ID: 916043874

View in Genome Browser
Species Human (GRCh38)
Location 1:160983407-160983429
Sequence CCTCAAAGAAGGAACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916043874_916043878 -2 Left 916043874 1:160983407-160983429 CCTTCCAGGTTCCTTCTTTGAGG No data
Right 916043878 1:160983428-160983450 GGTACTGCATTTTAAGTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916043874 Original CRISPR CCTCAAAGAAGGAACCTGGA AGG (reversed) Intergenic
No off target data available for this crispr