ID: 916030908

View in Genome Browser
Species Human (GRCh38)
Location 1:160876806-160876828
Sequence TTTGTTTCCCAGCACTGCAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916030908_916030911 15 Left 916030908 1:160876806-160876828 CCAATGCAGTGCTGGGAAACAAA 0: 1
1: 1
2: 1
3: 16
4: 205
Right 916030911 1:160876844-160876866 TAATGAGAGATCTGCCAGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916030908 Original CRISPR TTTGTTTCCCAGCACTGCAT TGG (reversed) Exonic
900299060 1:1967672-1967694 TCTCTTTCCCAGCAGGGCATCGG + Intronic
900524573 1:3122203-3122225 GGTTTTTCCCAGCACTGCACGGG - Intronic
901515637 1:9744127-9744149 TTTGTTTCTAAGCCCTGCCTTGG - Intronic
901847877 1:11996019-11996041 TTTGTCTCTCAGCACTGTCTGGG + Intronic
902890712 1:19441391-19441413 TTTGTTGCCCAGCCCAGCACAGG + Intronic
903676239 1:25066350-25066372 TTTTTTTCCCAGCCCTCCTTTGG + Intergenic
904279460 1:29408819-29408841 TTTCTATCCCAGCAGTGCCTGGG - Intergenic
905584667 1:39106744-39106766 TTAGTTTCCCTTCACTGGATAGG - Intronic
906527953 1:46507348-46507370 TTTGTTTGCCAGCACTGTCCAGG + Intronic
907348262 1:53802709-53802731 TCTGTTTCCCACCAGTGCCTGGG + Intronic
908286063 1:62604146-62604168 TTTGTTTTCCGGGATTGCATTGG - Exonic
908559182 1:65287933-65287955 TGTTCTTCCCAGCACTTCATGGG - Intronic
908824993 1:68124600-68124622 TTTGATTCCTGGCACTGCAGTGG + Intronic
909124287 1:71645880-71645902 TTGGCTGCCTAGCACTGCATAGG + Intronic
910052386 1:82990558-82990580 TTTGTTTTTCAGCAATGCCTGGG - Intergenic
910475255 1:87598923-87598945 TTTATTTTCCAGCACTGCCCTGG - Intergenic
910876487 1:91883626-91883648 TTTGAATCCCAGCACTTCAAAGG - Intronic
912952063 1:114127116-114127138 TTTGTTTTCCAGCATCACATGGG + Intronic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
916030908 1:160876806-160876828 TTTGTTTCCCAGCACTGCATTGG - Exonic
916038870 1:160945282-160945304 TCTGTTTCCCAGCACTGCATCGG - Exonic
916358777 1:163943700-163943722 TTTTTTTTCCAGCACAGGATTGG + Intergenic
917418127 1:174832822-174832844 TTTGTTTGAAAGCAGTGCATTGG + Intronic
917499829 1:175576112-175576134 TTTATTCCCCAGCACTGCTGTGG + Intronic
918911083 1:190570538-190570560 TTTATTTCCCAGAATTACATTGG + Intergenic
919394421 1:197026474-197026496 TTTTTTTCTCAGCATTGCTTTGG + Intergenic
921749575 1:218776879-218776901 TAGGTACCCCAGCACTGCATAGG + Intergenic
922908115 1:229191474-229191496 GTGGTTTCACACCACTGCATAGG - Intergenic
924471071 1:244343050-244343072 TTTTTTTTCCAGCACCACATAGG - Intergenic
1063014010 10:2056791-2056813 TGTGTTTCCCAGCAGTACAAAGG - Intergenic
1063703022 10:8404045-8404067 TTTTTTTCTCATCACTGCCTTGG - Intergenic
1063977609 10:11429806-11429828 TTTGTCTCCCAGAACTGGGTGGG - Intergenic
1064844805 10:19639993-19640015 TTTCTTTCCCCCCAATGCATAGG + Intronic
1065626214 10:27631532-27631554 TTTGTCTCCCAGGAGTGCAGTGG - Intergenic
1067672532 10:48336786-48336808 TTTATTTCTCAGCACTTTATAGG + Intronic
1068446537 10:57131883-57131905 TTTGTTGCCCAGGAGTGCAGTGG - Intergenic
1069580906 10:69566125-69566147 ATGGTTTCCCATCATTGCATAGG - Intergenic
1070159049 10:73854593-73854615 TTTGTCTCCTAGCACTGAACTGG - Intronic
1070428514 10:76313106-76313128 TTTGTGTCCCAGCTCTGCCAAGG + Intronic
1071267833 10:83980060-83980082 TTTGGATCCCAGCTCTGAATAGG + Intergenic
1072381314 10:94874092-94874114 TTATTCTCCCATCACTGCATAGG + Intergenic
1077699966 11:4432143-4432165 CATGTTTCCCAGCACTGCCAGGG + Intergenic
1077814079 11:5668487-5668509 TTTGTTGCCCAGGAGTGCAGTGG + Intronic
1077960654 11:7073390-7073412 TTTGGTGACCAGAACTGCATGGG - Intergenic
1078751008 11:14163759-14163781 TTTGGTTCCCACCACAGCACGGG - Intronic
1079306348 11:19326982-19327004 TTGGTTTGCCAACACTGCTTTGG + Intergenic
1083232160 11:61329574-61329596 TTTGTTTCTCAGGACCGCATTGG - Exonic
1086180758 11:83948600-83948622 TTTTTTTTCCAGTACTACATAGG - Intronic
1086941204 11:92800435-92800457 GTTGTTCACCAGCACTGCACAGG + Exonic
1087229271 11:95641531-95641553 TTTGTTTCCCAGAAGCCCATAGG + Intergenic
1087814817 11:102647009-102647031 TTTGTTTCGTAGTACTGCTTTGG + Intergenic
1088243599 11:107795230-107795252 TTGGTTGCCCAGCATTGCTTTGG - Intronic
1088838540 11:113602385-113602407 TTTATTTCCCAGGAATGCAGGGG - Intergenic
1089766229 11:120767999-120768021 TTTCTTTCTCAGTACTGCTTTGG + Intronic
1089817160 11:121186634-121186656 TTTGTTTCAAAGCACTTCAGAGG + Intronic
1092455495 12:8639069-8639091 TTTGCATCCCAGCACTGCCCTGG + Intronic
1093770765 12:23015084-23015106 ATTGTTTCCCAACAATACATAGG + Intergenic
1098332671 12:69370746-69370768 CTTTTTCCCCAGCATTGCATTGG - Exonic
1098560119 12:71863722-71863744 TTTTTTTCCCCTCACTGAATAGG + Intronic
1099994828 12:89767233-89767255 TTTGATTCCCTGCACAGCCTTGG + Intergenic
1102212861 12:111139496-111139518 TTATTTTTCCAGCACTGCGTTGG + Intronic
1102213079 12:111141114-111141136 TTATTTTTCCGGCACTGCATTGG - Intronic
1105472625 13:20706029-20706051 TTGGCTTCCCAGGACAGCATAGG - Intronic
1105830848 13:24161734-24161756 TTTGCTTCCCAGCATTGCATAGG + Intronic
1107736773 13:43406995-43407017 TTTCTTGCCCAGGCCTGCATGGG - Intronic
1108094649 13:46888457-46888479 TTTTTTTTTCAGCACTTCATAGG - Intronic
1108466609 13:50722464-50722486 TTTGTTTCCCAGAAGTGTAGTGG - Intronic
1110419848 13:75294325-75294347 ACTGTCCCCCAGCACTGCATTGG + Intronic
1110979675 13:81880386-81880408 TTACCTGCCCAGCACTGCATTGG + Intergenic
1111760527 13:92458336-92458358 TTTGTTGCCCAGGAGTGCAGTGG + Intronic
1111903995 13:94234118-94234140 TCTGTCTCCCAGCATTGCAGGGG - Intronic
1114521871 14:23344570-23344592 TTTGTTCCATAGCACTGCCTGGG - Intergenic
1114750851 14:25203265-25203287 TTTATTTGCCATCACTGCTTTGG - Intergenic
1118822802 14:69355930-69355952 GATGTCTCCCAGCACTGCATGGG + Exonic
1119063810 14:71505191-71505213 TTTATTTCCCCGCATTGCCTGGG + Intronic
1119745849 14:77043404-77043426 TTTTTTTCCCAGCAGTACTTTGG - Intergenic
1120968983 14:90191834-90191856 TTTTGTTCCCAGCACTGGTTAGG - Intergenic
1123917900 15:25050695-25050717 TATGTTTCCGAACACTGCAAAGG - Intergenic
1125242517 15:37592289-37592311 TTTGTTACCCAGCAACACATTGG + Intergenic
1127806331 15:62524207-62524229 TTTATTTCCCAGCATTGAAAAGG - Intronic
1131234478 15:90684057-90684079 TTTCCCTCCCAGCCCTGCATAGG + Intergenic
1131549288 15:93342970-93342992 TTTCTTTCCCAACACTGCACTGG - Intergenic
1134135723 16:11675119-11675141 TTTGTCACCAGGCACTGCATCGG - Intronic
1134540374 16:15059208-15059230 TTAGTTTCTCAGCACTCCAAGGG + Intronic
1135187308 16:20326459-20326481 TTTCTTTCCCATAGCTGCATGGG - Exonic
1136284018 16:29230806-29230828 TTTGTGTCCGGGCACTGCCTGGG + Intergenic
1137557545 16:49481710-49481732 CTTCTCTCTCAGCACTGCATTGG - Intergenic
1141325183 16:83050396-83050418 TTTAATTCCCAGCAGAGCATTGG + Intronic
1141365746 16:83440990-83441012 TTGGTTTCCTAGAACTGCAGTGG - Intronic
1143540223 17:7563995-7564017 TCTGTTTCCTAGCTCTGCCTGGG - Intronic
1144195251 17:12888249-12888271 TTTTTTTCCCAGCACAACTTTGG + Intronic
1144260023 17:13509305-13509327 TTTGTTTCCCAGGGTTACATGGG - Intronic
1149429402 17:56585335-56585357 TTTATTTCCCAGCCCAGCAGTGG + Intergenic
1149464550 17:56866646-56866668 CTTGTCCCCCAACACTGCATGGG - Exonic
1152296335 17:79469356-79469378 CTGGATTCCCAGGACTGCATGGG - Intronic
1153322449 18:3786357-3786379 TTGGTTTCCTAGTACTACATAGG - Intronic
1153809933 18:8743345-8743367 TGTCTTTCCCAGCACAGTATAGG + Intronic
1155248335 18:23932657-23932679 TTGGTTTCCTAGCACAGCACTGG - Intronic
1155421055 18:25656513-25656535 TCTGTTTGCAGGCACTGCATAGG - Intergenic
1156183726 18:34637413-34637435 TTTCTTCCCCAGAACTGGATGGG + Intronic
1163395676 19:17059287-17059309 TGCCTTTCCCAGCACAGCATGGG + Intronic
925207120 2:2016212-2016234 TTTGTTTGCCATCCCTGCCTGGG - Intronic
925842428 2:8005199-8005221 TCTGTTTCCCAGGAGTGCAGTGG + Intergenic
926971966 2:18475448-18475470 TTAGTTTCCCAGCTTTACATAGG - Intergenic
928217430 2:29373601-29373623 ATTGTTTCTAAGCACTTCATGGG + Intronic
928317633 2:30258408-30258430 TTTGCTTCCCAGCACTTTTTAGG + Exonic
929389603 2:41454684-41454706 TTTGTTTCTTAGCACTTGATGGG - Intergenic
930156761 2:48113800-48113822 TTTGTTTCCCAGCCCTGGTGTGG + Intergenic
930209619 2:48621158-48621180 TTGGTTTCCCAGAGCTGCAGAGG - Exonic
930296908 2:49566069-49566091 TTTTTTCCCCAGCAGTGGATGGG + Intergenic
930773923 2:55154442-55154464 TCTGGTTCCCAGCACCGCAGAGG - Intergenic
931987584 2:67756490-67756512 TTTGTGTCCTATCACTGCAGGGG + Intergenic
933384737 2:81596103-81596125 GTTGTTTCTCTGCACTTCATAGG + Intergenic
934524157 2:95041124-95041146 TCTGTTACCCAGCCCTGCAGCGG + Intronic
934604120 2:95681430-95681452 TTTGGTGCCCAGCACAACATAGG + Intergenic
935039733 2:99414767-99414789 TTTGTTCCCCAGAACTGTAACGG - Intronic
936050100 2:109216127-109216149 TCTGGTTCCCAGCTCAGCATCGG + Intronic
936065095 2:109325140-109325162 GTTGTTTCCGAGCACTGCAGAGG - Intronic
936537511 2:113323664-113323686 TTTGGTGCCCAGCACAACATAGG + Intergenic
938991896 2:136638161-136638183 TTTGCTTCCCAGCACACCATTGG - Intergenic
939235041 2:139480324-139480346 TTTGTTTCCCATCATTTCAATGG - Intergenic
947137725 2:226991911-226991933 ATAGTTTCCCAGCTCTGCCTGGG - Intronic
1170369849 20:15636922-15636944 TTTTTTTCCAAGAACTGCCTGGG + Intronic
1171017815 20:21557646-21557668 TTTGTTACCCAGCACAGCGGTGG + Intergenic
1171401925 20:24879257-24879279 TGTCTTGTCCAGCACTGCATAGG - Intergenic
1174122361 20:48275870-48275892 CTTGCTTCCCAGCACTGAATTGG - Intergenic
1175033113 20:55974591-55974613 TGCTTTTCCCAGCACTGCACTGG - Intergenic
1175033214 20:55975264-55975286 TGCGTTTCCCAGCACTGCCTTGG - Intergenic
1176983414 21:15408767-15408789 CATGTTTCCCAGCACCCCATAGG - Intergenic
1177516516 21:22158648-22158670 TTTGTTGCCCAGGGCTGCCTTGG - Intergenic
1179362494 21:40725342-40725364 TTTTTTTTCCATCACTGCTTTGG - Intronic
1181798630 22:25328474-25328496 TTTGTCACCCAGGAATGCATTGG + Intergenic
1182311048 22:29407131-29407153 TTTGTCACCCAGGAGTGCATTGG + Intronic
1182690060 22:32153982-32154004 TTTGTCGCCCAGGAGTGCATTGG - Intronic
1182916041 22:34031666-34031688 TTTCTTTCTCAGAACTGCTTTGG + Intergenic
1184400289 22:44270025-44270047 TTTGTGTCCCCCCACTGCCTCGG + Intronic
1185129269 22:49028423-49028445 TCTGTGTCCCAGCACTGTCTGGG + Intergenic
949104792 3:191045-191067 TTTTTTTACAAGCATTGCATTGG - Intergenic
949249396 3:1964734-1964756 TTTTTTTCACAGATCTGCATGGG - Intergenic
949901858 3:8821725-8821747 TATGTTTTCAAGCACTGAATTGG - Intronic
949945167 3:9184290-9184312 TTTGTTTCACAGCACAGCAAGGG + Intronic
950149207 3:10673177-10673199 TTTGTTTCCCACAAATGCATCGG + Intronic
954687340 3:52378057-52378079 TTGGGTTCCCAGCACAGAATTGG + Intronic
954884818 3:53863593-53863615 TTTGTTTTACAGCACCGTATAGG + Intronic
955173889 3:56592990-56593012 CTTGTTTCACAGCACTGAAAGGG - Exonic
955589404 3:60518497-60518519 ATTGTATACTAGCACTGCATGGG - Intronic
956325613 3:68049465-68049487 TTTGTTTTCCAACACTGAAGAGG + Intronic
957006909 3:74959439-74959461 TTTCTTTCCCTGTACTGCATAGG + Intergenic
960874709 3:122284997-122285019 TCCGTTTCCCCGCACTGCAGCGG - Exonic
963748058 3:149145745-149145767 TTTGTTTCCCTAGACTGGATAGG + Intronic
964994149 3:162853831-162853853 TTGGTGTCACAGCACTGCACAGG + Intergenic
965170826 3:165262386-165262408 TTTCCTTCTCAGCACTGCACAGG - Intergenic
966130023 3:176626877-176626899 TTTGTTTCCAAACACTTCAAGGG + Intergenic
969403114 4:6970261-6970283 TTTGTATCCCAGCTCTGCTACGG + Intronic
975658589 4:76666055-76666077 TTTTTTTCCCAGTAATCCATAGG - Intronic
975913082 4:79291682-79291704 TTTGCTGCCCAGGAGTGCATTGG - Intronic
976458498 4:85279105-85279127 CTTGTATCCCAGCATTTCATGGG - Intergenic
977063966 4:92289719-92289741 TTTTTTGCCCAGGATTGCATTGG + Intergenic
978805706 4:112798325-112798347 TTTGTTGCCCAGGAGTGCAATGG + Intergenic
978983162 4:114976895-114976917 CTTGTTTCTCAGCACAGTATGGG - Intronic
979408332 4:120342319-120342341 ATTGTCTCCCAGCAATGAATGGG + Intergenic
984836098 4:184022710-184022732 TTAGTTTCCCGGAACTGCAGAGG - Exonic
985654486 5:1122846-1122868 GTTGTTACCCATCACTACATAGG - Intergenic
986573701 5:9191267-9191289 TTTATTTCCCAGCATTGTACAGG - Intronic
986638255 5:9846147-9846169 TTTGTTTTCTAGCCCTTCATCGG - Intergenic
991252370 5:64577842-64577864 TTTTATTCCCAGGTCTGCATTGG + Intronic
991507304 5:67338683-67338705 TTTCTTTTCCAGCCATGCATGGG + Intergenic
991982905 5:72251787-72251809 TTTATTTCCCAGCCTTGGATGGG - Intronic
994062376 5:95493715-95493737 TTTTTTTCCCAACAGTGCTTAGG + Intronic
994157506 5:96520241-96520263 TCTGTTTCCCAACACTGATTTGG + Intergenic
994591848 5:101783677-101783699 TTTTTCTCCCAGCACTGGGTAGG - Intergenic
994608627 5:102006313-102006335 CTTCTTTCCTAACACTGCATAGG - Intergenic
997359205 5:133283708-133283730 GTTGGCTCACAGCACTGCATGGG + Intronic
997607813 5:135188391-135188413 TGTGTTTCTGAGCTCTGCATAGG + Intronic
1001239630 5:170058146-170058168 TTTGCTTCTCAGCACAGCTTAGG + Intronic
1001668741 5:173456034-173456056 TTTGTCTCCCAGCAATGCCATGG + Intergenic
1006399134 6:33805960-33805982 TCTGTTTCCCAGGAGTGCAGTGG - Intergenic
1012857657 6:104521711-104521733 ATTCTTTCACATCACTGCATGGG - Intergenic
1017787365 6:157767845-157767867 ATTGATTCCCAGAACTGCCTTGG + Intronic
1018935729 6:168273015-168273037 TTCGTCTCACAGTACTGCATGGG + Intergenic
1020955877 7:14739815-14739837 TTTTTTTCCCAGGACTGTAATGG + Intronic
1022804630 7:33809302-33809324 TGTGTTTCACAACACAGCATAGG - Intergenic
1023695054 7:42837048-42837070 TTTCTTTCACAGGACTGGATTGG + Intergenic
1028921773 7:96317543-96317565 TTTGTTTCCAACCACTGGATTGG + Intronic
1030517579 7:110557443-110557465 TTTGCTTTCCAGCAGTGTATAGG - Intergenic
1030912804 7:115273924-115273946 TTTTATTCCCAACACTGCACGGG + Intergenic
1032756427 7:134895079-134895101 TTTATTTCCCAGCACTGTTTTGG - Intronic
1033851320 7:145499090-145499112 TTTGTTTCTCAGACATGCATGGG + Intergenic
1039240746 8:35553793-35553815 CCTGTTTCCCAGCTCTGCCTTGG - Intronic
1039357528 8:36837500-36837522 TTAGTATCCCAGCAGTGAATTGG + Intronic
1040369851 8:46758648-46758670 TTTCTTTCTCAGCACTGAGTTGG - Intergenic
1041250352 8:55928019-55928041 TATGTTCCCCAGCAATGAATTGG + Intronic
1043378537 8:79677832-79677854 TTTGTTTTCCATTACTGCAGTGG - Intergenic
1046563311 8:115867041-115867063 TTATTTTGCCAGCACTGCAAAGG - Intergenic
1047035182 8:120930421-120930443 TTTGTTTACCAGCACACCACTGG + Intergenic
1048443138 8:134474866-134474888 TTTGCTTCTCAGGACAGCATTGG - Intergenic
1048736817 8:137511220-137511242 TATCTTTCCCAACACTACATTGG + Intergenic
1050157799 9:2686137-2686159 TTTGTCTCCCAGGAGTGCAGTGG + Intergenic
1050643026 9:7689017-7689039 TGAGTTTCACAGCACTGTATGGG - Intergenic
1051668792 9:19490030-19490052 TATGTTGCCCTGCATTGCATAGG + Intergenic
1051930449 9:22379114-22379136 TCTTCTTCCTAGCACTGCATGGG - Intergenic
1053603553 9:39633786-39633808 TTTGTTACCAGGCACTGCGTTGG + Intergenic
1054249984 9:62708633-62708655 TTTGTTACCAGGCACTGCGTTGG - Intergenic
1054564095 9:66743164-66743186 TTTGTTACCAGGCACTGCGTTGG - Intergenic
1056576935 9:87862663-87862685 TTTGTTTTCCTGCTCTGGATCGG + Intergenic
1057310579 9:93940587-93940609 GTTGTTTCCCAGAACTCCATGGG + Intergenic
1059239320 9:112789512-112789534 TTTGTTTGGTAGCACTGCATTGG + Intronic
1060415344 9:123425947-123425969 TTTGTTCACCAGCTCTTCATGGG - Intronic
1062270337 9:135705349-135705371 AGTGTGTCCCAGCCCTGCATGGG + Intronic
1185971937 X:4674890-4674912 TTTGTTTCCTTGCAATCCATCGG - Intergenic
1186471817 X:9827715-9827737 TTACTTTCCCAGAACTGCTTGGG - Intronic
1188241975 X:27803963-27803985 TCTGTTTCCCATTACTGCATTGG + Intergenic
1189301436 X:39955352-39955374 ATTCTTTCCCAGCACTTCCTGGG - Intergenic
1191954877 X:66633579-66633601 TTTGTTCCCCAGCTCTGGGTGGG - Intronic
1192180748 X:68914264-68914286 GTTGTTTCACTGCACTGCATTGG + Intergenic
1194323982 X:92487973-92487995 TCTGTTGCCCAGCAGTGCAGTGG + Intronic
1194913973 X:99682313-99682335 TTTCTTTCTGAGCACTGAATTGG - Intergenic
1198817510 X:140608360-140608382 CTTGTTTCCCTGCACAGCCTTGG + Intergenic
1199969439 X:152848403-152848425 TTTGATTCCCATCACTACAAGGG + Intronic
1200632085 Y:5601065-5601087 TCTGTTGCCCAGCAGTGCAGTGG + Intronic
1201541066 Y:15105513-15105535 TTTGTCACCCAGGAGTGCATTGG + Intergenic
1202268992 Y:23052374-23052396 TTTTTTTCCCTTCATTGCATTGG + Intergenic
1202421984 Y:24686114-24686136 TTTTTTTCCCTTCATTGCATTGG + Intergenic
1202448802 Y:24983964-24983986 TTTTTTTCCCTTCATTGCATTGG - Intergenic