ID: 916031201

View in Genome Browser
Species Human (GRCh38)
Location 1:160878954-160878976
Sequence TGAGATTCCTTGAGAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916031201 Original CRISPR TGAGATTCCTTGAGAAACAC AGG (reversed) Intronic
905383018 1:37577679-37577701 AGAGATTCATTGGGAATCACTGG + Intronic
905397702 1:37677674-37677696 TGTCATTCCTTCAGAATCACTGG + Intergenic
906830477 1:49026109-49026131 TGAGATTCTTGGAAAAACTCAGG + Intronic
907062162 1:51439316-51439338 TGAGATTTCTGTAGAAAAACTGG - Intronic
908201866 1:61805927-61805949 TAAGATTCTTTGTGAAACATAGG - Intronic
909300442 1:74006573-74006595 TCAGATTATTTGAGAAACAATGG + Intergenic
910713515 1:90205571-90205593 TATCATGCCTTGAGAAACACTGG - Intergenic
910796073 1:91099140-91099162 GGCCATTCCTTGAGAAACACTGG + Intergenic
911422634 1:97663230-97663252 TGAGATTCCTTGTGACAACCTGG - Intronic
912590645 1:110816136-110816158 TGAGACTTCTGGAGAAACAAAGG + Intergenic
914447744 1:147764142-147764164 TGATTTTCTTTGAAAAACACTGG - Intronic
915725888 1:158017228-158017250 AGAGAGCCCTTGAGAAACGCAGG - Intronic
916031201 1:160878954-160878976 TGAGATTCCTTGAGAAACACAGG - Intronic
918325819 1:183409816-183409838 TGAGAATACTTGAGCAACAAGGG + Intronic
918899840 1:190400820-190400842 TGACATTGATTCAGAAACACTGG + Intronic
919616992 1:199820339-199820361 TGAGCTGCCTTGAGAAAGGCAGG + Intergenic
922828638 1:228539066-228539088 TGAGATTCCTGGACAAACCCAGG - Intergenic
923207592 1:231773908-231773930 TGAAAGTCCTTGAGATACCCAGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063752967 10:8973061-8973083 TGCGATTCCTTCAGCTACACAGG + Intergenic
1064008308 10:11715200-11715222 TGAGCATCCTGGAGAGACACTGG + Intergenic
1064883586 10:20084561-20084583 TGAGATTCCTTGTGGAAGGCAGG + Intronic
1066554096 10:36592386-36592408 TAATATACATTGAGAAACACAGG - Intergenic
1068382074 10:56268313-56268335 TTAGATTCCTTGAAAAACGAAGG + Intergenic
1070823193 10:79375255-79375277 TGAGATTAGTTGAGATACAATGG - Intergenic
1071150342 10:82626955-82626977 TCAGCTACCTTGAGAAAGACAGG + Intronic
1073430333 10:103482011-103482033 GGATATTATTTGAGAAACACTGG + Intergenic
1073539238 10:104304932-104304954 TGAGTATTCTTCAGAAACACAGG - Intronic
1074877553 10:117625990-117626012 GGAGATTCCTAGAGAAACTATGG + Intergenic
1080337608 11:31216125-31216147 GGAGAATCCCAGAGAAACACTGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083391829 11:62357049-62357071 AGAGATTCCTGGAGAAAAACTGG + Exonic
1086051018 11:82590400-82590422 TGATAGTCCTCCAGAAACACTGG - Intergenic
1087296222 11:96377620-96377642 TGAGATTCTAGGAGAAACATTGG - Intronic
1088321911 11:108563314-108563336 TGTGGTTGCTTGAGAAACCCTGG - Intronic
1088588612 11:111380917-111380939 GGAGTTTCCATGAGAAACAGAGG + Intronic
1088773703 11:113061409-113061431 TGAGATTACTTATAAAACACAGG - Intronic
1089641323 11:119849111-119849133 TCAGCCTCCTTGACAAACACAGG - Intergenic
1090495432 11:127206678-127206700 TGTGCTTCCTGGGGAAACACAGG - Intergenic
1090623888 11:128588011-128588033 AGGGATTGCTTTAGAAACACAGG + Intergenic
1090749368 11:129732419-129732441 TTAGATTTCTTGACAAGCACTGG + Intergenic
1091467212 12:695402-695424 TGAGACCTCTTGAGGAACACAGG - Intergenic
1091849867 12:3686950-3686972 TGAGAAACCTGGAGAAACCCAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1097209574 12:57356294-57356316 TCAGCTTCCTTAAGAACCACTGG - Intronic
1097619132 12:61918854-61918876 TGAGGTTCTTTGGGAAATACTGG + Intronic
1097902773 12:64889904-64889926 TGGGAGACCTTGAGGAACACAGG - Intergenic
1098162924 12:67664288-67664310 TAAGCTTCCTTGAGACACATGGG - Exonic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1098968251 12:76818742-76818764 TGAAGTCACTTGAGAAACACAGG + Intronic
1100048580 12:90415033-90415055 TCAGATTGGTTGAGAAACAGAGG - Intergenic
1100475635 12:94932766-94932788 TGAGATTCCTTGACACAGGCTGG - Intronic
1100930931 12:99608752-99608774 TGAGACCCCTTGAAAAACACAGG - Intronic
1101898237 12:108771490-108771512 TGACATTTCTTGAGCCACACTGG - Intergenic
1103592629 12:122003180-122003202 TTTGATTCCTTGAAAAACTCTGG - Intronic
1105824979 13:24114498-24114520 TGAGATGCCAAGAGAAACAGTGG - Intronic
1106251007 13:27981390-27981412 CTAGATTCCCTGAGAACCACGGG - Intronic
1106806116 13:33309090-33309112 TCAGATTTAATGAGAAACACTGG + Intronic
1108467122 13:50727622-50727644 CGTGATTCCTTGGGAATCACAGG - Intronic
1108779955 13:53817611-53817633 TGAAATACTTTGAAAAACACTGG + Intergenic
1109032322 13:57207623-57207645 AGAGATTTTTGGAGAAACACGGG - Intergenic
1109848151 13:68024448-68024470 TGACCTTCCTCTAGAAACACTGG - Intergenic
1110275350 13:73635895-73635917 TGACCTTCCTTTAGGAACACTGG + Intergenic
1111462230 13:88560300-88560322 TGAGATTCCCTGATTAACCCAGG + Intergenic
1112101433 13:96193916-96193938 TGGAATTCCTTGAGGAACCCAGG + Intronic
1113664059 13:112128566-112128588 TGAGGCTCCTGGAGAAAAACAGG - Intergenic
1116226894 14:42164185-42164207 TGAAATTTCTTGAGAACCAGTGG - Intergenic
1118031133 14:61819099-61819121 TTAGATTCATTTAGAAACTCAGG - Intergenic
1118520654 14:66580756-66580778 TGAGAGAGCTTGAGAAACACTGG - Intronic
1119069575 14:71569121-71569143 TTATATTCCTTGAGTAACACTGG - Intronic
1119717761 14:76870756-76870778 TTAAATTCCTTGAGAAACTGGGG + Intergenic
1120912527 14:89680521-89680543 TGGAATTCTGTGAGAAACACGGG + Intergenic
1120954785 14:90072269-90072291 GGCGATTCGTTGAGAGACACAGG - Intronic
1122816666 14:104317299-104317321 TGAGTTTCCTGGAGTAACCCTGG - Intergenic
1202946161 14_KI270726v1_random:28789-28811 TGAGGTTCCTTGAGCAACTTAGG - Intergenic
1124000268 15:25753514-25753536 TGAGACCCCCTGAGGAACACAGG + Intronic
1124155506 15:27221775-27221797 TTTGAGTTCTTGAGAAACACAGG - Intronic
1125033462 15:35096306-35096328 GGAGATTCCTAGAGAAAAAAGGG + Intergenic
1125416903 15:39463283-39463305 TGAGAATCCTGAAGAAACTCTGG + Intergenic
1128531757 15:68456393-68456415 TCAGCTTCCTTGAGGTACACTGG - Intergenic
1138851267 16:60632636-60632658 TCAGACCCCTTGAGAAACACAGG - Intergenic
1140017942 16:71206170-71206192 TGTGCTTCCTGGGGAAACACAGG - Intronic
1140634990 16:76901942-76901964 TGATATTCCTGGAGAAACATGGG + Intergenic
1140703616 16:77605635-77605657 TGGGATTACCAGAGAAACACTGG + Intergenic
1140898996 16:79351009-79351031 TGAGAATCCTACAGACACACTGG + Intergenic
1142960344 17:3548540-3548562 AGAGATTCCTTGGGAAAGCCCGG - Intronic
1144149484 17:12429621-12429643 CAAGATGCCTTGTGAAACACAGG - Intergenic
1144342511 17:14321615-14321637 TGAGCTGCCTTGAGCAACCCTGG + Intronic
1147558531 17:41495082-41495104 TGAGATTTCTAGAGTAACTCCGG - Intergenic
1148843824 17:50516885-50516907 TGAGATTCATATAGAACCACAGG + Intronic
1152158682 17:78652973-78652995 TGAGAATCCCAGAGAAAAACGGG - Intergenic
1153516239 18:5904598-5904620 TTATATTCTTTGAGAAATACTGG - Intergenic
1154042064 18:10865765-10865787 TGAGATTCCTTGAGTGATGCAGG + Intronic
1154400208 18:14030029-14030051 TGACATTCCTAGATAAACAACGG + Intergenic
1156045482 18:32872691-32872713 TGAGATGCCTTGAGAAATCCAGG - Intergenic
1156197670 18:34793939-34793961 TGAGATACCTAGAAAAAAACAGG + Intronic
1159084447 18:63772677-63772699 TGAGATTCATGAACAAACACAGG - Intronic
1163844499 19:19630589-19630611 TGAGATTCCTGGAGAGCCAAGGG + Intronic
1164695084 19:30237406-30237428 TCTGATTCCTAGAGAAACAAGGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167009782 19:46799836-46799858 CAAAATTACTTGAGAAACACTGG + Intergenic
1167352015 19:48981449-48981471 TGAGACTCTAGGAGAAACACAGG + Intronic
1167368315 19:49065954-49065976 TGAGAGACCCTGAGAAAGACAGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925063870 2:914220-914242 TTAGATTCCACAAGAAACACTGG + Intergenic
925614205 2:5729844-5729866 TCAGTTTCCTTGAGAAAAAAAGG + Intergenic
928214401 2:29349407-29349429 TGAGATTCGTGGGGCAACACTGG + Intronic
928875972 2:36040391-36040413 TGACATTACTGGGGAAACACAGG - Intergenic
930315064 2:49787191-49787213 TGACATTTCTTGAGAGAGACAGG - Intergenic
930905753 2:56565129-56565151 TGAAATTCAGTGAGAAACACTGG + Intergenic
931651447 2:64472450-64472472 TGATAATCCTTGGGAAACATAGG - Intergenic
932417679 2:71583693-71583715 TGAGATTCCTTCTGCACCACGGG - Intronic
932912874 2:75822608-75822630 TGTGCTTCCTGGGGAAACACAGG - Intergenic
933671124 2:85008115-85008137 TGAGATTCCTCTAGGAACAGAGG - Intronic
935332740 2:101988874-101988896 TGGGTTTCCATGAGAGACACTGG - Intergenic
937994554 2:127683106-127683128 TGAGATTCTTTGAGCAAAACAGG - Intergenic
938635381 2:133219903-133219925 TGAGATTCTGTGAAAAAGACAGG - Intronic
940321129 2:152377800-152377822 TAAGACTACTTGAGAAACAAGGG - Intronic
941566577 2:167115759-167115781 TGTGCTTCCTGGGGAAACACAGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941853885 2:170211098-170211120 TGGGGTTCCATGAGAAAAACAGG + Intronic
942620312 2:177838133-177838155 TGAGGTTCCATGAGGAAAACAGG - Intronic
942968865 2:181932363-181932385 TGATATACCATGAGAAAAACAGG + Intergenic
943496902 2:188631453-188631475 TGAACTTCCTTTAGGAACACTGG + Intergenic
944449648 2:199828152-199828174 TGAGATTTTTTTTGAAACACAGG - Intronic
946033414 2:216723213-216723235 TGAGAGTCCTTCAGAGACAGGGG - Intergenic
946642970 2:221804071-221804093 AGAGATGCTTTGAGAAAGACTGG + Intergenic
1170389760 20:15859357-15859379 AGTTATTCCTTGAGCAACACAGG - Intronic
1170487840 20:16837827-16837849 TGACTCTTCTTGAGAAACACAGG + Intergenic
1171152016 20:22835636-22835658 TCACCATCCTTGAGAAACACTGG + Intergenic
1173331335 20:42078394-42078416 TCAGATTCTATGAGAAACCCAGG - Exonic
1176694069 21:9952540-9952562 AGAGAATCCATGAGAAACCCAGG + Intergenic
1178626467 21:34222856-34222878 TGAGACTCCCTGAGAAACACTGG - Intergenic
1180103632 21:45602114-45602136 TGAGCTACTTTGAGAAAAACAGG - Intergenic
1182357496 22:29728904-29728926 AGAGAGTCCTTGACCAACACCGG - Intronic
1184186646 22:42869296-42869318 TGAGACTCCTCAAGAAACCCTGG + Intronic
950147011 3:10657327-10657349 TGAGCTTCCCTGAGCTACACAGG + Intronic
952204388 3:31165410-31165432 TGGAATTCCTGAAGAAACACTGG + Intergenic
952629892 3:35453541-35453563 TGTGCTTCCTGGGGAAACACGGG - Intergenic
953176649 3:40559532-40559554 TGGGATTCCATGAGGAAGACAGG + Intronic
955909423 3:63845055-63845077 TGAGACTCCTTGAGGAACACAGG + Exonic
956821804 3:72960498-72960520 TGAGATCCATTGAGTAAAACAGG + Intronic
956978100 3:74605690-74605712 CAAGCCTCCTTGAGAAACACAGG - Intergenic
958440089 3:94145959-94145981 TAAGCCTCCTTGAGAAACAGTGG + Intergenic
961419021 3:126785058-126785080 TGACATTACTGGAGAAAAACTGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962290921 3:134135636-134135658 TGAGATACCTTTAGAAATCCTGG + Intronic
963256420 3:143149014-143149036 TGAAATTCCTTGAGCAAAAAAGG + Intergenic
964360129 3:155886875-155886897 AGAAATTCCTTGAGACACACTGG + Intronic
965205621 3:165716891-165716913 TGGGGTTCCATGAGAAAAACAGG + Intergenic
966035195 3:175403759-175403781 TGACATTACTTAAGAAACATTGG + Intronic
968401022 4:297661-297683 TGAGATGTCTCTAGAAACACTGG + Intronic
968411185 4:391733-391755 TGAGATGTCTCTAGAAACACTGG - Intergenic
968435414 4:584730-584752 AAAAATTCCTTGAAAAACACAGG - Intergenic
969345287 4:6565997-6566019 TGAGGTTTCCTGAGAGACACTGG + Intergenic
970159620 4:13175734-13175756 TTAGATTGGTTGAGAAACACTGG - Intergenic
971896295 4:32600597-32600619 ATAAATTCCTTGAGAAACACAGG - Intergenic
973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG + Intronic
973699144 4:53519639-53519661 TCAGATACCTTGACAGACACAGG - Intronic
973937286 4:55860195-55860217 GGAGATTCCTTGAAAAATAAAGG - Intronic
974409936 4:61526832-61526854 TGAGATAAGTAGAGAAACACTGG + Intronic
976319361 4:83695388-83695410 AAAGAATACTTGAGAAACACAGG - Intergenic
978426656 4:108590178-108590200 AGACATTCCTTGAGACACAGAGG - Intergenic
979534871 4:121808189-121808211 TTAAATTCCTTTAGAAACAAGGG + Intronic
980366692 4:131812733-131812755 AGAGAATCCATGAGAAACCCAGG + Intergenic
980579431 4:134730993-134731015 GGAGATTCATTGGGAACCACTGG - Intergenic
981089403 4:140717094-140717116 GGATATTCTTTGAGAAACACTGG - Intronic
981587089 4:146315486-146315508 AGAGATCCATTGAGAAACATTGG + Intronic
982217742 4:153096697-153096719 TGAGAATCCTGGGGAAACAGAGG + Intergenic
983151561 4:164288770-164288792 TGGGAGTCCTTTTGAAACACGGG + Intronic
984172578 4:176378643-176378665 CGAGATTTGTTGAGAAAAACTGG - Intergenic
985187012 4:187328384-187328406 GTAGATTCCTTGAGAAATAATGG + Intergenic
985762646 5:1758543-1758565 TGGAAATCCTAGAGAAACACTGG - Intergenic
985961899 5:3308857-3308879 TGAGTTCCCTTGAGAGACAAAGG - Intergenic
987393082 5:17395082-17395104 TGAGATTCAAAGAAAAACACAGG + Intergenic
988156504 5:27458517-27458539 GGAGATGCCCTGATAAACACTGG + Intergenic
988273872 5:29055372-29055394 TGATATTACTTCAGAAAGACTGG - Intergenic
990732563 5:58825414-58825436 TCTTATTCCATGAGAAACACAGG + Intronic
992208927 5:74458478-74458500 AGAAATTCCCTGGGAAACACTGG + Intergenic
992722491 5:79574556-79574578 TGAGACTCCATGAGAGACAGAGG + Intergenic
993092933 5:83449600-83449622 TGACATATTTTGAGAAACACTGG + Intergenic
994606873 5:101979059-101979081 TGGGGATCCTTGAGAAACAAAGG - Intergenic
997013892 5:129907287-129907309 TGAAACTCATTGAGATACACGGG + Intronic
997415318 5:133723669-133723691 TCTGATTCCCTGAGAAACAAGGG + Intergenic
1002823918 6:755440-755462 TGTGTTTCCTTGAAAGACACAGG - Intergenic
1003579077 6:7322992-7323014 TCAGAATCCTTGGGAAACATGGG + Intronic
1003991470 6:11490771-11490793 TGAGATTGCTTCAGAAGCAAAGG + Intergenic
1004419905 6:15459896-15459918 TGAGCTTCCTTGAGCAAAATGGG + Intronic
1005928797 6:30465632-30465654 TGAGATTCGTACAGAAGCACAGG - Intergenic
1006046124 6:31300251-31300273 TGAGATTCATGTAGAAGCACAGG + Intronic
1006738314 6:36290901-36290923 TGAGATTCCTATTAAAACACTGG - Intronic
1006746569 6:36346952-36346974 TGAGATTCACAGAGACACACAGG + Intergenic
1009375956 6:62969252-62969274 TGAGGTTCATTGAGCAACACTGG + Intergenic
1009401588 6:63262639-63262661 TGACCTTCCTTTAGGAACACTGG - Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1011078964 6:83468192-83468214 TAAGATTCCTTCTGTAACACAGG + Intergenic
1011593826 6:88997145-88997167 TGAGACCCCCTGAGGAACACAGG + Intergenic
1012232442 6:96776212-96776234 TGAGTTACCTTGAGAAAAATTGG + Intergenic
1012289962 6:97441535-97441557 TGAGAATCCTTAATATACACAGG - Intergenic
1012805087 6:103883846-103883868 TGAGAATATTTGGGAAACACTGG - Intergenic
1013509641 6:110832767-110832789 AGTGATACCTTGAGAAACACAGG + Intronic
1014354903 6:120395747-120395769 TGTGAGTGCTTGAGAAAGACTGG + Intergenic
1015206369 6:130644414-130644436 TGAGATTATGTGAGAATCACTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015749419 6:136545108-136545130 TGAGATTCCTGCAGAAATCCAGG - Intronic
1017959398 6:159208697-159208719 TGAGAAGCCCTGAGAATCACAGG - Intronic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1019466191 7:1190685-1190707 TGAGATAACTTGAGATTCACTGG + Intergenic
1020764169 7:12300378-12300400 TGAGACTTATTGAGGAACACAGG + Intergenic
1021885908 7:25138849-25138871 TGCTATGCTTTGAGAAACACTGG + Intronic
1023583686 7:41707048-41707070 TGAAATTCATTGAGAACAACAGG + Intergenic
1026251872 7:68678359-68678381 TGAGACTCCCTGAGAAACTCAGG - Intergenic
1028143042 7:87292205-87292227 TGTGCTTCCCGGAGAAACACAGG - Intergenic
1028863223 7:95678539-95678561 AGAGATGGCTTGAGAAATACAGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031113734 7:117644129-117644151 AGAGATTCCTTCAGAAATGCTGG + Intronic
1033875361 7:145810832-145810854 TGACATTTCTTGACACACACTGG + Intergenic
1035686199 8:1525165-1525187 TCAGAGTCCTAGAGACACACCGG - Intronic
1035735290 8:1882973-1882995 TGAGAATCATTGAGAATCACTGG + Intronic
1035759467 8:2058857-2058879 TGTCATTCCATAAGAAACACTGG - Intronic
1040834084 8:51713536-51713558 TCAGATTACTTGAGAGAAACCGG - Intronic
1042110302 8:65374606-65374628 TGAAAATCCTTATGAAACACCGG + Intergenic
1044713113 8:95075854-95075876 GGAGAATCTTTGACAAACACAGG + Intronic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1047581565 8:126222099-126222121 TGGGATTCCATGAGGAAAACAGG + Intergenic
1049279464 8:141736970-141736992 GGGGATTCCTGGAGCAACACAGG - Intergenic
1049315840 8:141966945-141966967 TGAGCTTCCCTGAGCCACACTGG + Intergenic
1049935207 9:495072-495094 TGTGTTTCCTAGAGAAATACAGG + Intronic
1050143408 9:2540013-2540035 TAATATTCCTAGAGAAAAACTGG + Intergenic
1050228543 9:3491208-3491230 TGAGATTACTTGAAGAAGACAGG + Intronic
1051891395 9:21945757-21945779 TGTGCTTCTTGGAGAAACACGGG - Intronic
1053631045 9:39938640-39938662 AGAGAATCCATGAGAAACCCAGG + Intergenic
1053774723 9:41524865-41524887 AGAGAATCCATGAGAAACCCAGG - Intergenic
1054212842 9:62312058-62312080 AGAGAATCCATGAGAAACCCAGG - Intergenic
1054952731 9:70871097-70871119 TGAGTTTTCTAGAGAAACAAAGG + Intronic
1056573126 9:87833717-87833739 TGATGTTCCTTGGGAAACTCTGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1057745105 9:97745193-97745215 TGAAATTCCTGTAGAAAAACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058528444 9:105883241-105883263 TGAGAGTCATTGGGAGACACGGG - Intergenic
1059225718 9:112671123-112671145 TGGGATCCCCTGAGAAATACAGG - Intergenic
1061085256 9:128394315-128394337 TGAGGTTCATTGGGAAAGACAGG - Intergenic
1186701003 X:12090100-12090122 TGAGATTTGTTCAGAGACACAGG - Intergenic
1186886854 X:13922430-13922452 TCAGATTCCTTAAGAAGCAAAGG - Intronic
1187675694 X:21714172-21714194 TGAGATAAGTTGAGAAATACTGG + Intronic
1188633894 X:32404137-32404159 TTAGCTTCTTTGATAAACACGGG + Intronic
1191241120 X:58190812-58190834 AGAGATTCCTGGACAAACCCAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193089877 X:77482518-77482540 TGTGCTTCCTGGAGAAACACAGG - Intergenic
1193269403 X:79511593-79511615 TGGGGTTCCATGAGAAAAACAGG - Intergenic
1195842220 X:109186630-109186652 TGAGACCCCTTGAGGAACACAGG - Intergenic
1197137537 X:123080607-123080629 TGACATTCCTTCAGAACCAATGG + Intergenic
1197396855 X:125938217-125938239 TGGGATTCCATGAGCAAAACAGG + Intergenic
1197551277 X:127895711-127895733 TGAGAGTCCTGGAAAAAAACAGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198951289 X:142075392-142075414 TGAAATTTAATGAGAAACACTGG - Intergenic
1199590102 X:149459727-149459749 TGTAATTCCTGGAGAAACAGAGG + Intergenic