ID: 916037437

View in Genome Browser
Species Human (GRCh38)
Location 1:160933620-160933642
Sequence CGGGGTGGCGGCGGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916037437_916037450 12 Left 916037437 1:160933620-160933642 CCCTCTGCCCCGCCGCCACCCCG No data
Right 916037450 1:160933655-160933677 GCCCAACAGCTCATTGAGAGCGG 0: 12
1: 438
2: 1151
3: 344
4: 148
916037437_916037452 13 Left 916037437 1:160933620-160933642 CCCTCTGCCCCGCCGCCACCCCG No data
Right 916037452 1:160933656-160933678 CCCAACAGCTCATTGAGAGCGGG 0: 35
1: 1426
2: 536
3: 133
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916037437 Original CRISPR CGGGGTGGCGGCGGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr