ID: 916040504

View in Genome Browser
Species Human (GRCh38)
Location 1:160957119-160957141
Sequence CTGATGCTGGATCTGGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916040497_916040504 4 Left 916040497 1:160957092-160957114 CCGTATGATTTGGCATCCCTGCT 0: 1
1: 0
2: 1
3: 13
4: 203
Right 916040504 1:160957119-160957141 CTGATGCTGGATCTGGTGTCGGG 0: 1
1: 0
2: 0
3: 14
4: 228
916040496_916040504 8 Left 916040496 1:160957088-160957110 CCAACCGTATGATTTGGCATCCC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 916040504 1:160957119-160957141 CTGATGCTGGATCTGGTGTCGGG 0: 1
1: 0
2: 0
3: 14
4: 228
916040494_916040504 21 Left 916040494 1:160957075-160957097 CCACAGCTGAACACCAACCGTAT 0: 1
1: 0
2: 1
3: 1
4: 59
Right 916040504 1:160957119-160957141 CTGATGCTGGATCTGGTGTCGGG 0: 1
1: 0
2: 0
3: 14
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916040504 Original CRISPR CTGATGCTGGATCTGGTGTC GGG Intergenic
900621451 1:3589397-3589419 CTGAGGCAGGATCTTGTGGCTGG - Intronic
902630088 1:17699605-17699627 CTGGTGCTGGAGCTGGCATCTGG + Intergenic
903695730 1:25205322-25205344 CTGCTGCTGGCTCTGTTCTCTGG + Intergenic
907547670 1:55276296-55276318 CTGATCCTGGAGGTGGAGTCAGG - Intergenic
907906803 1:58789800-58789822 CAGTTGCTGGATTTGGAGTCAGG - Intergenic
910059710 1:83075300-83075322 CTGATGTTGCCTCTGATGTCTGG + Intergenic
912057494 1:105622951-105622973 CTGCTGCAGGATCTGTAGTCAGG + Intergenic
913368479 1:118069420-118069442 CTGATGATGGATTAGGTATCAGG + Intronic
914992555 1:152511539-152511561 CTGCTGCTGGCTCTGCTGGCAGG - Exonic
914999957 1:152579910-152579932 CTGCTGCTGGTTCTGCTGGCAGG + Exonic
915003354 1:152613815-152613837 CTGCTGCTGGTTCTGCTGGCAGG - Exonic
915004383 1:152623077-152623099 CTGCTGCTGGTTCTGCTGGCAGG + Exonic
915006681 1:152644691-152644713 CTGCTGCTGGTTCTGCTGGCAGG + Intergenic
915021894 1:152787304-152787326 CTGCTGCTGGCTCTGCTGGCAGG - Exonic
915022861 1:152797799-152797821 CTGCTGCTGGCTCTGCTGGCAGG - Exonic
915023646 1:152805452-152805474 CTGCTGCTGGCTCTGCTGGCAGG + Exonic
915024223 1:152812451-152812473 CTGCTGCTGGTTCTGCTGGCAGG - Exonic
915025662 1:152827477-152827499 CTGCTGCTGGCTCTGCTGGCAGG - Exonic
916040504 1:160957119-160957141 CTGATGCTGGATCTGGTGTCGGG + Intergenic
917261236 1:173172373-173172395 GTGATGGTGGTTCTGGTGTCTGG + Intergenic
917353290 1:174100987-174101009 CTGATGCTTGATTTTATGTCTGG + Intergenic
918107033 1:181424388-181424410 CTGTTTCTAGATCTGGTCTCTGG + Intronic
918225449 1:182477229-182477251 CTGATTCTGGATCTGCAGCCAGG - Intronic
921378929 1:214504358-214504380 CTGATGCTGAGTCTGTTCTCAGG - Intronic
922859452 1:228803582-228803604 CGGCTGCTGGACCTGGTGTTAGG + Intergenic
924404741 1:243730809-243730831 CTGGTGCAGGTGCTGGTGTCTGG - Intronic
924819652 1:247476528-247476550 CTGATTTTGGGTCTGGTGCCTGG + Intergenic
1066645529 10:37603933-37603955 CTGATGTTGCATCTTGAGTCTGG - Intergenic
1070399418 10:76040280-76040302 CAGATGCTGGTTCTGGGCTCTGG - Intronic
1070754754 10:78985166-78985188 TGGATACAGGATCTGGTGTCAGG - Intergenic
1071227910 10:83553030-83553052 CTGATGTTGGAGCTGGGGCCAGG - Intergenic
1071599540 10:86951473-86951495 CTGATGCTGGCCATGGTTTCAGG + Intronic
1073036135 10:100565338-100565360 CTGATGCTGCATCTTGGGGCAGG + Intergenic
1074850832 10:117438304-117438326 CTTATGCTGGATATGGCCTCAGG - Intergenic
1074866686 10:117547964-117547986 CTGAGTCTGGAACTGGAGTCTGG + Intronic
1075016665 10:118914667-118914689 CTGATGCTGGAGGTGGGGCCTGG - Intergenic
1076028687 10:127139695-127139717 CTGATGCTGGTTTGGGAGTCGGG + Intronic
1076539463 10:131204956-131204978 CTGCAGCTGGATCTGGTCTAAGG + Intronic
1076931595 10:133535308-133535330 CTGATTCTTGCTCTGTTGTCAGG - Intronic
1078326768 11:10387633-10387655 CAGATGCTGGAGCTGGGCTCTGG - Intronic
1079141919 11:17816754-17816776 CTGATTCTGGATCTTGTCTCAGG - Intronic
1081377192 11:42373952-42373974 ATGATGATGGCTCTGGTGTCTGG + Intergenic
1084195560 11:67522252-67522274 CTGGTGGTGGATCTGGGGTTTGG + Intronic
1084460835 11:69295746-69295768 TTGCTGCTGGAGCTGGTGACCGG + Exonic
1084501737 11:69539277-69539299 CTGCTGCTGGATCTGATGGTGGG - Intergenic
1087454869 11:98372167-98372189 CTGATGGTGGAGGTGGTTTCTGG + Intergenic
1088202827 11:107358833-107358855 CTGAACCTGCAGCTGGTGTCAGG + Intronic
1088752883 11:112859707-112859729 CTCATGTAGGATGTGGTGTCTGG + Intergenic
1089772788 11:120815431-120815453 CTGATGATGGAGCTGGAGGCTGG - Exonic
1090111911 11:123921073-123921095 CTGATGCTGGGTGTGGTCCCCGG + Intergenic
1091557988 12:1590216-1590238 CAGAAGATGGATCTAGTGTCAGG + Intronic
1091737416 12:2934436-2934458 ATGAGGTTGGATCTGGAGTCAGG - Exonic
1094708274 12:32936000-32936022 CTGTAGCTGCATCTGGTATCTGG + Intergenic
1096610599 12:52798729-52798751 CTGCTGCTTGGTCTGGTGTGGGG + Intergenic
1097189315 12:57211962-57211984 CTGCTGCTGGTTCTGGTGGCCGG + Exonic
1097277251 12:57821953-57821975 CTGAGGCTGGATCTAGGGTGTGG + Exonic
1097426260 12:59448227-59448249 CTGATTCTGTATGTGGTTTCTGG + Intergenic
1097958849 12:65513117-65513139 TTGAGGCTGGATCTGGGGCCAGG - Intergenic
1098608120 12:72419661-72419683 CTAATGTTGGATGTGGGGTCTGG - Intronic
1099359357 12:81680684-81680706 CTGAAGATGGACCTGGTGTAGGG - Intronic
1100137555 12:91572268-91572290 CTGAATCTGAATCTGGTTTCAGG - Intergenic
1100298183 12:93282156-93282178 CTGAGGCTGGCTTTGGTGTATGG + Intergenic
1101452377 12:104791039-104791061 CTGGAGCTGTATCTGGTCTCTGG + Intergenic
1102037374 12:109779671-109779693 CTGAATCTGGATGTGATGTCTGG + Intergenic
1102984901 12:117270117-117270139 CAGAAGCAGGAGCTGGTGTCAGG + Intronic
1104042625 12:125140246-125140268 CTCATGCAGGAGCTGGTGTGGGG + Intronic
1104599129 12:130140514-130140536 CGGAGGTTGGATGTGGTGTCTGG - Intergenic
1112033351 13:95476339-95476361 GTGCTGATGGATTTGGTGTCCGG + Intronic
1112780728 13:102898000-102898022 CAGCTGCTGGAGCTGGTGGCAGG - Intergenic
1113987710 13:114331748-114331770 CTTTTGCTGGGTCTGGTGCCAGG - Intergenic
1118497725 14:66325408-66325430 CAGATGCTGGATCTGTATTCGGG - Intergenic
1118866735 14:69710291-69710313 CTAATGCTGGATTAGGTTTCAGG + Intronic
1120227024 14:81802099-81802121 CAGATGCTGCTTCTGGTTTCTGG - Intergenic
1121552462 14:94812955-94812977 TGGATGCTGGATGGGGTGTCAGG + Intergenic
1123398980 15:19965235-19965257 CTCATGCTGGATCAAGTGTAAGG - Intergenic
1124416713 15:29478503-29478525 CTGATGCTGGAGGTGGGGCCTGG + Intronic
1124873341 15:33565879-33565901 CTGATCTTGGATCAGTTGTCTGG - Intronic
1125127200 15:36238176-36238198 GTGATGCTGGCTGTGGCGTCTGG + Intergenic
1125729722 15:41886355-41886377 CTGAAGCAGGATCTGGTGGAGGG + Exonic
1127839572 15:62819424-62819446 CTCTTGCTGGATGTGGAGTCAGG - Intronic
1128798836 15:70484116-70484138 CTGAGGCTGCATCTGGTCTTAGG - Intergenic
1129225560 15:74168510-74168532 ATGAAGCAGGATCTGGGGTCTGG - Intergenic
1129530500 15:76260817-76260839 CTGAGGCTGTAGCTGGTGGCAGG + Intronic
1136631927 16:31493875-31493897 CTGATGCTCCCTCTGGTGTCAGG - Exonic
1137855967 16:51794997-51795019 CTGAAGCTGTAGCTTGTGTCAGG + Intergenic
1138723080 16:59104796-59104818 CTGATGTTGGAGGTGGGGTCTGG + Intergenic
1140044177 16:71429587-71429609 CTGATGCTAATTCTGGTGTTTGG - Intergenic
1140719504 16:77758605-77758627 CTGGTTCTGGATCTAGTCTCTGG + Intergenic
1141915513 16:87093949-87093971 CTGCTGCTGCATCCGGGGTCTGG - Intronic
1141942157 16:87284182-87284204 CAGATTCTGCATCTGGAGTCGGG + Intronic
1142001749 16:87668221-87668243 CGGCTGCTGGATCTGGAGGCCGG + Intronic
1145207964 17:20994738-20994760 GGGATGCTGGATATGGGGTCAGG - Intergenic
1146506497 17:33410191-33410213 CTGTTGCTGGAAATGGTATCTGG - Intronic
1147476143 17:40713321-40713343 CTGATGCTGGAGGTGGGGCCTGG + Intergenic
1148196097 17:45714374-45714396 CTGATTTTGGGTCTGGTCTCTGG + Intergenic
1148471486 17:47896394-47896416 CTGGGGCTGGGTCTGGCGTCGGG + Intronic
1148533277 17:48415818-48415840 CTGATGCTGGTACTTGTGACTGG - Intronic
1150584720 17:66506913-66506935 CTGTTGTTGGAAATGGTGTCTGG + Intronic
1153694520 18:7626901-7626923 CTGTTGCTGGGGCTGGAGTCGGG + Intronic
1155112032 18:22725254-22725276 ATTAAGCTGCATCTGGTGTCAGG + Intergenic
1155397356 18:25400696-25400718 CAGAACCAGGATCTGGTGTCAGG + Intergenic
1155635564 18:27950959-27950981 CTAATTTTGGATCTGGTGACTGG - Exonic
1156289390 18:35732703-35732725 CTTCTGCTGGGGCTGGTGTCAGG + Intergenic
1161237761 19:3206254-3206276 CTCCTGCTGGATCTGCTGTAGGG - Exonic
1161380982 19:3964761-3964783 CTCATCCTGGAGCTGGTCTCTGG - Exonic
1162985170 19:14265296-14265318 CTGAAGCTGGGGCTGGGGTCCGG - Intergenic
1163148915 19:15399806-15399828 CTGACGCTGGATTTGCTGTTAGG + Intronic
1164433789 19:28210605-28210627 CGCATGCTGGTTCTGGTCTCAGG + Intergenic
1165218628 19:34296329-34296351 CTGAAGCTGGAGCTGCAGTCTGG + Intronic
1165837694 19:38769828-38769850 CTGAATCTGATTCTGGTGTCTGG - Intronic
1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG + Intergenic
1166352221 19:42204766-42204788 CTGGTGCTGGTCCTGGTGTGGGG - Intronic
1166624188 19:44334981-44335003 CTGTTGGTGGGTCTGGGGTCTGG - Intronic
1167960211 19:53099026-53099048 CAGATGCTGGGGCTGGGGTCGGG - Intronic
1168586786 19:57600241-57600263 CTGGTGCTGGATCTCGTTTCTGG + Intronic
924960578 2:30800-30822 CTTCTGCTGGGTCTGGTGCCAGG + Intergenic
925038491 2:710758-710780 ATGGTGGTGGATCTGCTGTCAGG - Intergenic
925316427 2:2929789-2929811 CTGAGTCTGGTTCTGGTGGCTGG + Intergenic
926845100 2:17127980-17128002 CTGTTGCTGGTTCTGTTGTAAGG + Intergenic
927025855 2:19068479-19068501 CTGATGCTGTATTAGTTGTCTGG + Intergenic
927850920 2:26498755-26498777 CTGAAGCTGGATCAGGTCCCTGG - Intronic
930701116 2:54457764-54457786 CTTCTGCTGGATGTGGCGTCAGG + Intronic
934857367 2:97737720-97737742 ATGCTGCTGGATCAGGGGTCAGG - Intronic
935603322 2:104944936-104944958 CTGAAGCTGTATTTTGTGTCCGG - Intergenic
936029623 2:109060696-109060718 ATCATCCTGGAGCTGGTGTCCGG - Intergenic
936499969 2:113059278-113059300 CAGATTCTGGGTCTGGGGTCAGG - Intronic
937346453 2:121129068-121129090 ATGATGCTGTGTCTTGTGTCTGG + Intergenic
937832677 2:126440755-126440777 CTGATGCAGAATCTGGTCTTGGG + Intergenic
938875921 2:135531500-135531522 CTGCCGCTGGAGCCGGTGTCCGG + Intronic
939434852 2:142162148-142162170 TTGATGCTGTATATGGTGTAAGG - Intergenic
940103511 2:150070332-150070354 ATGATGATGGCACTGGTGTCTGG - Intergenic
941704126 2:168639804-168639826 CTGGTACTGGGTCTGCTGTCAGG + Intronic
944919923 2:204402255-204402277 CTGATGATGCATCTGGGGGCTGG + Intergenic
947856069 2:233325423-233325445 GTGAAGCTGAATATGGTGTCAGG + Intronic
948217075 2:236239824-236239846 CTGCTGCTGGATCTGCTGCAGGG + Intronic
948278542 2:236728675-236728697 CTCATGCAGGATCCGGTGTCAGG - Intergenic
948490448 2:238309357-238309379 CTCATGATTGGTCTGGTGTCAGG + Intergenic
1169533067 20:6506168-6506190 CAGAGGCTGGATGTGGTGGCGGG + Intergenic
1169662680 20:7997838-7997860 CTAATGCTGGAGGTGGGGTCTGG + Intronic
1170275925 20:14588019-14588041 CTTTTTCTGGATCTGGTATCAGG + Intronic
1171194686 20:23187711-23187733 CTCTTGCTGGGTCTGGTTTCAGG - Intergenic
1172771756 20:37386238-37386260 CTCATGCAGGATCTGGCATCAGG + Intronic
1174099747 20:48118283-48118305 CTGATGCTGGAGGTGGGGCCTGG - Intergenic
1174574255 20:51525630-51525652 CTGATGATGGATCAGATGTGAGG - Intronic
1174602365 20:51734993-51735015 CTGAAGCTGGAGCTGCAGTCTGG - Intronic
1175556047 20:59857721-59857743 CTGAGGCTGGAGCTGGAGTCAGG - Intergenic
1176745657 21:10649969-10649991 CTCATGCTGGATCAAGTGTAAGG - Intergenic
1178150776 21:29791119-29791141 CTGAAGCTGGATCTGGAGTATGG + Intronic
1178579410 21:33825409-33825431 CTGAAGCTGGGTCTGGTGTTAGG - Intronic
1180636559 22:17266774-17266796 CTGAGGCTTGATCTGGGGGCTGG + Intergenic
1180844671 22:18974643-18974665 CTGATGCTTGAGCTGATTTCAGG + Intergenic
1182957716 22:34442836-34442858 CTGTTAGTGGATCTGGTGTCTGG - Intergenic
1183306121 22:37084146-37084168 CAGAGGCTGGGGCTGGTGTCAGG - Intronic
1184514147 22:44951079-44951101 CTTAAGCTGCATCTGGTGGCAGG - Intronic
949538209 3:5012034-5012056 CTGGTTCTGGTTCTGCTGTCAGG + Intergenic
949597226 3:5560855-5560877 CTGTTTCTTGATCTGGAGTCTGG - Intergenic
949832492 3:8230432-8230454 CTGTTGCTAGATCAGGTATCAGG + Intergenic
950494738 3:13327045-13327067 CACAGGCTGGATCTGGTCTCCGG + Intronic
950937614 3:16856890-16856912 CTGATGTTCTATCTGGTATCAGG + Intronic
952111856 3:30133372-30133394 GTGCTGTTAGATCTGGTGTCTGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956081796 3:65565228-65565250 CTGATGCTGTAGCTTATGTCAGG + Intronic
956593730 3:70944485-70944507 TTGCTGCTGAATGTGGTGTCAGG - Intergenic
958687349 3:97416238-97416260 ATAATTCTGGATCTGCTGTCAGG - Intronic
959105011 3:102055820-102055842 CTTATGCTGGATCTGCTGCCTGG + Intergenic
959404381 3:105942563-105942585 CTGATTATGGATCTGGTTCCAGG - Intergenic
959547622 3:107615266-107615288 CAGATGCTCAAGCTGGTGTCTGG - Intronic
959897195 3:111617971-111617993 CTGCTGCAGGCACTGGTGTCTGG - Intronic
963183208 3:142382606-142382628 CTGATTCTGGATCTGGGGCAGGG - Intronic
963323857 3:143839424-143839446 CTGATGGAGGATCTGATGTTTGG - Intronic
965786854 3:172344271-172344293 CTGATTCTGGTTATGGTGTATGG - Intronic
968650552 4:1758696-1758718 CTGATGGTGGCTCTGGACTCAGG - Intergenic
969517036 4:7653652-7653674 GTGAGGCTGGCCCTGGTGTCAGG + Intronic
971645646 4:29198028-29198050 CTTTTTCTGGATTTGGTGTCAGG + Intergenic
975712513 4:77174624-77174646 ATGATGCTGCAGCTGGTGACTGG + Intronic
976266977 4:83193969-83193991 CAGCTCCTGAATCTGGTGTCAGG + Intergenic
977983208 4:103350414-103350436 CCAATGCTGGATCTGGGGCCTGG + Intergenic
981952333 4:150423694-150423716 CTGGTGCTGGAGCTGCTGTGCGG - Intronic
982780408 4:159484470-159484492 CTCAGACTGGCTCTGGTGTCTGG + Intergenic
983839708 4:172441958-172441980 CTGATGCTGGATAATGTGACTGG - Intronic
984938979 4:184915161-184915183 CCAATGCTGGCTCTGGTGGCCGG + Intergenic
986949053 5:13059820-13059842 CTAATGCTGGAGGTGGGGTCTGG - Intergenic
986952848 5:13112084-13112106 CTCATGCTGGATGTGCGGTCTGG + Intergenic
987993319 5:25243813-25243835 ATTAAGCTGCATCTGGTGTCAGG - Intergenic
989690880 5:44142801-44142823 GTCATTCTGGATCTGGGGTCTGG + Intergenic
993289078 5:86041417-86041439 TTGATTCTGCATCTGGTTTCTGG + Intergenic
997005188 5:129808348-129808370 CAGATGTTGGGTCTGGTGTTCGG - Intergenic
999080638 5:148840221-148840243 GTGATGGTGCATCTGGTGGCTGG - Intergenic
1002511338 5:179720463-179720485 CAGCTCCTGGATGTGGTGTCTGG + Exonic
1003879915 6:10470779-10470801 CTGCTGCTGCAGCTGGTCTCAGG + Intergenic
1004164209 6:13241380-13241402 CTGATTCTGGGTCTGGGGTGGGG - Intronic
1004323822 6:14655109-14655131 CTGATGTTGGAGGTGGGGTCTGG - Intergenic
1004325762 6:14672772-14672794 GTGCTGGTGGGTCTGGTGTCTGG - Intergenic
1004599265 6:17131961-17131983 ATGAAGCTGTATCTGGTGGCAGG + Intergenic
1005650299 6:27879427-27879449 CTGAGGCTGGATCTAGGGTGTGG + Intergenic
1006081928 6:31572812-31572834 CTGCTGCTGGTTCTGCTGCCTGG + Exonic
1006700669 6:35970548-35970570 CTGTTGCTGGATCTAATTTCTGG + Intronic
1007320536 6:41025842-41025864 CTCCTGCTGGATTTGGAGTCTGG - Intergenic
1007927431 6:45661889-45661911 CTGTTCCTTCATCTGGTGTCTGG - Intronic
1014042683 6:116848282-116848304 CCAATGCTGGATGTGGGGTCTGG + Intergenic
1015159253 6:130133644-130133666 GTAATCCTGTATCTGGTGTCGGG - Intronic
1015891446 6:137973677-137973699 ATGCTGGAGGATCTGGTGTCAGG + Intergenic
1017949800 6:159127205-159127227 CTGATGCAGGTTCTGGTGGCTGG - Intergenic
1018767767 6:166947126-166947148 CTCATGCTGGATCTGTGGTGCGG - Intronic
1019624058 7:2006903-2006925 CTTGTGTTGTATCTGGTGTCTGG - Intronic
1023845296 7:44116926-44116948 CTGCTGGTGGATGTGGTGACGGG - Exonic
1024088267 7:45914978-45915000 ATGCTCCTGGGTCTGGTGTCAGG + Intronic
1024188431 7:46979628-46979650 CAGATGATGGATCTAGTGTGTGG - Intergenic
1028641459 7:93046406-93046428 CTGATGCCGCCTCTGGAGTCTGG + Intergenic
1029188197 7:98754410-98754432 CTGAGGCTGGAGCTGGAGTCAGG - Intergenic
1029458116 7:100681098-100681120 CTGAGGCTGGCTGAGGTGTCCGG - Exonic
1033019465 7:137708016-137708038 CTGATGCCATATCTGCTGTCAGG - Intronic
1033660309 7:143397991-143398013 CTGACGATGTATGTGGTGTCAGG + Exonic
1034036614 7:147830258-147830280 GTATTGGTGGATCTGGTGTCTGG + Intronic
1037123439 8:15317149-15317171 CCGATGCTGGCTCGGATGTCTGG + Intergenic
1037328341 8:17717833-17717855 CTGATGATGGGTGTGGTGCCGGG - Intronic
1037764536 8:21764218-21764240 GTGCTGGTGGATTTGGTGTCTGG + Intronic
1039888904 8:41671423-41671445 CTGCTGCTGGAGCTGGCGTTCGG - Intronic
1040486978 8:47882984-47883006 CTGGTGCTGGACCTGGTGCTGGG + Intronic
1042020401 8:64368373-64368395 CTGCTGATGGATGAGGTGTCAGG - Intergenic
1043092092 8:75917754-75917776 CCGATGCTGGATATGGGGCCTGG + Intergenic
1046594815 8:116248861-116248883 CTGATGCTGTGACTGCTGTCTGG + Intergenic
1048140702 8:131791475-131791497 CTGAGGCTTGAGCTGGTATCAGG + Intergenic
1049358392 8:142199940-142199962 CTGATGCTGGCTGTGCAGTCCGG - Intergenic
1049385895 8:142342830-142342852 CAGGTGCTGGAACAGGTGTCCGG - Intronic
1050805420 9:9671011-9671033 CTGTTGGTGGATCTGGAGTATGG - Intronic
1055293665 9:74812149-74812171 CTGAAGCTGGATCTAGTTCCAGG - Intronic
1058646386 9:107135078-107135100 CTGATCCTGGGTCTAGTGACTGG - Intergenic
1059345572 9:113625683-113625705 CTGAGGCTGGAGCTGATGACTGG + Intergenic
1061372764 9:130207087-130207109 CAGATTCAGGATCTGCTGTCTGG - Intronic
1061397028 9:130348922-130348944 CTGATGCTGGGGGTGGTGGCTGG + Intronic
1062172803 9:135144802-135144824 CTGATGCTGTTTCTTTTGTCTGG + Intergenic
1187339519 X:18408802-18408824 CTGTTGCTGAATATGGGGTCTGG + Intergenic
1188065894 X:25658903-25658925 ATTATGCTGTATCTGGTGGCAGG - Intergenic
1188191081 X:27172538-27172560 CTGATGCTGGAGGTGGGGCCTGG - Intergenic
1188926560 X:36051216-36051238 AGGATGGTGGATCTGGGGTCTGG - Intronic
1188926567 X:36051239-36051261 AAGATGGTGGATCTGGGGTCTGG - Intronic
1192659444 X:73026858-73026880 CTGAGGCTGGACCTGGAGGCTGG + Intergenic
1195244100 X:102980422-102980444 CTGATGCTGGCTGTAGAGTCTGG - Intergenic
1197041478 X:121941038-121941060 ATGTTGATGGATCTTGTGTCAGG + Intergenic
1200153593 X:153963657-153963679 CTGCTGCTGGGTCTGGACTCGGG - Intronic
1200244848 X:154517419-154517441 CAGATGATGGATCAGCTGTCAGG - Intergenic
1200931813 Y:8703639-8703661 GTGAGGCAGGATCTGGTGCCAGG + Intergenic