ID: 916036945

View in Genome Browser
Species Human (GRCh38)
Location 1:160930772-160930794
Sequence CTGTCCAAAGACTCTGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916036943_916036945 7 Left 916036943 1:160930742-160930764 CCAAAATTAAGGCATCAGCAGGA No data
Right 916036945 1:160930772-160930794 CTGTCCAAAGACTCTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916036945 Original CRISPR CTGTCCAAAGACTCTGCAGG AGG Intergenic
No off target data available for this crispr