ID: 916048661

View in Genome Browser
Species Human (GRCh38)
Location 1:161019725-161019747
Sequence CTGGATCAAAGAATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 420}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916048654_916048661 13 Left 916048654 1:161019689-161019711 CCCAAACAGTTCTTGTGCTATAG 0: 1
1: 0
2: 0
3: 7
4: 158
Right 916048661 1:161019725-161019747 CTGGATCAAAGAATGGAAAAAGG 0: 1
1: 0
2: 2
3: 36
4: 420
916048655_916048661 12 Left 916048655 1:161019690-161019712 CCAAACAGTTCTTGTGCTATAGG 0: 1
1: 0
2: 0
3: 5
4: 85
Right 916048661 1:161019725-161019747 CTGGATCAAAGAATGGAAAAAGG 0: 1
1: 0
2: 2
3: 36
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916048661 Original CRISPR CTGGATCAAAGAATGGAAAA AGG Intronic
902471719 1:16651609-16651631 CTGAATCAAAGAATGGTGTAGGG - Intergenic
902863900 1:19265028-19265050 CTGTATAAAAGACTGGAGAAGGG - Intergenic
903313590 1:22481381-22481403 CTTGAGCAATGAAAGGAAAATGG - Intronic
904247925 1:29201228-29201250 CTGAGTCAAAGAACTGAAAAGGG - Intronic
905032876 1:34899625-34899647 CTGGAGGAAAGAGTGAAAAAGGG - Intronic
906132204 1:43467284-43467306 CTGGATCAAGTGATGGAAGAAGG - Intergenic
906289171 1:44608821-44608843 CTGGATCATAGAAGGGAAGAAGG + Intronic
906842508 1:49155011-49155033 CTGTTTTAAAGAATGGTAAATGG - Intronic
907057565 1:51384828-51384850 CAAGAACAAACAATGGAAAAAGG + Intronic
907182193 1:52580585-52580607 CTGGATCCAAGATTAGAAAAAGG - Intergenic
907339573 1:53725414-53725436 CTGAGTCACAGAATGGAAACTGG - Intronic
907507668 1:54932723-54932745 CTGGATCAATGCATAAAAAATGG - Intergenic
907717847 1:56944188-56944210 CTTTATCAAAGATTGGAGAAGGG - Intronic
908429862 1:64045985-64046007 CTGAATCAAACCATTGAAAAAGG + Intronic
909711460 1:78654248-78654270 CTGGATGAAAGAAAGATAAAAGG + Exonic
910154616 1:84200550-84200572 CTGGACATAAGAATGGACAAAGG - Intronic
910537197 1:88311843-88311865 CTTGATCAAAGATGGGAAGATGG + Intergenic
910985583 1:93002053-93002075 GTGGAACAAAGAATGGAAAATGG - Intergenic
911289826 1:96043857-96043879 CTGGATGATAAAGTGGAAAATGG + Intergenic
911800376 1:102130189-102130211 CAGGAACAAAGAAAGCAAAATGG - Intergenic
912259128 1:108091939-108091961 CTGGATAAATGAGTAGAAAAGGG - Intergenic
912925781 1:113911804-113911826 CTATAGCAAAGAATGGAACAAGG + Exonic
913348995 1:117837268-117837290 ATTAATCAAAGAATGGACAAGGG + Intergenic
913477303 1:119250470-119250492 CTGGAACAAAGAAGGGAATTTGG + Intergenic
914372239 1:147037261-147037283 CTCCAACAAAGAATGGGAAACGG - Intergenic
914402296 1:147333772-147333794 CTGGTACAATGAATAGAAAACGG + Intergenic
914577271 1:148985584-148985606 CTCCAACAAAGAATGGGAAATGG + Intronic
916048661 1:161019725-161019747 CTGGATCAAAGAATGGAAAAAGG + Intronic
919530548 1:198713770-198713792 ATGGATAAAAGAATAGAGAAAGG - Intronic
922135312 1:222819418-222819440 TTATGTCAAAGAATGGAAAATGG + Intergenic
922329918 1:224565489-224565511 CTGGAGCAAAGAATGCAAGCAGG - Intronic
922643980 1:227266175-227266197 CCTGACCAAACAATGGAAAAGGG - Intronic
923877815 1:238069007-238069029 CTGGATACCAGAATAGAAAAAGG - Intergenic
924165605 1:241278923-241278945 CTGGAGAAAAGAATGGAAGCAGG + Intronic
1063995590 10:11615504-11615526 CTGAACCAAGGAATGGAGAAGGG - Intergenic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064559947 10:16586097-16586119 CTCTATCAAGGAAAGGAAAAAGG - Intergenic
1064753621 10:18555985-18556007 ATGGATAATAGAATGGAATATGG + Intronic
1065268875 10:24006325-24006347 ATGGATAAAAGTATGGAAAAAGG - Intronic
1065750472 10:28881739-28881761 CTTTTTCAAAGAATAGAAAAAGG + Exonic
1066045753 10:31594375-31594397 CTGGATCGAGGGTTGGAAAAAGG + Intergenic
1066212013 10:33249564-33249586 CAGAAACAAAGAAAGGAAAAAGG + Intronic
1066357295 10:34697379-34697401 CTGAAGCAAAGATTGGAAGAAGG + Intronic
1067887364 10:50101975-50101997 CTGGAACAAAGAAGGCAACATGG - Intronic
1068099972 10:52540295-52540317 CTGGAACAAAAAATTTAAAAAGG + Intergenic
1069708713 10:70475591-70475613 CTTGATCAAAGATGGGAAACAGG - Intergenic
1070425470 10:76283024-76283046 GTGGAGCACATAATGGAAAAGGG + Intronic
1070457959 10:76635713-76635735 CTAGAACAATGAATGGAACATGG + Intergenic
1070709983 10:78674066-78674088 GTGGCTCAAAGAGTGGTAAATGG + Intergenic
1071984956 10:91041086-91041108 CTGGCTAAAATAAAGGAAAATGG - Intergenic
1072450475 10:95535700-95535722 CTGGAACAAAGAAGGTAAACCGG + Intronic
1072919170 10:99561074-99561096 TTGGGTCAAAGCAAGGAAAACGG - Intergenic
1072933401 10:99688111-99688133 CTGGTCCAAAGAACAGAAAAAGG - Intronic
1073378453 10:103057627-103057649 ATGGAAAAAAGGATGGAAAAAGG - Intronic
1074784340 10:116825905-116825927 CTGGATCTCAGAATGAAAACAGG + Intergenic
1075795698 10:125118012-125118034 CTGGTTTTAAGAATGTAAAAAGG + Intronic
1076426020 10:130368226-130368248 CTGAACCAAGGAAAGGAAAAGGG - Intergenic
1077553186 11:3212939-3212961 CTGGATCAACTTATGGAGAACGG - Intergenic
1077887719 11:6398104-6398126 GTGGACCAAGGTATGGAAAAAGG + Intronic
1078116031 11:8451901-8451923 CTGGATAAAAAAATGCAAAGAGG + Intronic
1078601742 11:12738236-12738258 CTGCCTTAAAGCATGGAAAATGG + Intronic
1078758647 11:14234293-14234315 CCAGAGCAAAGAAGGGAAAAGGG - Intronic
1079317670 11:19422818-19422840 ATGGATCAATGAATGGCAGAAGG - Intronic
1079600218 11:22302728-22302750 CTGGATCTTAGACTTGAAAAAGG + Intergenic
1079602893 11:22331433-22331455 ATGGATAAATGAATGGAAGAAGG - Intergenic
1080571042 11:33557583-33557605 CTGGATTAAACAATTAAAAAGGG + Intronic
1083793859 11:65003248-65003270 CTGAAACAAAGTATGGAAAGTGG + Intergenic
1085323928 11:75592367-75592389 CTGAAACAAAGAAGGCAAAATGG + Intronic
1085646870 11:78229739-78229761 TTGGATCCTAGAGTGGAAAAGGG - Intronic
1086218785 11:84416102-84416124 CTGGAGCACAAAATGGAGAAGGG - Intronic
1086262225 11:84953849-84953871 CTGGAACAAAGCATTGAAGAAGG - Intronic
1086327401 11:85717772-85717794 CTAGACCACAGTATGGAAAATGG + Intronic
1086478416 11:87205514-87205536 CAGGATCAGAGGATGGAATAGGG + Intronic
1087049240 11:93869029-93869051 CTGGATCGAACAAGGAAAAAGGG + Intergenic
1087713417 11:101581485-101581507 ATGGATTACAGAATGAAAAAAGG + Intronic
1089221115 11:116872766-116872788 ATGGATTAAAGGAGGGAAAAGGG + Intronic
1090443924 11:126747428-126747450 CTTAATCAGAGAATGGTAAATGG - Intronic
1091289306 11:134428540-134428562 CTAGACCAAAGTTTGGAAAATGG - Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1092308794 12:7330429-7330451 CTGGGTAAAACAATTGAAAAAGG - Intergenic
1092338370 12:7654306-7654328 ATGAAAGAAAGAATGGAAAATGG + Intronic
1092463531 12:8707405-8707427 CTAGGGCAAAGTATGGAAAAGGG + Intronic
1092814646 12:12302159-12302181 ATGCCTCCAAGAATGGAAAAGGG + Intergenic
1093121516 12:15276872-15276894 GTGTCTCAAGGAATGGAAAAAGG + Intronic
1093858924 12:24139411-24139433 CAGGATGGAAAAATGGAAAAAGG + Intergenic
1095574717 12:43723321-43723343 CTAGTTTAAAGAATGGGAAATGG - Intergenic
1097245697 12:57606509-57606531 CAGGATCAAAGTAAGCAAAAAGG + Exonic
1098515534 12:71372387-71372409 TTGGAATAAAGAAGGGAAAAGGG - Intronic
1098516458 12:71382297-71382319 CTGGATCATGGAATGGGCAATGG - Intronic
1098772073 12:74565081-74565103 TTGGAGCAAAGAATAGACAAGGG + Intergenic
1101584945 12:106077550-106077572 CTGCATCATAGGATGGGAAAAGG + Intronic
1102251143 12:111388306-111388328 CTGGTTGAAAGAATGGCTAATGG - Intergenic
1102384363 12:112495251-112495273 TTGGATCAAGGAACAGAAAAAGG - Intronic
1102553654 12:113711397-113711419 TTGGATCACAAAATTGAAAAGGG - Intergenic
1103920794 12:124398241-124398263 CTGGCTCAAAGGAGAGAAAAGGG - Intronic
1104823195 12:131690434-131690456 AAGGAGCACAGAATGGAAAAAGG + Intergenic
1104895144 12:132160366-132160388 CTGCATGAGAGAATGGAAACTGG + Intergenic
1106024256 13:25941696-25941718 CTGGTTTAAAGAATGGACACAGG - Intronic
1106807922 13:33330416-33330438 CTGGATTAAAAAATGGGCAAGGG - Intronic
1107200681 13:37713316-37713338 CTAGATAAAAGAATGTAAAATGG - Intronic
1107218546 13:37951806-37951828 CTGAAACAAAAAATGGGAAAAGG - Intergenic
1107383565 13:39882930-39882952 CTGGTTCAAAGAAAGGAACTGGG - Intergenic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1108489150 13:50962911-50962933 AGGGAGGAAAGAATGGAAAAAGG - Intronic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109193652 13:59354436-59354458 CTGCATAAAAGAATGGTACAAGG - Intergenic
1109939561 13:69344045-69344067 CTGCATCACAGCATGGAAAAAGG + Intergenic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1110900905 13:80823038-80823060 CAGGTTTACAGAATGGAAAATGG + Intergenic
1111451148 13:88418974-88418996 CGGAATCAAAGTATAGAAAATGG + Intergenic
1111718503 13:91911653-91911675 CTGCATGCAAGAATGAAAAAAGG + Intronic
1112727064 13:102317019-102317041 ATGAATTAATGAATGGAAAATGG - Intronic
1113063326 13:106349055-106349077 CTCAATAAAAGAATGGGAAAGGG + Intergenic
1114312737 14:21482450-21482472 TGGGATCAGAGAATGAAAAAAGG + Intronic
1114854311 14:26419610-26419632 CTGTAACAAAGAATGTGAAATGG - Intergenic
1115705845 14:35997483-35997505 CTTGATCAAAAAATGGGCAAAGG - Intergenic
1115759551 14:36565682-36565704 CTGTATCAAAAAAAAGAAAAAGG - Intergenic
1116716854 14:48438477-48438499 CTGGAACAAAGTAATGAAAAGGG - Intergenic
1116909559 14:50445270-50445292 CTGTATAGAAGAATGAAAAAAGG - Intronic
1118363506 14:65075377-65075399 CTGGATCACACAATGGAGACAGG + Intronic
1118506405 14:66417471-66417493 CTTGATCAAAAAATGGACCAAGG + Intergenic
1119919312 14:78431560-78431582 CTGGAGCAAAGAAAGACAAAGGG + Intronic
1120028050 14:79608231-79608253 CTGAAGCAAATAATGGGAAAGGG + Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120465068 14:84845888-84845910 CTGGCTAAAAGTATGGAATAGGG + Intergenic
1120739233 14:88089452-88089474 CTGGATCATGAAATGGAAACTGG - Intergenic
1121146671 14:91589984-91590006 CTGGCTGAAAGAGTGGCAAAAGG - Intronic
1121410676 14:93746387-93746409 CTGGAGCAAAGACTGGAATTCGG + Intronic
1122103172 14:99429898-99429920 CTGTTTCAAAGAATGAAAACAGG - Intronic
1122530441 14:102421785-102421807 CTGGTTTACAGAATGGGAAACGG + Intronic
1123726008 15:23101987-23102009 CAAGATCAAAGATTGGAAAATGG - Intergenic
1123974749 15:25542676-25542698 CTTGATTAAAGGATGAAAAAGGG - Intergenic
1124020674 15:25919807-25919829 CTGAAACAAAGCATGGAAAAAGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125441288 15:39706974-39706996 CTGGGTCAAAGCAAGGCAAAAGG + Intronic
1126299317 15:47177678-47177700 CTGGATCTGAGAATGGATACAGG + Intergenic
1126538569 15:49796243-49796265 CTGGAACAAAAACTGGAGAAAGG - Intergenic
1128191100 15:65698262-65698284 CTGTCTCAAAGAATGGAAAAAGG + Intronic
1131784766 15:95900176-95900198 CTGGATCAACTAAAAGAAAATGG - Intergenic
1132275786 15:100562633-100562655 CTGGAAAAAAGAATTTAAAAAGG - Intronic
1134345765 16:13389932-13389954 GTGGAAAAAAGAATGGAGAATGG - Intergenic
1135602864 16:23798032-23798054 CTGGGTCAAAGAAAGAAAAGAGG + Intergenic
1138288656 16:55829309-55829331 CTGGATGAGAGGATGAAAAAGGG + Intronic
1138827504 16:60338179-60338201 GTGGATTGAAGGATGGAAAATGG + Intergenic
1138895746 16:61202056-61202078 CTGTATCAAAGAATTGAGAGTGG + Intergenic
1138914284 16:61444079-61444101 CTGGAACAAAAAAAGGAAATTGG + Intergenic
1139789399 16:69420837-69420859 CTGGATCCTAGAACAGAAAAAGG - Intergenic
1139845266 16:69916557-69916579 CTGGACATAGGAATGGAAAATGG + Intronic
1140191814 16:72823975-72823997 CTGTGACAAAGAATGGAAAGGGG - Intronic
1140908453 16:79429932-79429954 GTGGAGCAAAGAGAGGAAAAAGG + Intergenic
1141019775 16:80484590-80484612 AGTGATCAAACAATGGAAAATGG - Intergenic
1143052240 17:4135748-4135770 CTGGTGGAAAGAATGGAGAAGGG - Intronic
1143332089 17:6144953-6144975 CTGGAAACAAGAATGGAAGATGG - Intergenic
1143870789 17:9956192-9956214 CTGCAGCAGAGAAGGGAAAATGG + Intronic
1143873855 17:9976976-9976998 CTGGATCCAAGAACAGAAAAAGG + Intronic
1145051001 17:19660643-19660665 GTGGAGCAAAGATTGGCAAATGG + Intronic
1145093421 17:20004451-20004473 CTGAAGAAAAGAATTGAAAATGG + Intergenic
1146148596 17:30445783-30445805 ATGAATCAAAGAAAGGAAAAGGG + Exonic
1146288027 17:31587607-31587629 CTGGACCAGACAATGGACAATGG - Intergenic
1147043257 17:37734028-37734050 CTCCTTCAAAGAAAGGAAAAGGG - Intronic
1149360707 17:55892571-55892593 TAGGATCAGAGAAGGGAAAAAGG + Intergenic
1149778757 17:59379360-59379382 TTGGAGAAAAGAATGGAAAAAGG + Intronic
1150842374 17:68620749-68620771 CTGGAGGGAAGGATGGAAAAAGG + Intergenic
1151326532 17:73383331-73383353 CTGGAGCAAAGGAAGGAAAGAGG - Intronic
1154488575 18:14900653-14900675 CTGTAACAAAGACTGGGAAATGG - Intergenic
1156708968 18:39918702-39918724 CTGGCTTAAAGGAGGGAAAAAGG + Intergenic
1158004650 18:52658452-52658474 CTGAATCAAAGAAGGTAAATGGG - Intronic
1158288535 18:55912715-55912737 ATGGATCAGAGAAAGGAGAAAGG - Intergenic
1160379694 18:78443744-78443766 CTGTCTCAGAGAATGGGAAAGGG + Intergenic
1160387692 18:78506327-78506349 CTGAAGCAAAGAAAGGAAACCGG - Intergenic
1165946553 19:39446410-39446432 CTGGAGAAAAGAACAGAAAAGGG + Intronic
1166041959 19:40208976-40208998 CTGCATTAAGGAATGAAAAATGG + Intronic
1166821150 19:45581079-45581101 CTGGTTTATAGAAGGGAAAATGG - Intronic
1166993909 19:46710195-46710217 CTGGCTCAAAAACAGGAAAAAGG - Intronic
1167277644 19:48548535-48548557 CTAGATGAATGGATGGAAAATGG + Intergenic
1167281492 19:48571856-48571878 TTGGAACAAAGACTTGAAAAAGG + Intronic
1167626201 19:50591211-50591233 CTGGATCAAGGAATGAAAGGTGG + Intergenic
1168144688 19:54414447-54414469 CTGGAGCAAAATATGGAAATGGG + Intergenic
1168312808 19:55469675-55469697 CTCGATGAAAGAAAAGAAAAGGG + Intergenic
1202704120 1_KI270713v1_random:8403-8425 CTGAATCAAAGAATGGTGTAGGG - Intergenic
925831739 2:7903103-7903125 CTGCATAAAAGAAAGGAAGATGG + Intergenic
926285708 2:11486054-11486076 CTGGAACAGAGAATGCTAAAAGG - Intergenic
926620025 2:15039271-15039293 CTGAATGAATGAGTGGAAAATGG + Intergenic
926832835 2:16982254-16982276 CTGGGACAGAGAAGGGAAAATGG - Intergenic
926954621 2:18280949-18280971 CTGGACCAAAAAAGGGAGAAAGG + Intronic
928660801 2:33500179-33500201 CTGGAGTAAAGAGAGGAAAAAGG + Intronic
928738754 2:34324274-34324296 AGGGATTAAAGAGTGGAAAAAGG - Intergenic
928891701 2:36211708-36211730 GTGAATGAAAGAAAGGAAAAGGG + Intergenic
929332128 2:40694662-40694684 CTGGAACAAATAATGGGAAGAGG + Intergenic
929432950 2:41903727-41903749 CTGGATAAAAGAAGGAAGAATGG + Intergenic
930062317 2:47300473-47300495 CTGGAACAGAGACTGGAATATGG - Intergenic
931712026 2:64996388-64996410 CAGGATCAAACAACAGAAAAAGG + Intronic
931819000 2:65932961-65932983 CTGGCCCTAAGAATGGAAACAGG - Intergenic
932155676 2:69414738-69414760 CTGGAACTAGGAAGGGAAAAGGG + Intronic
932196112 2:69785351-69785373 TTGGATCCAAGAATGTAATATGG - Intronic
933699027 2:85241391-85241413 CTGGATCAAAGAGTGCAAAGAGG - Intronic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
936532290 2:113284544-113284566 CTGAAGCATAGAAAGGAAAACGG - Intergenic
937236949 2:120436901-120436923 CTGAATGAAAGATTGGGAAAGGG - Intergenic
937583593 2:123519117-123519139 CTGGGCCCAAGAATGGAAAATGG - Intergenic
938631015 2:133167651-133167673 CTGGATCAAAGCGTAGAACACGG + Intronic
940979703 2:159987532-159987554 CTGGAGAAAAGAATGCAAGATGG + Intronic
941996017 2:171602625-171602647 CAGGAACAAACAAAGGAAAAAGG - Intergenic
942240613 2:173961461-173961483 CTGGATCCCAGAAGAGAAAATGG + Intronic
942272672 2:174292523-174292545 CAGGAGCAAAGCATGGAAGAAGG - Intergenic
943580279 2:189675646-189675668 CTGCATGAAAGAAAAGAAAAGGG - Intronic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
944099573 2:196008769-196008791 CTGGGTGGAAGAATGGGAAATGG + Intronic
944115735 2:196184417-196184439 ATGGATGAAAGAATGGACAAAGG + Intergenic
945672044 2:212813998-212814020 AGGGTTCAAAGAAAGGAAAAGGG - Intergenic
945965099 2:216178529-216178551 CTTGATCAAAGAAAAGAAAAAGG + Intronic
946568101 2:220990021-220990043 GAAGGTCAAAGAATGGAAAATGG + Intergenic
948028575 2:234798472-234798494 CTGCATAGAAGAATGAAAAAGGG - Intergenic
1169079952 20:2791821-2791843 TTGGAGCTAAGAATGGCAAAAGG + Intergenic
1169085223 20:2822024-2822046 ATTGATCAAGGAATGGAGAAGGG + Intergenic
1169871319 20:10251437-10251459 CTGGATGGAAGGCTGGAAAAGGG + Intronic
1170293947 20:14803924-14803946 GTGGCTCAAAGAAGGCAAAATGG + Intronic
1170335314 20:15264364-15264386 CTGAATCAAAGAATGAAGGAAGG - Intronic
1171139397 20:22728147-22728169 CAGGAACAAAGGATGGACAAGGG - Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172456540 20:35079059-35079081 CTGTCTCAAAAAATAGAAAAGGG + Intronic
1172739336 20:37153320-37153342 CTGGATCAAAGAAGTGACATGGG + Intronic
1173876917 20:46378858-46378880 CAAGATCAAAGATTGGAAAATGG + Intronic
1174510654 20:51049567-51049589 CTGGTTTAAATAATGGACAAAGG + Intergenic
1174948417 20:55014672-55014694 CTGAAGCAAAGAATGTGAAATGG + Intergenic
1175673164 20:60923701-60923723 GTGGATTATAGAATGGAAAGGGG - Intergenic
1175818860 20:61897761-61897783 CTGGAACCAAGGATGGACAATGG - Intronic
1176203627 20:63876263-63876285 CTGGAGCTAAGCAGGGAAAAGGG - Intronic
1176362857 21:6012656-6012678 CTGGATCAGAGAAGAGGAAAAGG + Intergenic
1177128298 21:17224209-17224231 ATGAATCAAAGAAATGAAAATGG + Intergenic
1177851734 21:26357197-26357219 CTGAATGAATGAATGGGAAAGGG + Intergenic
1178228341 21:30751244-30751266 CTGCATCAAAACATGGCAAAAGG - Intergenic
1179471822 21:41615437-41615459 CTGTCTCAAAGAAAAGAAAAAGG + Intergenic
1179760661 21:43525889-43525911 CTGGATCAGAGAAGAGGAAAAGG - Intergenic
1180246991 21:46554964-46554986 CTACAACAAAGAAAGGAAAAGGG - Intronic
1180658269 22:17443013-17443035 CCTGATGAAAGAATAGAAAAAGG - Intronic
1181912654 22:26252194-26252216 CTGGACTAGAGAATGAAAAAAGG + Intronic
1182537567 22:31016606-31016628 CTGAATTAAAGAATGGGGAAAGG - Intergenic
1182757267 22:32690167-32690189 CTGTCTCAAAAAAAGGAAAAAGG + Intronic
1182790621 22:32949735-32949757 GTTGATGACAGAATGGAAAATGG + Intronic
1183778459 22:39983404-39983426 CTGGATCTCAGAATGAAAGAAGG - Intergenic
1184460202 22:44633529-44633551 CTGGATGAATGCATGGAAAATGG + Intergenic
1184697507 22:46148246-46148268 CCGGATCAGAAAATGTAAAAAGG + Intergenic
1184907834 22:47500972-47500994 CTGGCTCAAGGACTGCAAAAGGG + Intergenic
949220224 3:1624439-1624461 CATCATCAAAGAAGGGAAAAGGG - Intergenic
949325880 3:2863815-2863837 CTGGATTAAACAAAGTAAAACGG - Intronic
949502410 3:4693536-4693558 CTGGATCAGAGTCTGGAAAGAGG - Exonic
950225019 3:11226357-11226379 GTGGGTGAAAGAAGGGAAAAGGG + Intronic
951390310 3:22094880-22094902 CAGGAACATAGAAAGGAAAAAGG - Intronic
951707701 3:25559806-25559828 GTGGATCAATGGATGGAAAATGG + Intronic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
953445198 3:42957736-42957758 CTGGCTCTAAGAATGAAAGAAGG + Intronic
954966248 3:54613738-54613760 CCAGAGCAAAGAAAGGAAAAAGG - Intronic
955360780 3:58273033-58273055 CTGGATCCCAGAACAGAAAAAGG - Intronic
955430148 3:58835098-58835120 ATGGATGAAAGACTGGAAGAAGG - Intronic
955807325 3:62750697-62750719 TGGGAACAAAGGATGGAAAAAGG - Intronic
955979974 3:64514983-64515005 ATGGTTCAAAGAAGAGAAAAGGG - Intergenic
956302640 3:67789208-67789230 CAGAATAAAAGACTGGAAAAAGG - Intergenic
957615419 3:82519960-82519982 CAGAAACAAAGAAGGGAAAAGGG + Intergenic
958898236 3:99854485-99854507 CTGGAACTATTAATGGAAAAAGG - Intronic
959000176 3:100955205-100955227 CTGGATCCAAGAAAAGAACACGG + Intronic
959033487 3:101331614-101331636 CTGGATTAAAGAAAGAGAAATGG + Intronic
959505602 3:107153154-107153176 CTGGATCAAAGGAAGGGTAAAGG - Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959829123 3:110839421-110839443 TTGGATCCAAGAAAAGAAAAAGG + Intergenic
962064172 3:131961868-131961890 CTGGATCTGAGTAGGGAAAAGGG - Intronic
962663286 3:137627034-137627056 GTGGATAAAATCATGGAAAAGGG + Intergenic
963167128 3:142216297-142216319 TTGGCTCAAAGAATGAGAAAGGG + Intronic
963186098 3:142419112-142419134 TTGGATGAAAGAAAGGAAATGGG - Intronic
963753518 3:149208406-149208428 CAGGATTAAAGTATGGAAAGAGG + Intronic
964045849 3:152325432-152325454 CTGGTTAAAGGAATGGAACATGG + Intronic
964150098 3:153513681-153513703 CTGGAAGAAACAATTGAAAAAGG - Intergenic
964234737 3:154512108-154512130 CTGTATCAAAGCAGTGAAAAAGG + Intergenic
964849906 3:161084454-161084476 CTGAATTACAGGATGGAAAAAGG - Exonic
964986626 3:162749296-162749318 CTGAAAAAAAGGATGGAAAAAGG - Intergenic
965268579 3:166582526-166582548 CTCCATCAAAAAATGGACAAAGG - Intergenic
965318200 3:167217046-167217068 CTGGACCTAAGAATGGGCAAAGG + Intergenic
965411669 3:168339187-168339209 CTGTCTCAAAGAATAAAAAATGG + Intergenic
966264897 3:178027988-178028010 CTGGATATAAGAATAGAGAAAGG + Intergenic
966885699 3:184377088-184377110 CTGGAGAAGAGAGTGGAAAATGG + Intronic
967693276 3:192502174-192502196 CAAGAACAAAGAATGGGAAATGG - Intronic
970465410 4:16317644-16317666 AAGAATCAAAGAATGGAAGAGGG - Intergenic
970468018 4:16347329-16347351 GATGATAAAAGAATGGAAAAGGG - Intergenic
971434861 4:26609768-26609790 CTGGAAGATAGATTGGAAAAGGG + Intronic
973158011 4:46981909-46981931 CAAGATCAAAGACCGGAAAAGGG + Intronic
974062980 4:57052341-57052363 CTGGATTGAAGAAGGGGAAAGGG + Intronic
975222668 4:71831751-71831773 CTGAAACAAAGAAAGGAGAAAGG - Intergenic
976140220 4:81983788-81983810 CTGGAGGAAAGAAAGGAAAGAGG + Intronic
977009082 4:91613001-91613023 ATGGAGCAAAAAATGGACAATGG + Intergenic
977169917 4:93749479-93749501 TTGAATCAAAGAGTGAAAAAGGG - Intronic
977371600 4:96144387-96144409 CTGGAGCAAAGTAAGAAAAAGGG - Intergenic
978278564 4:106981564-106981586 CTGGTTCAGAGAATGACAAAAGG - Intronic
978813406 4:112876135-112876157 CTGAATAAAAGCATTGAAAACGG - Intronic
979149898 4:117298035-117298057 CTTAATCAATGCATGGAAAAAGG - Intergenic
982595316 4:157376073-157376095 ATGCATCAAACAACGGAAAAAGG + Intergenic
983190756 4:164751100-164751122 CTGCATCAAAAAGAGGAAAAGGG - Intergenic
983679246 4:170333184-170333206 ATGGCACAAAGCATGGAAAATGG + Intergenic
983769071 4:171525586-171525608 CAGGATCCAAGAACAGAAAAGGG - Intergenic
984909280 4:184657133-184657155 CTGAACCAATGAATAGAAAATGG + Exonic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
985835012 5:2264051-2264073 CTGGCTCATGGAATGGAAATGGG + Intergenic
986271666 5:6236461-6236483 CTAAAACAAAGAAGGGAAAATGG + Intergenic
986442782 5:7796365-7796387 CTGGAACAATGCTTGGAAAATGG + Intronic
986767172 5:10938741-10938763 CTGCTTCACAGAATGGATAAGGG - Intergenic
987400366 5:17469289-17469311 CTTCTTCAAAGAATGGAATATGG - Intergenic
987844146 5:23259602-23259624 CTGGGACAAATAATGCAAAATGG + Intergenic
988465506 5:31487458-31487480 ATGAATTAAAGAATGAAAAAGGG + Intronic
988642857 5:33060601-33060623 CTAGATCACAGAACAGAAAAAGG + Intergenic
988768668 5:34409023-34409045 CTGGGAAAAAGAATGGGAAAAGG - Intergenic
989026121 5:37070303-37070325 CTGGAGCAAAGAACAGAAAAAGG + Intergenic
990257202 5:53983005-53983027 CTGCATCAAAAACTGGACAAAGG - Intronic
991973050 5:72159207-72159229 CTAGATGAAAGATTGTAAAAAGG + Intronic
994468236 5:100166662-100166684 TTGGAGCAAAGGGTGGAAAAAGG + Intergenic
994494642 5:100495901-100495923 ATGGATTAATGAATGGAAAGAGG + Intergenic
994762602 5:103875476-103875498 CTGGGACAAACAAGGGAAAATGG + Intergenic
995623510 5:114053695-114053717 GTTGATCAAGGAATGGAGAAGGG + Intergenic
995816203 5:116171146-116171168 CTGCATCAAAAAATGGGCAAAGG + Intronic
996042216 5:118827906-118827928 TAGGATAAAAGAATGGAAAGTGG - Intergenic
996338278 5:122408418-122408440 TGGGCTCCAAGAATGGAAAATGG + Intronic
996354665 5:122582273-122582295 CTGTATCAAAGAATGCAAGGTGG + Intergenic
996516212 5:124372511-124372533 CAGGATCACAGCTTGGAAAATGG + Intergenic
997426827 5:133808902-133808924 CTGGAAAATAGAATAGAAAAAGG + Intergenic
997665401 5:135626175-135626197 ATTCATCAGAGAATGGAAAAGGG - Intergenic
998264252 5:140655586-140655608 ATGGAGCAAAGAATGGAACCAGG - Intronic
999463327 5:151776053-151776075 CTGGATCCTAGAACAGAAAAAGG - Intronic
999906545 5:156147074-156147096 CTGGGTCAAAGAATGTTTAAAGG + Intronic
1000290099 5:159862010-159862032 AAGGAACAAAGAAAGGAAAAGGG - Intergenic
1000524518 5:162340002-162340024 CTGGGTCCAAGAACAGAAAAAGG - Intergenic
1001063427 5:168514746-168514768 CTGGATCTTAGACTAGAAAAAGG - Intronic
1001543443 5:172555151-172555173 CTGGATGAATGAATGGAGGAGGG - Intergenic
1001654599 5:173339949-173339971 CCTGTTCAAATAATGGAAAATGG + Intergenic
1002841534 6:910942-910964 CTGGATGAAAGAAGGAAATAGGG - Intergenic
1003190819 6:3872755-3872777 CTAGGTCAAAGAGTGAAAAATGG + Intergenic
1003193253 6:3892533-3892555 CTAGAGCAAAGAAAGGCAAAGGG - Intergenic
1003368022 6:5495542-5495564 CTGGAGCTAGGAAGGGAAAATGG + Intronic
1003594745 6:7464290-7464312 TTGGATAAAAGAATGTAAATTGG + Intergenic
1004176447 6:13344188-13344210 CTTGGTCAAAGGATGGGAAAGGG + Intergenic
1005057082 6:21739645-21739667 GTGGGTCAAAGGATGGAAAAGGG + Intergenic
1005652428 6:27896463-27896485 CGGGATGAAAGCATGGAAAATGG - Intergenic
1005704738 6:28440208-28440230 CTGGAACAAAGAAAACAAAAGGG + Intronic
1005814448 6:29539310-29539332 CTGGGGCAAAGATTGGAAAGAGG - Intergenic
1005965835 6:30725997-30726019 CAGGATCCAGGGATGGAAAATGG + Intergenic
1007865244 6:44961912-44961934 CTGGAATAAGGAAAGGAAAATGG - Intronic
1008802573 6:55387954-55387976 CTAGATAAAAGAATGTAGAATGG + Intronic
1013047397 6:106500492-106500514 CTGATTTAAAAAATGGAAAAAGG - Intergenic
1014100616 6:117507653-117507675 TTGGATCACAGACTGGAAAAGGG - Intronic
1014563305 6:122917304-122917326 CTGGACCAAAGAAAGCAAAGAGG - Intergenic
1014593323 6:123299812-123299834 TTGGATGAGAGAATGAAAAAAGG + Intronic
1014878871 6:126696740-126696762 ATGGATGAAAAAATTGAAAAAGG - Intergenic
1014890373 6:126837089-126837111 ATGGATTACAGAATGGCAAAAGG - Intergenic
1015869773 6:137764334-137764356 CTAGATCTCAGAAAGGAAAAAGG - Intergenic
1015916488 6:138222672-138222694 CTTGATCAAAGTAAGAAAAAAGG + Intronic
1015987738 6:138901379-138901401 CTGCTTCAAAGAACGGAAATAGG - Intronic
1016155223 6:140798103-140798125 CTGCATCAAAAAATTGGAAAGGG - Intergenic
1018150813 6:160936431-160936453 CATAATCAAAGAGTGGAAAATGG - Intergenic
1018272175 6:162092029-162092051 CTGTCTCAAAGAAAAGAAAAAGG + Intronic
1018291604 6:162297425-162297447 CTGGCACAAAGAAGGAAAAAAGG + Intronic
1018786691 6:167113930-167113952 ATGGAACAAAGAAAGGAAAAAGG + Intergenic
1020661587 7:10990565-10990587 GTTAATAAAAGAATGGAAAATGG + Intronic
1021384578 7:20012488-20012510 CTGGAGCAGAGAAAGCAAAATGG + Intergenic
1021835577 7:24670202-24670224 CTGGGTCACAGAAGGGGAAAGGG - Intronic
1022628026 7:32058223-32058245 CTGGAGAAAAGAATGGAGACAGG - Intronic
1023544616 7:41305269-41305291 TTGGCTCAAAGAGAGGAAAAGGG - Intergenic
1024362137 7:48479240-48479262 CTGTCTCAAAAAAAGGAAAAAGG - Intronic
1024847216 7:53660651-53660673 CTGGATCAAAAAATGACAAAGGG + Intergenic
1027604721 7:80286728-80286750 CAAGATAAAAGAATAGAAAAAGG + Intergenic
1027797011 7:82708463-82708485 CAGGACAAAAGAGTGGAAAAAGG + Intergenic
1027889770 7:83956914-83956936 ATGGATCAAAGAAAAAAAAAAGG - Exonic
1028827451 7:95289818-95289840 ATGGGTGAATGAATGGAAAAAGG - Intronic
1029565689 7:101335997-101336019 TTGGATCGCGGAATGGAAAAAGG - Intergenic
1030335806 7:108324589-108324611 CTGCATCACAGAATGGATGAAGG + Intronic
1030350236 7:108476742-108476764 ATGGATGAATGAATGGATAAAGG + Intronic
1030798521 7:113819516-113819538 CAACAACAAAGAATGGAAAAAGG + Intergenic
1031202821 7:118711953-118711975 CTAGATCAAATAATGGAATATGG - Intergenic
1031225505 7:119032822-119032844 CTCCATCAAAGAGTGGACAAAGG - Intergenic
1031394828 7:121260869-121260891 CAGGAGGAAAGAAAGGAAAAAGG + Intronic
1031674788 7:124596373-124596395 GAGGATGAGAGAATGGAAAAAGG - Intergenic
1032771717 7:135065884-135065906 CTGTATCAAAGAAACAAAAATGG + Intronic
1033218265 7:139509988-139510010 CTAAATCAAAGAACTGAAAATGG - Intergenic
1033554417 7:142476262-142476284 CTGGATCTTGGAATGGACAAAGG - Intergenic
1035617529 8:1013120-1013142 CTAGATCAAAAACTGGAACAGGG - Intergenic
1035687515 8:1536493-1536515 CTGGTTTACCGAATGGAAAAAGG - Intronic
1036702774 8:11024090-11024112 CTGGAGCAAATAATGGAAATTGG - Intronic
1037392028 8:18403297-18403319 CTAGCTCAAAGAACGGAAGAAGG - Intergenic
1037841400 8:22247834-22247856 CTGGAAAAAAGAATGGATTAAGG - Intronic
1038219751 8:25596025-25596047 CTGTCTCAAAAAAGGGAAAAAGG - Intergenic
1038453552 8:27656530-27656552 CCTGATCACAGAATGGAACAGGG - Intronic
1038469085 8:27796610-27796632 ATGGATCAAAGAAATTAAAAGGG - Intronic
1038514626 8:28176245-28176267 CTGGTTCAAAAAAAGAAAAAAGG + Intronic
1039148468 8:34477138-34477160 CTGCAACAATGAATGGCAAATGG + Intergenic
1040851330 8:51903484-51903506 CTAGAACATAGAATGCAAAAAGG + Intergenic
1041282242 8:56222367-56222389 CAGGTTCAAACAATGCAAAAGGG + Intergenic
1041344050 8:56877191-56877213 CTGAATCTAAGGAAGGAAAATGG - Intergenic
1042059617 8:64802564-64802586 TTGGATAAAAGAAAGTAAAAAGG + Intergenic
1042881501 8:73497221-73497243 CTGCATCATAGAATGTGAAATGG - Intronic
1042915949 8:73876502-73876524 CTGGTTAGAGGAATGGAAAACGG - Intronic
1043466117 8:80508732-80508754 GTGGGTCGAAGAATAGAAAAGGG + Intronic
1044524417 8:93235919-93235941 CATGATCAAAGAATGGAAGATGG - Intergenic
1046092350 8:109518647-109518669 CAGGAGCAAAGAAGGAAAAAGGG - Intronic
1047762929 8:127967434-127967456 CTGGCTCAAAGGAAGAAAAACGG + Intergenic
1047982072 8:130193614-130193636 TTGGAACAAAGAGTTGAAAAGGG - Intronic
1048085066 8:131168391-131168413 TTTCATCAAGGAATGGAAAAAGG + Intergenic
1048180516 8:132190077-132190099 CTGGATCAGTGCATGGGAAAAGG + Intronic
1048413153 8:134196975-134196997 ATGGATAGAAGAATGGACAAGGG - Intergenic
1048730959 8:137440598-137440620 CTGGATGAAACAGTGAAAAAAGG - Intergenic
1049177706 8:141204348-141204370 CTGGATAAACGTATGGAAAAGGG + Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050138447 9:2492846-2492868 CTGGATGGAAGAAAGGGAAATGG + Intergenic
1050780864 9:9333326-9333348 ATGGAGCAAAGAATGCAAACAGG + Intronic
1051698066 9:19789725-19789747 CTGGGCCAAAGAATGGAAGACGG + Intergenic
1051960611 9:22758131-22758153 CTGAGTCAAAGAAAGGAAAAGGG - Intergenic
1052286418 9:26790897-26790919 CTGAATGAAAGAAGGAAAAAAGG - Intergenic
1052358955 9:27533757-27533779 CAGGATAAAAGAAAGAAAAAAGG - Intergenic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1053250097 9:36567149-36567171 GTGGAGCACAGGATGGAAAAAGG - Intergenic
1055295115 9:74826082-74826104 CTGTACCAAAGGAGGGAAAAAGG + Intronic
1055389988 9:75810097-75810119 GTGGAAGAAAGAATGGAAATAGG - Intergenic
1056710492 9:88989112-88989134 CTCCATAAAAAAATGGAAAATGG + Intergenic
1057458181 9:95233617-95233639 GTGGATGCAAAAATGGAAAATGG + Intronic
1057551712 9:96055971-96055993 AAGGATCAAAGAATGCAAGATGG - Intergenic
1057642665 9:96840216-96840238 CTGGAACAAAGAAAGCAAGAAGG - Intronic
1058005363 9:99907843-99907865 GTGGATCCTAGAATAGAAAAAGG - Intronic
1058194234 9:101954093-101954115 CTGTCTCAAAGAAAGAAAAAAGG + Intergenic
1058295211 9:103297873-103297895 CGTAATCAAAGAATGAAAAATGG - Intergenic
1058311657 9:103511296-103511318 TTGGATCAAATATTGAAAAAAGG + Intergenic
1059374151 9:113869279-113869301 CTGGATCTCAGAATGGAGATGGG - Intergenic
1059849235 9:118318709-118318731 ATGGATCAACGGATGGAAAAAGG + Intergenic
1060019811 9:120119486-120119508 CTGATCCAAAGTATGGAAAAAGG + Intergenic
1061695515 9:132370340-132370362 CTGGAGGAAAGGATGGAAACAGG + Intergenic
1188053430 X:25514063-25514085 CAAGAACAAAGAATTGAAAAAGG + Intergenic
1188618342 X:32187814-32187836 CTGGAGAAAAGATGGGAAAACGG + Intronic
1189052640 X:37662922-37662944 CTGGATCACAGAATGTTACATGG - Intronic
1191586439 X:62832299-62832321 CTTGATTAAAGAATGGGCAAAGG + Intergenic
1191991795 X:67046001-67046023 CTGGATCTGGGAATGGAAATTGG - Intergenic
1192000082 X:67140509-67140531 CTGGACCCAACAATGGAGAATGG - Intergenic
1192795927 X:74423696-74423718 CTGCATCAAAGCAGGGAAAAAGG - Intronic
1192815852 X:74591275-74591297 CTGGAACAAAAACTGGAGAAAGG + Exonic
1192863238 X:75101712-75101734 CTTGATGGAATAATGGAAAAAGG + Intronic
1193096312 X:77553371-77553393 ATGGATCAGAGAAAAGAAAATGG - Intronic
1193454836 X:81718599-81718621 CTGGATCAGACAATGGTGAAGGG - Intergenic
1194430948 X:93804212-93804234 GTGGATGAAAGAAGAGAAAATGG - Intergenic
1195589469 X:106607786-106607808 TTGGATGGAAGAAAGGAAAAGGG + Intergenic
1196207527 X:112957707-112957729 CTGGATCAGAGAGTGGAGAAAGG - Intergenic
1197237336 X:124082224-124082246 GTGGATCAAAACATGGGAAAAGG - Intronic
1197751101 X:129964100-129964122 CAGGATCAAATAAAGGAATAGGG + Intergenic
1198117983 X:133562994-133563016 GTGGATCAAAGAGAGGGAAATGG + Intronic
1198249225 X:134863520-134863542 CTGGGACAAAGAGTAGAAAATGG - Intergenic
1198636215 X:138703716-138703738 CTGTCTCAAAAAATGAAAAAAGG - Intronic
1199326663 X:146506790-146506812 CTGGAACAAAGGAAAGAAAAGGG + Intergenic
1199462122 X:148096308-148096330 CAGAATCAGAGAATGGGAAAAGG + Intergenic
1200795554 Y:7338223-7338245 CTAGATCTAAGCATGGAACAAGG - Intergenic
1200983239 Y:9281110-9281132 CTGGATCAATATTTGGAAAATGG - Intergenic
1201625302 Y:16008208-16008230 CCCCATCAAAAAATGGAAAAAGG - Intergenic
1202127144 Y:21578587-21578609 CTGGATCAATATTTGGAAAATGG + Intergenic
1202142960 Y:21747374-21747396 CTTGATGAAAAAATGAAAAAGGG + Intergenic
1202143898 Y:21758244-21758266 CTTGATGAAAAAATGAAAAAGGG - Intergenic
1202261591 Y:22975952-22975974 CTGGTTCAAAGACTGGTTAATGG - Intronic
1202414579 Y:24609693-24609715 CTGGTTCAAAGACTGGTTAATGG - Intronic
1202456206 Y:25060393-25060415 CTGGTTCAAAGACTGGTTAATGG + Intronic