ID: 916031488

View in Genome Browser
Species Human (GRCh38)
Location 1:160881227-160881249
Sequence CTGTTTCTCCAGTGCTGCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916031482_916031488 7 Left 916031482 1:160881197-160881219 CCAGTGTCCGTGCGGTACCTCAG 0: 1
1: 0
2: 1
3: 1
4: 42
Right 916031488 1:160881227-160881249 CTGTTTCTCCAGTGCTGCATGGG 0: 1
1: 1
2: 1
3: 15
4: 191
916031480_916031488 24 Left 916031480 1:160881180-160881202 CCAGTGTCTGGAGGAAGCCAGTG 0: 1
1: 1
2: 2
3: 24
4: 269
Right 916031488 1:160881227-160881249 CTGTTTCTCCAGTGCTGCATGGG 0: 1
1: 1
2: 1
3: 15
4: 191
916031486_916031488 -10 Left 916031486 1:160881214-160881236 CCTCAGCAGGGAGCTGTTTCTCC 0: 1
1: 1
2: 5
3: 30
4: 270
Right 916031488 1:160881227-160881249 CTGTTTCTCCAGTGCTGCATGGG 0: 1
1: 1
2: 1
3: 15
4: 191
916031485_916031488 0 Left 916031485 1:160881204-160881226 CCGTGCGGTACCTCAGCAGGGAG 0: 1
1: 0
2: 0
3: 17
4: 87
Right 916031488 1:160881227-160881249 CTGTTTCTCCAGTGCTGCATGGG 0: 1
1: 1
2: 1
3: 15
4: 191
916031479_916031488 25 Left 916031479 1:160881179-160881201 CCCAGTGTCTGGAGGAAGCCAGT 0: 1
1: 1
2: 3
3: 20
4: 184
Right 916031488 1:160881227-160881249 CTGTTTCTCCAGTGCTGCATGGG 0: 1
1: 1
2: 1
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916031488 Original CRISPR CTGTTTCTCCAGTGCTGCAT GGG Exonic
900467243 1:2831764-2831786 CTGTGTACCCAGTGCTGCACTGG + Intergenic
902449318 1:16486539-16486561 CTGCTTCTCCAGGGCTGCCTTGG + Intergenic
902505430 1:16936738-16936760 CTGTTTCTCCAGGGCTGCCTCGG - Exonic
903167637 1:21531949-21531971 CTGTTTCCCCATTGTTGCCTAGG + Intronic
906218824 1:44061242-44061264 CTGTTTCTCCAGGGCTAGACAGG + Intergenic
907060706 1:51421023-51421045 CTGTTTCCTTAGTGCTGCACCGG - Intronic
907533925 1:55130590-55130612 CTGTTTCTCCAGAGCAACCTAGG - Intronic
916031488 1:160881227-160881249 CTGTTTCTCCAGTGCTGCATGGG + Exonic
916039554 1:160950626-160950648 CTGTTTCTCCAATGCTGCATGGG + Exonic
916897490 1:169180442-169180464 CTCTTTCTTCATTGCTGGATAGG - Intronic
916908564 1:169318067-169318089 CTCTCTCTCCTGTGCTCCATGGG + Intronic
917648600 1:177053061-177053083 CTGTGTCTCCAGCACTGTATGGG - Intronic
918181116 1:182086634-182086656 CTGTTTCTACATCTCTGCATGGG + Intergenic
919247414 1:195005951-195005973 CTGCTTTTCCAGTTCTGCCTTGG + Intergenic
920405188 1:205703808-205703830 CTCTCTCTCCAATGCTGCAGTGG - Intergenic
920685016 1:208102669-208102691 CTGTTTCTCCATTGCTGTTTAGG - Intronic
923364619 1:233247179-233247201 CTGCTTTTCCAGAGCTGCCTAGG + Intronic
924293888 1:242566310-242566332 CAGTTTCTCCAGAGAAGCATAGG + Intergenic
924610886 1:245572886-245572908 GTGTTTCTCCATTTCTGCTTGGG - Intronic
1062792905 10:321216-321238 CAGTTTTTCCAGTGCTGACTTGG - Intronic
1064506849 10:16040562-16040584 CTGTTTCCCCAGTGTTGGCTGGG - Intergenic
1065051658 10:21798773-21798795 CTGTTTCTCCACAGCTCCTTAGG + Intronic
1067509674 10:46884553-46884575 CTGTACCTGCTGTGCTGCATGGG + Intergenic
1067652580 10:48167305-48167327 CTGTACCTGCTGTGCTGCATGGG - Intronic
1067808154 10:49407488-49407510 CTGTTTCCCCTGTGCTCCCTCGG - Intergenic
1068665902 10:59675756-59675778 CTGTTGCTCAACTGCTGCATAGG - Intronic
1069041361 10:63699029-63699051 CTATTTCCCCATTGCTACATTGG - Intergenic
1073406936 10:103306530-103306552 CTGTATTTCCAGTGCTGCTCTGG + Intronic
1073485877 10:103818897-103818919 CTGAGTCTCCAGTGCTGCAGTGG - Intronic
1074142320 10:110684716-110684738 CTTTTCATCCAGTGCTGCAATGG - Intronic
1075623785 10:123947241-123947263 CTGCTTCTCCAGAACTGAATTGG + Intergenic
1076368244 10:129935912-129935934 CTGGTGCTCCAGGGCTGCTTGGG - Intronic
1076606526 10:131693067-131693089 CAGTTTCTCCAGTGCTGTTCAGG + Intergenic
1080759821 11:35237558-35237580 CTGTCTCTCCACTTCTGCATGGG - Intergenic
1084836866 11:71808347-71808369 GTGTTTCTGCATTTCTGCATAGG + Intergenic
1085013397 11:73157026-73157048 CTGTTTCTCCTGGGCTGGATAGG - Intergenic
1085337024 11:75704128-75704150 CAGTTTGAGCAGTGCTGCATAGG + Intergenic
1085950913 11:81330389-81330411 CTACTTCTCTAGTGCTGCGTTGG + Intergenic
1086257939 11:84902157-84902179 TTGTTTCTCCAGCACTCCATGGG + Intronic
1087126607 11:94633406-94633428 CTGTATCTCCATTGCTTTATTGG - Intergenic
1088973226 11:114791696-114791718 CTGTTTCTCCAGTTCACCCTTGG - Intergenic
1090711073 11:129386095-129386117 CTGTTTCTCCAGTAATGCTTTGG + Intronic
1092402368 12:8187757-8187779 GTGTTTCTGCATTTCTGCATAGG - Intronic
1093522342 12:20065966-20065988 CTCTTTCTCCAGCTCTGCACTGG - Intergenic
1095842026 12:46703758-46703780 CTCTTTCTCCAGTACTTTATTGG - Intergenic
1099428665 12:82553960-82553982 CTCTTTGTCCTGTGCTGCCTGGG + Intergenic
1102236558 12:111297680-111297702 CTGTTTATCCAGTGCTGTTCTGG + Intronic
1103333290 12:120169942-120169964 CTGTTGCTCCAGTGCTACACAGG - Intronic
1104109356 12:125690382-125690404 CTGTTTATTCAGTGCAGCACGGG + Intergenic
1107721520 13:43253440-43253462 ATGGTTCTGCAGTGCTGCAAAGG - Intronic
1109617067 13:64848960-64848982 CTGTTTCCCCAGGGGTGAATTGG - Intergenic
1112155099 13:96808640-96808662 CATTTTCTCAAGTGCTGGATCGG - Intronic
1113716062 13:112508732-112508754 CTCTTCCTCCAGTGCTCCCTGGG + Intronic
1114837849 14:26224644-26224666 CTGGATCTCCAGAGCTGCTTGGG - Intergenic
1117786921 14:59295597-59295619 CTGTGTTTCCAGTGCTGGAGAGG + Intronic
1118300033 14:64606941-64606963 CTGTTTCTCCAGTTCTCCTGAGG + Intergenic
1121409935 14:93742831-93742853 CTGTTTCTCCACTTCTGAAAGGG - Intronic
1121573321 14:94963785-94963807 CTGTTGCTGCTGTGCTGCTTTGG + Intergenic
1122073934 14:99223675-99223697 CATTTTATCCAGTGGTGCATTGG - Intronic
1123141848 14:106087571-106087593 CTGTTTTTCCAGTGCAGCTGAGG - Intergenic
1126975275 15:54171230-54171252 CTGTTTGTCCATTTTTGCATTGG - Intronic
1127715008 15:61641424-61641446 TTCTTTTTCCATTGCTGCATAGG + Intergenic
1128320461 15:66690252-66690274 CTGTTTCTCTTGCCCTGCATTGG + Intergenic
1128333587 15:66771918-66771940 GTGTGTTTCCAGGGCTGCATAGG + Intronic
1128358839 15:66946493-66946515 CCGTTTCTTCATTTCTGCATTGG - Intergenic
1128885419 15:71282509-71282531 TTGCTTGTCCAGTGCTGCCTTGG + Intronic
1129748101 15:78038988-78039010 GTGTTTCTGCAGTGGTGCAATGG - Intronic
1131341839 15:91609672-91609694 CTGTTTATCAACTGCTGCAAAGG - Intergenic
1133469494 16:6060835-6060857 CTGTTTTTCCAGGGCTGCCTGGG + Intronic
1134845514 16:17436501-17436523 CAGTTTCACCAATGCTGCCTGGG - Intronic
1138098866 16:54235541-54235563 CTCTTTCTGCAGGGCTGCAGGGG - Intergenic
1138499313 16:57429270-57429292 CTCTCTCTCCAGTGCTACCTGGG - Exonic
1141182876 16:81766307-81766329 CTGTGTCTCCAGCCCTGCAGAGG - Intronic
1143260596 17:5595749-5595771 CTGTTTTTCCAGTGGTCCCTCGG + Intronic
1143654663 17:8287020-8287042 CTGTTCCTTCAGTGAGGCATCGG + Intergenic
1145000221 17:19299759-19299781 CTCTTTCACCAGCCCTGCATTGG + Intronic
1146142880 17:30384131-30384153 CTGCTTCTACAGTGATGTATTGG + Intronic
1146511439 17:33452552-33452574 CTGTTTCTCATGTGCTTCCTGGG + Intronic
1148976648 17:51535769-51535791 CTGATTCTGCAGGTCTGCATAGG - Intergenic
1149781960 17:59404894-59404916 CTGTTTCTCCAATGCTTGAAAGG - Intergenic
1151665555 17:75543385-75543407 CTGTTTCTCCAGGTCTCCAGTGG + Exonic
1153777562 18:8467065-8467087 CTCTTTCTCACGTGTTGCATGGG + Intergenic
1156545408 18:37958996-37959018 CTGTTCCTTCAGTTCTGCAGAGG + Intergenic
1160602681 18:80025923-80025945 CTATTCCTCCAGTGCTCCAAAGG + Intronic
1161012227 19:1965837-1965859 CTGCTTCTCCACTGCAGCCTGGG - Intronic
1163345208 19:16736910-16736932 CTCTTTCTGCAGAGCTGAATGGG + Intronic
1164517168 19:28946356-28946378 GTCTTTCTCCAGTGCTGACTGGG - Intergenic
1164936634 19:32219988-32220010 CTTTTTCTCCACTGCTCCTTGGG - Intergenic
1165324260 19:35104982-35105004 AGGTGTCTCCAGGGCTGCATGGG - Intergenic
1165675139 19:37716190-37716212 CTGTTTCTCCATTGCTCAGTAGG - Intronic
1166438708 19:42791691-42791713 CTGTGTCTCCTGTGCTGTAATGG + Intronic
1166473720 19:43102480-43102502 CTGTGTCTCCTGTGCTGTAATGG + Intronic
1166494502 19:43289417-43289439 CTGTGTCTCCTGTGCTGTAATGG + Intergenic
1167273045 19:48517210-48517232 CTGTTCCTCCAACACTGCATGGG + Intergenic
1168699823 19:58430993-58431015 CTGGTACTCCAGTGCTGGAAGGG + Intergenic
925973243 2:9122381-9122403 CTGTTTGTCCAGTGGGGCAAGGG - Intergenic
928068945 2:28195144-28195166 CATTTTCCCCAGTGCTACATTGG + Intronic
929889074 2:45904800-45904822 CCTTTTCTCCAGCCCTGCATGGG + Intronic
930408451 2:50992771-50992793 ATGTTTCTTTAGTGATGCATGGG + Intronic
930795229 2:55382951-55382973 CTGGTGCTACAGTGGTGCATAGG - Intronic
931600738 2:64000741-64000763 CTCTTTCTGCTGAGCTGCATGGG + Intronic
931670327 2:64641619-64641641 CTGTTTTTACAGTGCTGCCCTGG - Intronic
934613145 2:95755318-95755340 GTGCTTCTCCTGTGCTGCCTGGG + Intergenic
934841124 2:97624925-97624947 GTGCTTCTCCTGTGCTGCCTGGG - Intergenic
935651249 2:105384058-105384080 CTGTTTCTCCAGTGATTTAGTGG - Intronic
937023195 2:118677066-118677088 CAGTTTGGCCAGTGCTTCATTGG + Intergenic
937871347 2:126788376-126788398 CAGCTTCTGCAGAGCTGCATTGG + Intergenic
938163853 2:129009469-129009491 CTTTTTCTCGGGTGCTGCAGAGG - Intergenic
941708216 2:168682596-168682618 CTCTTTCTCCAGAGCTGCAGAGG + Intronic
947374025 2:229477182-229477204 ATGTTGCTCCATTTCTGCATGGG + Exonic
948922236 2:241071219-241071241 CTGTGTCTCCAGGGCAGCCTGGG + Intronic
1170402917 20:16006916-16006938 CTGTTTGAACAGTGATGCATAGG + Intronic
1170567452 20:17615127-17615149 GTGTGTCTCCTGTGCTGCCTTGG - Intronic
1170941194 20:20849232-20849254 CTGTTGCCCCCCTGCTGCATGGG - Intergenic
1173150862 20:40565634-40565656 CAGTTTCCCCAGTTCAGCATGGG - Intergenic
1174179007 20:48663189-48663211 CAGTTTCTCCAGTTTTCCATTGG - Intronic
1174387280 20:50194585-50194607 CTGTTTCCCCAGTGCTGTCCTGG + Intergenic
1175276048 20:57771497-57771519 GTGTGTCTCAAGTGCTGTATGGG + Intergenic
1176424984 21:6543045-6543067 CTGTATCCCCAGTGCTAAATGGG - Intergenic
1178091372 21:29167161-29167183 CAGGTTCTCCTGTGCTTCATTGG + Intronic
1178709120 21:34898727-34898749 CACTTTCTGCAGTGCTGCCTAGG - Intronic
1179700475 21:43151362-43151384 CTGTATCCCCAGTGCTAAATGGG - Intergenic
1180180202 21:46115523-46115545 CTGATTCTCCAGCGATGCCTGGG - Intronic
1180224072 21:46379182-46379204 CTTTTCCTTCAGTGCTGCGTGGG + Intronic
1181671045 22:24425518-24425540 CTGTTTCCCCAGTGCTGAGCTGG + Intronic
1182858952 22:33542375-33542397 CTGTGTCTCCATTCCTGCCTTGG + Intronic
1183042172 22:35190310-35190332 CTGTTTCTCCAGTGTAAGATGGG + Intergenic
1184865036 22:47197510-47197532 CTATTTCTCCAGTGTGGCTTTGG + Intergenic
949291471 3:2471648-2471670 CTGTCCCTCCAGAGGTGCATTGG + Intronic
950084937 3:10250459-10250481 CTGTTTCTCCACTCCTCCACAGG - Intronic
951709326 3:25573197-25573219 CTGTTCTTCCAGTGCTTCCTGGG + Intronic
952803920 3:37327684-37327706 CTGTTTCTCCCGTTCTGCCCCGG - Exonic
953401485 3:42624329-42624351 CTGTTTCTTTAGTGATTCATGGG - Intronic
953431882 3:42846805-42846827 CTGTGTGTCCAGTGCTGGCTGGG + Intronic
961224097 3:125223661-125223683 CAGTATATCCAATGCTGCATGGG - Intergenic
961786803 3:129352418-129352440 CTTCCTCTCCAGTGCTGCACGGG - Intergenic
964151875 3:153535302-153535324 CTGTTTGTCCAGTTTTGCTTTGG - Intergenic
965879496 3:173371446-173371468 CTGATTCTTCAGTACTGCTTAGG + Intergenic
966202687 3:177374418-177374440 CTGATTCACCCGTGCTGCAGTGG + Intergenic
966867821 3:184270230-184270252 CTATTTCTCCAGCCCTGAATGGG + Intronic
969047548 4:4347668-4347690 CTGCTTCTTCAGGTCTGCATGGG - Intergenic
969778264 4:9375842-9375864 GTGTTTCTGCATTTCTGCATAGG + Intergenic
973896357 4:55417533-55417555 CTGTTTCTCCCGTGGTGTCTAGG + Intronic
978521262 4:109618171-109618193 CTGTATACCCAGTGCAGCATTGG + Intronic
980149990 4:129033675-129033697 GTGTTTCTCCAGAGCTGCACAGG - Intronic
982394009 4:154896318-154896340 CTGTTTGTCCATTGTTGTATAGG - Intergenic
985533427 5:447334-447356 CTTTTTCTTCATTGCTGCCTGGG - Intronic
986464646 5:8008750-8008772 CTTTTTCCCCCGTGCTGCCTGGG + Intergenic
988708847 5:33753664-33753686 CTGTTTCTTCTGTGCCGCTTGGG - Intronic
988746067 5:34139781-34139803 CTGATTATCCAGTGATGTATTGG + Intergenic
989099958 5:37814078-37814100 CTGTGTCTCCCGGGCTGCACTGG + Intronic
992365027 5:76082713-76082735 CTGTCTCCCCAATGCTACATAGG - Intergenic
994812074 5:104532739-104532761 ATGTTTTTTCAGTGCTGCAATGG - Intergenic
996474523 5:123901560-123901582 CTGTTCATTCAGTTCTGCATAGG + Intergenic
997374389 5:133386724-133386746 CTGTCTCTCCACTTCTGCCTGGG - Intronic
998548911 5:143057633-143057655 CTGGTTCTCCAGTTCTGCAAAGG - Exonic
1001577656 5:172774602-172774624 CTGTCTCCCCTGTGCTGTATGGG + Intergenic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1002836932 6:872908-872930 CTGTTTCTCCAGCTCTGCCAGGG - Intergenic
1004993774 6:21168296-21168318 CTGTTTCATCAGTGCTGCTCAGG + Intronic
1006004379 6:30990811-30990833 ATGCTTCTGCAGGGCTGCATGGG - Intergenic
1010499297 6:76576396-76576418 ATGTTTCATCTGTGCTGCATTGG + Intergenic
1012510773 6:99999276-99999298 CTATGTCTCCAGTGCTTCTTGGG + Intergenic
1012875255 6:104719111-104719133 CTGTTTCTATTGTGCTGCCTTGG - Intergenic
1014469808 6:121800330-121800352 CTGTTTCGCCAATGCTGTGTTGG + Intergenic
1017546239 6:155453478-155453500 TTGTTACTCTAGTGCTGCAGAGG - Exonic
1019029752 6:169000136-169000158 CTGTGTTTCCAGTGCTGCCCCGG + Intergenic
1020211067 7:6158597-6158619 CTGTTTCCCCAGCACTCCATGGG - Intronic
1027958657 7:84916018-84916040 CTGTTTCTTCTCTTCTGCATGGG - Intergenic
1030271996 7:107678435-107678457 CTATTTCTCCTGTTCTGCAGGGG - Intronic
1030356273 7:108546430-108546452 CTGGTTCTTCAGTGATACATAGG + Intronic
1031819885 7:126486865-126486887 TTGTTTTTCCAGTTTTGCATAGG - Intronic
1036275722 8:7349838-7349860 GTGTTTCTGCATTTCTGCATAGG + Intergenic
1036345633 8:7960518-7960540 GTGTTTCTACATTTCTGCATAGG - Intergenic
1036763811 8:11533392-11533414 CTGTTTCTCCAATGTTTCCTTGG - Intronic
1036840958 8:12121273-12121295 GTGTTTCTGCATTTCTGCATAGG - Intergenic
1036862767 8:12367524-12367546 GTGTTTCTACATTTCTGCATAGG - Intergenic
1037677917 8:21067814-21067836 TTGTTTCTCCAGTGATCCACTGG + Intergenic
1037733214 8:21546836-21546858 CTGTCCTTCCAGTGCAGCATTGG - Intergenic
1038242652 8:25824207-25824229 CTTTGTCTCCAGTGATGCACGGG + Intergenic
1038464833 8:27751889-27751911 GTGATTCTCCTGTGCAGCATGGG - Intronic
1039253610 8:35693807-35693829 ATGTTTCTGAAGTGCTACATAGG - Intronic
1041315586 8:56558692-56558714 CTGGGTCTCCAGTGTTTCATGGG + Intergenic
1042431400 8:68710599-68710621 CTGTTTCTGCTGTGGTGGATGGG - Intronic
1042862055 8:73324879-73324901 CTCTTCCTCAAGTCCTGCATTGG - Exonic
1043098678 8:76010650-76010672 CTAAGACTCCAGTGCTGCATGGG + Intergenic
1043222663 8:77686827-77686849 CTGTGTCTCCAAGGCTGCACAGG - Intergenic
1045359123 8:101415508-101415530 CAGTGTCTCCACTGCTGCAAAGG + Intergenic
1047587962 8:126294515-126294537 CAGTTCCTCCAGTGCTGATTGGG + Intergenic
1047868374 8:129054856-129054878 CTGTTTCTCTAGTGCAGCGGGGG + Intergenic
1048119208 8:131561206-131561228 CTGTTTGTCCAGTTTTGCTTTGG - Intergenic
1048474956 8:134734604-134734626 CTGCTTCTCCAGTGCTCCCCTGG - Intergenic
1048794964 8:138141341-138141363 CTGTTTCTCCACAGCTTCATTGG - Exonic
1048822167 8:138390582-138390604 CTGTATCTCCAGTGCAGAGTAGG + Intronic
1049706180 8:144043850-144043872 CAGTGTCCCGAGTGCTGCATAGG + Intronic
1052666332 9:31499815-31499837 TTGTCTATGCAGTGCTGCATGGG - Intergenic
1056273037 9:84965992-84966014 CTCTTTCTGCAGAGCTGCAGTGG + Intronic
1056312779 9:85358351-85358373 GTGTTTCTCAAGTGATGGATGGG + Intergenic
1056519573 9:87387742-87387764 CTGTTTATCAAGTGCTTCATGGG - Intergenic
1057847665 9:98538073-98538095 TTGCTTCTCCAGTGATTCATGGG - Intronic
1059642311 9:116229129-116229151 CTGAGTCTCCAGTTCTGCATGGG - Intronic
1187996184 X:24929421-24929443 CAGTTTCTCCCTTGCTGCCTTGG - Intronic
1189158946 X:38790820-38790842 TTGTTTCTCCAGCCCTGCGTAGG - Intergenic
1190065855 X:47241383-47241405 CTGCTTCACCAGGTCTGCATAGG - Exonic
1191896503 X:65998752-65998774 CTGTTTGTTCACTGCTGTATTGG - Intergenic
1192286457 X:69743278-69743300 CAATTTCTCCAGTGATACATGGG - Intronic
1195069086 X:101262365-101262387 CTGTTTGTCCTTTTCTGCATGGG - Exonic
1198312068 X:135433757-135433779 CTGCTTCTCCAGGGCCGCTTCGG - Intergenic
1198641367 X:138759647-138759669 CTACTTCTCAAGTGCAGCATTGG + Intronic