ID: 916048789

View in Genome Browser
Species Human (GRCh38)
Location 1:161020658-161020680
Sequence GGTGCGTGTGGAGCGCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916048782_916048789 6 Left 916048782 1:161020629-161020651 CCGTTGGAGGGGCAGGCTGGCCC 0: 1
1: 0
2: 0
3: 30
4: 286
Right 916048789 1:161020658-161020680 GGTGCGTGTGGAGCGCGCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916048789 Original CRISPR GGTGCGTGTGGAGCGCGCGC TGG Intronic
900137370 1:1123514-1123536 GGTGTGTGTGGCGTGTGCGCAGG - Intergenic
900151390 1:1180690-1180712 GGCTCGTGTGGAGGGAGCGCAGG - Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
901243001 1:7705500-7705522 CGAGCGTGTCGGGCGCGCGCGGG + Intronic
903362024 1:22782907-22782929 TGTGCGTGTGGAGCAGGGGCTGG - Intronic
909651275 1:77978863-77978885 GGTAAGTGTGGACCGCGCGGCGG - Exonic
910449075 1:87328803-87328825 GGAGCGGGAGGAGCGCGGGCGGG + Exonic
911696404 1:100895090-100895112 AGGGCGTGTGGAGCGCGGGGAGG - Exonic
916048789 1:161020658-161020680 GGTGCGTGTGGAGCGCGCGCTGG + Intronic
920498281 1:206470698-206470720 GGTGAGTGTGCAGCGTGCGGAGG + Exonic
1073153708 10:101329661-101329683 GGTGTGTGTGGAGGGGGAGCAGG - Intergenic
1073297621 10:102450700-102450722 GGGCCGCGTGGAGCGCGCGCGGG - Exonic
1075556477 10:123436079-123436101 GGTGGGTGTGGAGGGGGAGCTGG - Intergenic
1075725835 10:124610562-124610584 GGTGCTGGTGGAGCGGGTGCGGG + Intronic
1075725864 10:124610667-124610689 GGTGCTGGTGGAGCGGGTGCGGG + Intronic
1076674037 10:132138484-132138506 GGTGTGTGTGGAGAGCGTGCTGG + Intronic
1076683101 10:132185495-132185517 GGCGAGTGTGGAGGGCGCGCGGG - Intergenic
1077247956 11:1548280-1548302 GGGGCGCGTGGAGCCTGCGCTGG - Intergenic
1077417931 11:2433528-2433550 GCTGTGTGTGGAGCGGGCACTGG + Intergenic
1078050778 11:7963185-7963207 GGTGAGTGTGGAGCGGGGGAAGG - Exonic
1084361166 11:68669550-68669572 GGTGGGTGTGGAGCAGGCCCCGG - Intergenic
1090285576 11:125496240-125496262 GCTGCGCGGGGAGCGCTCGCTGG - Exonic
1091749885 12:3015583-3015605 GCTGCGTGTGGACCGCGTGGAGG + Intronic
1094819282 12:34211852-34211874 GGTGCGTGTCGCGCCCACGCGGG - Intergenic
1095097089 12:38154658-38154680 GGTGCGTGTGAAGCCCACGGGGG + Intergenic
1096148967 12:49296906-49296928 GGTGAGTGTGGAGAGCCAGCAGG + Exonic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1112290858 13:98143256-98143278 GGTGGGTGGGGAGCGGGCTCCGG - Intronic
1113343467 13:109448993-109449015 TGTGCGTGTGGAGCGAGGGAGGG - Intergenic
1113656059 13:112068327-112068349 GGTGCGCGGGGTGCGCGTGCGGG - Exonic
1122056334 14:99100820-99100842 GGTGGGTGGGGAGGGCGGGCTGG - Intergenic
1123586881 15:21768958-21768980 GGTACGTGTGGAGGACGTGCAGG - Intergenic
1124109523 15:26773140-26773162 GGGGAGGGAGGAGCGCGCGCGGG + Intronic
1127117468 15:55742735-55742757 GGGGCGTGGGGAGCGCGCGGCGG - Intronic
1129463077 15:75709723-75709745 GGTGCGTGTGGAGCTCTCAGAGG - Intronic
1129721809 15:77881678-77881700 GGTGCGTGTGGAGCTCGCGGAGG + Intergenic
1129823812 15:78621210-78621232 GGGGCGTGTGCAGCTCCCGCAGG + Intronic
1130656448 15:85794818-85794840 GGAGCCTGTTGAGCTCGCGCGGG - Exonic
1133051778 16:3120979-3121001 GGTGAGTGAGGAGCCCTCGCAGG - Intergenic
1136672143 16:31867995-31868017 GGTGCGTGTGGGGCATGTGCAGG - Intergenic
1136913003 16:34159577-34159599 GGTCGGCGTGCAGCGCGCGCAGG + Intergenic
1137756542 16:50906684-50906706 GGGGCGTGTGGAGCTCTAGCTGG + Intergenic
1137787459 16:51150794-51150816 GGTGCGGGTGGAGGTCGCCCCGG - Intronic
1138507611 16:57486086-57486108 GCTGCGGGTGGAGAGAGCGCAGG + Intronic
1139387054 16:66579433-66579455 GGCGCGCGTGGAGAGGGCGCGGG + Intronic
1141682145 16:85551006-85551028 GGTGGGTGTGCAGCGTGGGCAGG + Intergenic
1143584028 17:7842577-7842599 GGTGAGAGTGGAGCGCGAGCTGG + Intronic
1143728525 17:8866562-8866584 GGGGTGTGTGGAGCACTCGCAGG - Intronic
1144695827 17:17303425-17303447 GGCGCGCGTGGAGCGCGGGACGG - Exonic
1147139672 17:38453996-38454018 GTGGCGCGTGGAGCGCGCGGGGG + Intronic
1147605903 17:41773597-41773619 GGTGCGTGTGGAAAGGGGGCTGG - Intronic
1151672758 17:75580843-75580865 GGTGGCTGTGGAGCGCGGGGTGG - Intergenic
1153006232 18:500662-500684 GGAGCGCGGGGAGCGCGGGCCGG - Exonic
1153051981 18:908405-908427 GGTGCCTGTGCGGGGCGCGCGGG + Intronic
1153794639 18:8610268-8610290 GGTTCGAGTGGAGCGCAGGCAGG + Intronic
1154954721 18:21242563-21242585 GGTGTGAGCGGAGCGCGTGCGGG + Intronic
1155474830 18:26227029-26227051 GGTGCGGGTGGAGAGCACTCCGG + Exonic
1158251267 18:55489965-55489987 GGTGCGTGTGGAGAAGGAGCTGG - Intronic
1160514413 18:79470608-79470630 GGTGCTTGTGGGGGGCGGGCTGG + Intronic
1160991679 19:1862872-1862894 GGTGGGTGGGGCGCGCGCGGGGG - Intronic
1161388100 19:4007640-4007662 GCGGCGGGAGGAGCGCGCGCGGG + Exonic
1161990674 19:7682283-7682305 GGCGCTGCTGGAGCGCGCGCTGG + Exonic
1163492175 19:17623428-17623450 GGTGGGTGAGGAGGGGGCGCTGG + Intronic
1163635573 19:18435735-18435757 CGTGCGTGGGGCGCGGGCGCGGG - Exonic
1168076389 19:53982742-53982764 GGCGCGGGTGGCGCGGGCGCGGG - Exonic
925165094 2:1710972-1710994 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165112 2:1711049-1711071 GGTGCTTGTGGAGCGGGTGCTGG - Intronic
925165134 2:1711147-1711169 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165142 2:1711179-1711201 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165146 2:1711194-1711216 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165160 2:1711256-1711278 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165172 2:1711305-1711327 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165176 2:1711320-1711342 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165190 2:1711382-1711404 GGTGCTTGTGGAGCGGGTGCTGG - Intronic
925165208 2:1711463-1711485 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165212 2:1711478-1711500 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165246 2:1711623-1711645 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
927997284 2:27495013-27495035 GCTGCGGGCGGAGCGGGCGCGGG + Exonic
933583799 2:84158371-84158393 GGTGCCTGTGGAGAGCACCCAGG + Intergenic
935332703 2:101988725-101988747 GGTGCCTGTGGAGGGAGAGCAGG + Intergenic
935590396 2:104842664-104842686 TGTGAGTGCGGTGCGCGCGCAGG - Intergenic
948140860 2:235670831-235670853 GCAGCGGCTGGAGCGCGCGCGGG + Intronic
1168753029 20:297357-297379 GGTGAGGTTGGAGCGAGCGCTGG + Exonic
1169006057 20:2207848-2207870 GGTGCGCGTGGGGCGGGGGCTGG - Intergenic
1171010471 20:21506501-21506523 GGGGCGCGTGGAGCGTACGCGGG + Intergenic
1174258836 20:49278397-49278419 GGTGCGTGTGAAGCGCGACATGG + Intronic
1175890225 20:62312717-62312739 GGTGCGTGTGGAGCGGGCCACGG - Exonic
1176380994 21:6111874-6111896 GGTCCGGGTGGAGCGGGCGGCGG + Intronic
1179742478 21:43426366-43426388 GGTCCGGGTGGAGCGGGCGGCGG - Intronic
1179996921 21:44978383-44978405 GGCGCGTGTGGGGCGCGTGTGGG + Intergenic
1179996927 21:44978405-44978427 GGCGCGTGTGGAGCGGGTGTGGG + Intergenic
1179996996 21:44978614-44978636 GGCGCGTGTGGAGCGGGTGTGGG + Intergenic
1179997039 21:44978757-44978779 GGCGGGTGTGGAGCGCGTGAGGG + Intergenic
1180342426 22:11629053-11629075 GGTCGGCGTGCAGCGCGCGCAGG + Intergenic
1181831634 22:25564886-25564908 GGGGCGCGCGGCGCGCGCGCGGG + Exonic
1182357676 22:29729698-29729720 GGTGGGTGGGGAGGGCTCGCTGG - Exonic
1183672758 22:39282873-39282895 GGTGCGTGTGCAGCTTGGGCTGG - Intergenic
952316813 3:32238827-32238849 GGTGCGAGGGGGGCGCCCGCCGG - Exonic
956659453 3:71583640-71583662 TGTGCGCGGGGTGCGCGCGCGGG - Intronic
960829903 3:121835159-121835181 GGTGCGCGTCGAGCGCGGGGTGG + Intergenic
964509755 3:157437775-157437797 GGCGCGTATGGAGGGCGCGGAGG + Exonic
967228732 3:187317928-187317950 GGTGGGTGTGGAGTGGGGGCGGG - Intergenic
967272655 3:187743921-187743943 GGCGCGGGAGGAGCGGGCGCGGG - Intronic
968051554 3:195658240-195658262 GGTCCGAGCGGAGCGGGCGCCGG + Intergenic
968104263 3:195990093-195990115 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
968302564 3:197627683-197627705 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
985497622 5:218493-218515 GGTCCGAGCGGAGCGGGCGCCGG + Intronic
985650362 5:1104679-1104701 GGTGCGTGTGGGGTGCGTGTGGG + Intronic
985848382 5:2370975-2370997 GATGTGTGTGGACCACGCGCAGG - Intergenic
993905023 5:93612657-93612679 GGGGGGTGGGGCGCGCGCGCTGG + Intergenic
996158698 5:120135557-120135579 GGTACGTGTGCAGAACGCGCAGG + Intergenic
1002646334 5:180658426-180658448 GAGGCGTGTGCTGCGCGCGCCGG + Intergenic
1005048596 6:21664806-21664828 GGTGCGAGTGAAGCGCGGGGCGG + Intergenic
1005612952 6:27544439-27544461 GGTTCGTGTGGGGGGCGGGCGGG - Intergenic
1007785128 6:44275489-44275511 GGTGGGGCTGGAGGGCGCGCCGG + Exonic
1013170774 6:107634848-107634870 CGTGCGCGTGCAGCGCGCGGTGG - Exonic
1014001446 6:116370673-116370695 GGTGCGGGTGGAGTCCGGGCCGG + Intronic
1019565659 7:1677828-1677850 GGAGCGTGTGGAGCTCCCGCGGG + Intergenic
1022721256 7:32943206-32943228 GGTGGGCGGGGAGCGCCCGCTGG + Intergenic
1022923501 7:35037971-35037993 GCTGCGCTTGGAGCCCGCGCAGG + Exonic
1027001572 7:74657996-74658018 GGCGAGTGTGGGCCGCGCGCGGG - Intronic
1029224159 7:99012935-99012957 GATGCGTGTGGCGCTCCCGCAGG - Exonic
1029483993 7:100828249-100828271 GGTGGGTGTGGCGGGCGCGGTGG + Intronic
1034639446 7:152590996-152591018 GGTGAGTGAGGAGCGGGAGCGGG + Intergenic
1035132535 7:156669226-156669248 GGTGCATGTGGAGGCCGCTCGGG + Intronic
1035351653 7:158251595-158251617 GGTGCATGTGGGGCGTGTGCAGG + Intronic
1035574540 8:696366-696388 GGAGGGTGAGGAGCGAGCGCAGG - Intronic
1035574607 8:696665-696687 GGAGGGTGAGGAGCGAGCGCAGG - Intronic
1037510467 8:19576993-19577015 GGTGGGTGTGGAGGGCGAGAGGG - Intronic
1039608543 8:38901557-38901579 GGCGCGAGGGGCGCGCGCGCAGG + Intronic
1049093224 8:140532499-140532521 GGAGCGTGTGCAGCGCACGTAGG + Exonic
1049748529 8:144273052-144273074 GCTGCTTGTGGAGGGCGCCCGGG - Intronic
1049777492 8:144413449-144413471 GGTTTGTGTGGAGCGCGGGTGGG - Intronic
1053198412 9:36136902-36136924 GGTGCGGGTGGAGGGCGCGCGGG + Intronic
1053482186 9:38424016-38424038 GGGGCGTGTGCCGAGCGCGCAGG + Exonic
1058686872 9:107487947-107487969 GCTGCAGGTGGAGGGCGCGCTGG + Exonic
1060868507 9:127019762-127019784 GGTGCATGTGCAGGGCGTGCAGG + Intronic
1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG + Intergenic
1061357905 9:130120240-130120262 GGTGCCTGTGTGGGGCGCGCAGG + Intronic
1061432068 9:130537327-130537349 GGGGCCTGTGGAGCCCGGGCAGG - Intergenic
1061501954 9:131009145-131009167 GGTGGGCGCGGACCGCGCGCTGG - Exonic
1185449668 X:275604-275626 GGTGCGTGGGGAGCACCTGCGGG + Intergenic
1190279206 X:48918483-48918505 GGTGCGTGTGGCGGGGGCGGGGG - Intronic