ID: 916028496

View in Genome Browser
Species Human (GRCh38)
Location 1:160855961-160855983
Sequence GCCCCACACCTTCCTCCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916028496_916028501 3 Left 916028496 1:160855961-160855983 CCAGTCGGAGGAAGGTGTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 916028501 1:160855987-160856009 AGCACCTGGGAGAAGGAGCACGG 0: 1
1: 0
2: 1
3: 53
4: 516
916028496_916028505 8 Left 916028496 1:160855961-160855983 CCAGTCGGAGGAAGGTGTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 916028505 1:160855992-160856014 CTGGGAGAAGGAGCACGGGAGGG 0: 1
1: 0
2: 3
3: 55
4: 478
916028496_916028499 -4 Left 916028496 1:160855961-160855983 CCAGTCGGAGGAAGGTGTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 916028499 1:160855980-160856002 GGGCCTGAGCACCTGGGAGAAGG 0: 1
1: 2
2: 53
3: 672
4: 1231
916028496_916028506 23 Left 916028496 1:160855961-160855983 CCAGTCGGAGGAAGGTGTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 916028506 1:160856007-160856029 CGGGAGGGTCTCAGAGCAAGTGG 0: 1
1: 0
2: 2
3: 18
4: 174
916028496_916028504 7 Left 916028496 1:160855961-160855983 CCAGTCGGAGGAAGGTGTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 916028504 1:160855991-160856013 CCTGGGAGAAGGAGCACGGGAGG 0: 1
1: 0
2: 3
3: 35
4: 418
916028496_916028502 4 Left 916028496 1:160855961-160855983 CCAGTCGGAGGAAGGTGTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 916028502 1:160855988-160856010 GCACCTGGGAGAAGGAGCACGGG 0: 1
1: 0
2: 2
3: 45
4: 351
916028496_916028498 -10 Left 916028496 1:160855961-160855983 CCAGTCGGAGGAAGGTGTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 916028498 1:160855974-160855996 GGTGTGGGGCCTGAGCACCTGGG 0: 1
1: 0
2: 5
3: 36
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916028496 Original CRISPR GCCCCACACCTTCCTCCGAC TGG (reversed) Intronic
903211779 1:21822897-21822919 GCCCCACAGCTACCTGAGACGGG - Exonic
903890620 1:26567953-26567975 GCCCGACTCCTTCCTGTGACTGG + Intronic
906208382 1:43998970-43998992 GCCCCCCCCCTTCCCCCGCCAGG - Intronic
906742932 1:48199946-48199968 GCCCCACACGTGCCTGCAACAGG + Intergenic
907462309 1:54612208-54612230 TCCCCACAGCTTCCTCCAATAGG - Intronic
911665109 1:100543054-100543076 GCCCCACTCTATCCTCCAACTGG - Intergenic
912205448 1:107503448-107503470 TACCCACACCCTCCTCCAACAGG + Intergenic
916028496 1:160855961-160855983 GCCCCACACCTTCCTCCGACTGG - Intronic
916526681 1:165617145-165617167 GCACCACACCTTCCCCCAACTGG + Intergenic
916749900 1:167714395-167714417 GCCCCGCACTTTCCTCAGCCCGG + Intergenic
917304640 1:173613444-173613466 GCCCCCCACCTCCCTCCCAGAGG - Intronic
922572472 1:226642194-226642216 GCCCCAAACCTTCATCCACCAGG - Intronic
922757504 1:228104751-228104773 GCCCCACACCATCCTGAGATGGG - Intronic
1063187378 10:3663640-3663662 GCCCCACACCTTCCACAGATGGG + Intergenic
1063187400 10:3663734-3663756 GCCCCTCACCTTCCACGGATGGG + Intergenic
1067467009 10:46508541-46508563 GCCACAGACCTTCCTCAAACAGG - Intergenic
1067620177 10:47876064-47876086 GCCACAGACCTTCCTCAAACAGG + Intergenic
1067706120 10:48607554-48607576 TCCCCACTCCATCCTCCCACAGG - Intronic
1067841050 10:49679763-49679785 GCACCACACCTTCCGCCTGCAGG + Exonic
1068001346 10:51337821-51337843 TCCCCACACCCTCCTCCAAATGG - Intronic
1069508602 10:69023265-69023287 CCCCCACACCATCCTGCGTCTGG + Intergenic
1073035584 10:100562473-100562495 GCCCCCGACCTTCCGCCGACTGG + Intergenic
1073815688 10:107204186-107204208 ACCCCCTACCCTCCTCCGACAGG - Intergenic
1076762109 10:132611079-132611101 ACCCCACATCCTCCTCTGACAGG - Intronic
1076762200 10:132611397-132611419 CTCCCACACCCTCCTCTGACAGG - Intronic
1076762352 10:132611847-132611869 CTCCCACACCCTCCTCTGACGGG - Intronic
1076762385 10:132611937-132611959 CTCCCACACCCTCCTCTGACAGG - Intronic
1076762399 10:132611982-132612004 CTCCCACACCTTCCTCTGACAGG - Intronic
1077096489 11:801254-801276 TCCCCCCAGCTTCCTCCAACCGG - Exonic
1077199489 11:1298377-1298399 CACCCACACCCTCCCCCGACTGG - Intronic
1083732466 11:64660260-64660282 GACCCACACCTGCCTCTGTCTGG - Intronic
1084116172 11:67044364-67044386 GCCCCACTCCTCCCTTCCACCGG - Intronic
1084400366 11:68939703-68939725 CCCCCTCTCCTTCCTCCGGCTGG - Exonic
1085504538 11:77049591-77049613 GCTCCATGCCTTCCTCCGGCAGG - Intergenic
1090915520 11:131159303-131159325 GGCCCACACCTTTCTCCCAGTGG + Intergenic
1091588926 12:1831578-1831600 GCCCCACACTTTCCTCCTGGTGG + Intronic
1091847696 12:3669918-3669940 ACCACACACCTTTCTCCCACAGG - Intronic
1094454252 12:30614581-30614603 CCCCGACCCCTCCCTCCGACAGG + Intergenic
1095970968 12:47901822-47901844 GCCCCACCCCAACCTCAGACAGG - Intronic
1096192818 12:49631419-49631441 CCCCCACCCTTTCCTCCGATGGG + Exonic
1096706424 12:53424991-53425013 GCCCCACGCTTTCCTCCTCCTGG + Intronic
1101315816 12:103627808-103627830 GCCCCTCACCTTCCTCCACTGGG + Intronic
1103565481 12:121813102-121813124 GCTCCAGACCTTCTTCTGACTGG + Intronic
1104635295 12:130434696-130434718 GCCCCACACCATCCTCCTGGTGG - Intronic
1104957142 12:132472500-132472522 GCCTCACCCCTTCCTCGGGCAGG - Intergenic
1106136399 13:26976849-26976871 GCCCCACACATTCCCACGCCAGG + Intergenic
1113320292 13:109226260-109226282 GCTCCTCACATTCCTCTGACTGG - Intergenic
1117133289 14:52707149-52707171 GCCCCGCCCCTTCCCCCGCCCGG + Intergenic
1118466655 14:66037480-66037502 TCCCCAGAACTTCCTCCTACAGG + Intergenic
1119808698 14:77499010-77499032 GTCCCCCACCCTCCTCCGAGGGG + Intergenic
1119879204 14:78086797-78086819 GCCCAATCCCTTCCTCCAACAGG - Intergenic
1121441847 14:93954483-93954505 GACCCACTCCTTCCTCTCACAGG - Exonic
1122365378 14:101192069-101192091 GCCCCACACTTTCCTCAGTCAGG - Intergenic
1122886576 14:104713044-104713066 GCCCCTGGCCTTCCTCCGGCAGG + Intronic
1124221891 15:27856452-27856474 CCCCCACAGCTTCCTGCCACAGG - Intronic
1127074948 15:55316419-55316441 GCCCCCCACCCGCCCCCGACAGG - Intronic
1130053592 15:80504085-80504107 CCCCCACACCTTCCTCCATTTGG + Intronic
1132391662 15:101443564-101443586 CCCTCACACCTTCCTCAGAATGG - Exonic
1132747882 16:1444497-1444519 GCCCCACACCTGCCTCCCTGGGG - Intronic
1137270097 16:46897716-46897738 GCCAATCACCTTCCTCCGGCAGG + Exonic
1138196672 16:55057382-55057404 CCCCTACACCTTCCCCCCACGGG - Intergenic
1138483037 16:57316808-57316830 GCCAAACTCCTTCCTCAGACAGG + Intergenic
1142033720 16:87851296-87851318 GCCCCTCACCCACCCCCGACGGG - Intronic
1142058364 16:88014673-88014695 TCCCCACACCATCCTCGCACTGG + Intronic
1142329570 16:89442766-89442788 GGCACACACCTTCCTGCCACCGG - Intronic
1144366026 17:14545721-14545743 GTCACACACCTTTCTCTGACTGG + Intergenic
1144766951 17:17738191-17738213 CCCCCTCACCTTCCTCTGTCAGG - Intronic
1150218821 17:63484549-63484571 GCCCCACACCATCCTCACTCAGG - Intergenic
1151780191 17:76240399-76240421 GCCGCGCACCATCCTCCGCCGGG + Intergenic
1152095398 17:78269181-78269203 ACCCCACACTTGCCTCCGAGGGG - Intergenic
1152658983 17:81533801-81533823 GCCCCACACCCCCTTCAGACAGG - Intronic
1152706222 17:81844989-81845011 GCCCCACACCTTCGCCCAGCAGG - Intronic
1152912106 17:83010814-83010836 GCTCCACCCATTCCCCCGACAGG + Intronic
1153242845 18:3046359-3046381 GCCTCACACATTCTTCAGACTGG - Intergenic
1161046853 19:2139695-2139717 GCCCCTCTCCATCATCCGACAGG + Intronic
1162641573 19:12014459-12014481 GCTCCACACCTACCTCCCTCAGG + Intergenic
1167072165 19:47227694-47227716 CCCCCTCTCCTTCCTCCGCCGGG + Intronic
1167275727 19:48538064-48538086 GCCCCCCACCCCCCACCGACAGG + Intergenic
928722151 2:34133144-34133166 GCCCCCCACCTCCCCCGGACGGG + Intergenic
929997893 2:46840437-46840459 GCCCCACATCTTCCTGCTCCTGG + Intronic
931249203 2:60515281-60515303 GCCTCACACCTTCCCTGGACAGG + Intronic
932304473 2:70692115-70692137 GCCCCACGCCTTGGTCCAACAGG + Intronic
932487787 2:72094951-72094973 GCCCCACCCTTGCCTCCAACTGG - Intergenic
932573517 2:72950634-72950656 GCCCCACACTTACCTCAGAGAGG - Intronic
934138666 2:89022933-89022955 CCCCCACACCTGCCTCTGCCTGG + Intergenic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
941732277 2:168932156-168932178 ACCCCACACCATCCCCTGACAGG + Intronic
942776804 2:179591444-179591466 GGCCAACCCCTTCCTCCCACTGG - Intronic
945066239 2:205949793-205949815 GCCCGACACCTGCCTCGGCCAGG - Intergenic
946418551 2:219552436-219552458 GCCCCGCCCCTGGCTCCGACGGG - Intronic
948551420 2:238775437-238775459 GCCTCACAACTTATTCCGACTGG - Intergenic
1168786527 20:544345-544367 GCCCAATTCCTTCCTCCTACAGG + Intergenic
1170655853 20:18287626-18287648 GCCCTTCACCTTCCTCAGATAGG - Intergenic
1172519744 20:35559028-35559050 GCCCCAAAACTTCCTTCAACTGG - Intergenic
1173229717 20:41184700-41184722 GCCCCTCACCTTCCACAGTCAGG - Exonic
1173477019 20:43367029-43367051 GCCCCACTCCTTCCTCCCTCTGG - Intergenic
1175727531 20:61329844-61329866 CCCCCACCCCATCCCCCGACAGG + Intronic
1177011076 21:15730464-15730486 GCCCCACTTCTCCTTCCGACGGG + Intronic
1181235539 22:21445893-21445915 GCCCCACTCCTTCTTCCGAGTGG - Exonic
1183422964 22:37723065-37723087 ACCCCACACCCTCCTCCTACAGG - Intronic
1183994270 22:41621113-41621135 GCCCCGCCCCTTCCTACGTCAGG - Intronic
1184664716 22:45982189-45982211 CCACCACACCTCCCTCCGCCAGG + Intergenic
949933293 3:9097540-9097562 GACCCAGACTTTCCTCCCACTGG + Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
954687817 3:52380122-52380144 GCCCCTCACCTTACTCTCACTGG - Exonic
955412856 3:58667139-58667161 GCCCCACACCTCCCAGCGCCTGG - Intergenic
962129866 3:132660712-132660734 CCCCCGCGCCTGCCTCCGACCGG - Exonic
965770186 3:172173812-172173834 GCCCCACCCCTCCCCCAGACAGG - Intronic
968517336 4:1020772-1020794 GCCCCACCCCTTCCCCTGCCTGG - Intronic
968690958 4:1989947-1989969 GCCCCACACCCTCCTCAGTTAGG + Intronic
968797975 4:2721645-2721667 GCTTCACACCTTCCTCCAGCAGG - Intronic
972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG + Intronic
972938450 4:44167963-44167985 GCCCCCCACCTCCCTCCCAGAGG - Intergenic
973728032 4:53795466-53795488 CCCCCACCCCATCCCCCGACAGG - Intronic
973945217 4:55948686-55948708 GATCCACACCTCCCGCCGACAGG + Intergenic
976396070 4:84557003-84557025 TCCCCACACCCCCCTCCAACAGG - Intergenic
979491762 4:121336291-121336313 TCCCCACACCTTTGTCAGACAGG - Intronic
989706359 5:44336494-44336516 TCCCCACACCCTCCTCCTCCGGG + Intronic
992505408 5:77382579-77382601 CCCCCACCCCACCCTCCGACAGG + Intronic
997104989 5:131008384-131008406 GCCCCGCGCCTACCTCCCACCGG - Intergenic
997117875 5:131145419-131145441 CCCCCAGACCCCCCTCCGACAGG - Intergenic
998586655 5:143433987-143434009 GCCACACACCTTCCTACCTCAGG + Intronic
1001763690 5:174227853-174227875 TTCCCACTCCTTCCTCCGGCAGG - Intronic
1006739174 6:36295099-36295121 ACCCCACACTTTCCTCCCAGGGG + Intronic
1006844288 6:37051731-37051753 GCCCACCTCCTTCCTCCCACAGG + Intergenic
1007126009 6:39426352-39426374 GCAGCACAACTTCCTCAGACTGG + Intronic
1007851284 6:44804906-44804928 GCCTCACACCTTGCTCTTACAGG + Intergenic
1009750676 6:67875251-67875273 TCCCTCCACCTTCCTCTGACAGG - Intergenic
1012532041 6:100249932-100249954 TCCCCACTCCTTTCTCCAACTGG + Intergenic
1013225953 6:108119500-108119522 GCCCCACGCCTTCCTCGGTGGGG - Intronic
1013330426 6:109094957-109094979 GCCCCTCCCCTTTCTCCGCCCGG + Intergenic
1015190543 6:130467317-130467339 GCCCCACACCTTTCTCAAGCAGG + Intergenic
1016923524 6:149318074-149318096 GCCCCGCACCCCCCTCCGTCTGG + Intronic
1019356848 7:584744-584766 GCCCCCCACCTCCCTCCTCCCGG + Intronic
1019519542 7:1454522-1454544 GCCCCACACTTTCCTTCCAGAGG - Intronic
1019604611 7:1902163-1902185 GCCCCACACCTGCCTCCTCCTGG + Intronic
1019696941 7:2451433-2451455 GGCTCACACCTTCCTCGGGCAGG - Intergenic
1021451777 7:20788926-20788948 CCCCCACCCCTTCCTCCTTCTGG - Intergenic
1022364756 7:29701551-29701573 TCCCCACCCCATCCCCCGACAGG + Intergenic
1025176174 7:56803544-56803566 GCCCCACTCCTGCCTCCCAGGGG - Intergenic
1025695619 7:63772878-63772900 GCCCCACTCCTGCCTCCCAGGGG + Intergenic
1025829569 7:65038052-65038074 GCCCCACCCCTTTCTCCCCCGGG + Intergenic
1025912359 7:65839081-65839103 GCCCAGCTCCTGCCTCCGACGGG + Intergenic
1025916806 7:65873001-65873023 GCCCCACCCCTTTCTCCCCCGGG + Intergenic
1039889496 8:41674494-41674516 GCCCCACCCTTTCCTACAACAGG + Intronic
1045112260 8:98947251-98947273 GGCCCACACCTTCCTCTGGAAGG - Intronic
1048136205 8:131748778-131748800 CCCCCGCACCCTCCTCTGACAGG + Intergenic
1049325005 8:142017169-142017191 GCCCGACACCTTCCTGCCCCTGG - Intergenic
1049606864 8:143533625-143533647 TCCCCACCCCTTCCTCAGACAGG + Intronic
1049797838 8:144504672-144504694 GCCCATCACCTTCCTGCGCCAGG + Exonic
1055785331 9:79864433-79864455 GCCCCACACCTTTCTCCTTCCGG + Intergenic
1058285470 9:103171446-103171468 CCCCCCCTCCTTCCTGCGACAGG - Intergenic
1058705526 9:107634970-107634992 GCTCCACAGTTTCCTCAGACGGG + Intergenic
1060927104 9:127462668-127462690 CCCCACCACCCTCCTCCGACAGG - Intronic
1061133861 9:128722515-128722537 GCCCCTCACCTTCCTGCTCCTGG - Exonic
1061194828 9:129102123-129102145 TCCCCACACCTGCCTCCTCCTGG + Intronic
1061883458 9:133579207-133579229 GCCCCCCACCTTCTTCCTGCAGG - Exonic
1193303407 X:79920309-79920331 CCCCCAGCCCTACCTCCGACAGG - Intergenic
1198667533 X:139041047-139041069 CCCCCACCCCCACCTCCGACAGG - Intronic
1199700444 X:150371540-150371562 GACCCACACTTTCCTCTCACAGG - Intronic
1199996718 X:153030650-153030672 GCCCCCCACCTCCCTCCAAAGGG + Intergenic
1201948313 Y:19535824-19535846 GCCCCCCACCTCCCTCCCAGAGG - Intergenic