ID: 916056866

View in Genome Browser
Species Human (GRCh38)
Location 1:161074041-161074063
Sequence CTAAGGGTCTGGAGCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916056866 Original CRISPR CTAAGGGTCTGGAGCACAGA TGG (reversed) Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
900520801 1:3104687-3104709 CTAGGGGTTTGTAGCCCAGAGGG - Intronic
900564765 1:3326823-3326845 CTCAGGGTCAGGAACAGAGAAGG + Intronic
900857668 1:5198947-5198969 CTGAGGGTCTGGGCCACACAGGG + Intergenic
901631560 1:10650770-10650792 CCAAGGGACTTGAGCTCAGACGG + Intronic
901635100 1:10666866-10666888 CACAGGGTCTGGCCCACAGAAGG - Intronic
905888577 1:41505298-41505320 CTAAGGGTCGGGAGGACGAAGGG - Intergenic
907303045 1:53500183-53500205 CAGAGGGTCTGGTGCACAGCTGG - Intergenic
907422764 1:54358286-54358308 CTGAGGGTCTGTTGCACACAAGG - Intronic
907442729 1:54488884-54488906 GTCAGGGGCTGGAGCATAGACGG - Intergenic
908955350 1:69618892-69618914 CTAAGTGTTTGGAACACAGGTGG - Intronic
909268020 1:73587036-73587058 CATACGGTCTGGAGCACAGATGG + Intergenic
909856414 1:80538812-80538834 CTTAGGGTTTTGAGCAAAGAAGG - Intergenic
914750082 1:150529041-150529063 CAAAGGATCTAGAGCACAGGTGG + Intergenic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
916435063 1:164770392-164770414 CTGAGGAGTTGGAGCACAGAAGG - Intronic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
918391146 1:184064096-184064118 CTAACAGTCTGGAGCTGAGATGG + Intronic
919781242 1:201222579-201222601 CTAAAGGACTGGAGTACAGCTGG - Intronic
922440837 1:225653579-225653601 CTACGGGTCTGGCGCCCAGGAGG - Intergenic
923469019 1:234273700-234273722 TTGAGGGTCTGGAGCAGGGAAGG + Intronic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1069426160 10:68290358-68290380 CTAAGGCTCTGGAGAACAGATGG - Intronic
1069589684 10:69634134-69634156 CTGAGGCTCTGGGCCACAGAGGG + Intergenic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1070889317 10:79930323-79930345 CAGAGGGTCCGGTGCACAGATGG + Intergenic
1071290507 10:84185567-84185589 CAAAGGGCCTGGCACACAGAGGG + Intergenic
1071290610 10:84186078-84186100 CAAAGGGCCTGGCGCACAGAGGG - Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1073989447 10:109245851-109245873 CTATGGGTCTGAAGCATAGCAGG - Intergenic
1074077014 10:110137777-110137799 CACAGGGTCTGGCACACAGATGG - Intergenic
1074750111 10:116577747-116577769 CAAAGATTCTGAAGCACAGAGGG - Intergenic
1080992604 11:37557437-37557459 CTAAGTGTCTGGCCCACAGTAGG - Intergenic
1081659584 11:44879804-44879826 ATAAGTGTCTGGAGGCCAGATGG + Intronic
1083120559 11:60508812-60508834 CTAAGGGTCTGGAAAATAAATGG + Intergenic
1083616291 11:64028246-64028268 CTGAGGGTCTGGAGCCGAGGGGG + Intronic
1088441014 11:109870307-109870329 CTAGGGAGCGGGAGCACAGATGG - Intergenic
1089003794 11:115074149-115074171 TTAAGGGTCTGGGACTCAGAAGG + Intergenic
1090067139 11:123512729-123512751 CAAAGGGTCTGGATTAGAGAAGG - Intergenic
1090481919 11:127076566-127076588 ATAAGAGTCTGGAACTCAGAAGG + Intergenic
1091322224 11:134659837-134659859 CTTAGAGGCTGGAGGACAGATGG + Intergenic
1092662146 12:10750072-10750094 CCAAAGGTCTGGATCACAGTTGG + Intergenic
1093477938 12:19575203-19575225 CTAAAGGTCATTAGCACAGAAGG + Intronic
1096541605 12:52310788-52310810 CAAAGGGACTGGAGCACGTAGGG - Intergenic
1096685957 12:53288455-53288477 CTAAGGGAGTGGATTACAGAAGG + Intronic
1097577018 12:61407428-61407450 CTATGTGTCTGGAACACTGAAGG + Intergenic
1098190580 12:67944516-67944538 CAAAGGGGCTGGACCACAGCAGG - Intergenic
1098590141 12:72201499-72201521 CAGAGGGTCTGGAGCCTAGAGGG - Intronic
1099051192 12:77783448-77783470 GGAAGGGTGTGGTGCACAGAGGG + Intergenic
1100029156 12:90164607-90164629 CCAAGGGTGTGGAGGACACAAGG - Intergenic
1101315106 12:103621836-103621858 CTAAGGGTCTGAAGCTCTGCAGG - Intronic
1103184583 12:118945422-118945444 CTATGTATCTGCAGCACAGAAGG - Intergenic
1103218162 12:119219696-119219718 CAAAGGGCCTGGTGCACAGTGGG - Intronic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1105034023 12:132905328-132905350 CGGAAGGTCCGGAGCACAGAGGG + Intronic
1106485572 13:30169376-30169398 CTAAGGCTGTGGATCACAGTTGG + Intergenic
1106538735 13:30671545-30671567 CTCAGGGTATGGTTCACAGATGG - Intergenic
1106658719 13:31775988-31776010 CTAAGGGCCAGGCACACAGAAGG - Intronic
1112811437 13:103223513-103223535 GTAAGTGTTTGGAGCCCAGAAGG - Intergenic
1113124835 13:106965764-106965786 CTAAGAGCCAGGAGCACTGAGGG + Intergenic
1113897533 13:113775676-113775698 CTGAGGGAGTGGAGCACAGGCGG + Intronic
1116204977 14:41853648-41853670 ATAAGGTTCTGGAACTCAGAGGG + Intronic
1117744952 14:58860268-58860290 CTAAGGGTATGGAGTCCAGCTGG + Intergenic
1117949465 14:61067390-61067412 CTAAATGTCTGAAGCAGAGACGG - Intronic
1119952568 14:78760408-78760430 CTAAGGGTCTGGAACATAGTAGG + Intronic
1120872569 14:89351209-89351231 CTAAATTTCTGGAGCAGAGATGG - Intronic
1126711184 15:51457994-51458016 CTAAGAGTCTGGAGAAAAGCAGG + Intronic
1127311342 15:57754629-57754651 CCTAGGGTCTGAATCACAGAAGG - Intronic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128359504 15:66951595-66951617 CTAAGGTTCTGTAGCACTGTAGG - Intergenic
1128543396 15:68552019-68552041 CTGAGGTTCTGGAACCCAGAAGG + Intergenic
1130550562 15:84887813-84887835 CCAAGGGTCTGGAGAACATGGGG + Exonic
1132751927 16:1461572-1461594 CTCAGGGTCAGGGGGACAGAAGG + Intronic
1133317409 16:4893186-4893208 CTGCGGGTCAGGAGCACAGGTGG - Intronic
1133502647 16:6380225-6380247 CCCAGGGCTTGGAGCACAGAAGG - Intronic
1133599390 16:7324367-7324389 GTAGGGTCCTGGAGCACAGAAGG + Intronic
1134630213 16:15750760-15750782 CCCAGGGCCTGGAGCACAGAAGG - Intronic
1134646179 16:15868700-15868722 TTAAGGGTCTGGAAAACAGATGG + Intronic
1137036677 16:35574676-35574698 CAGAGGGTCGGGACCACAGATGG - Intergenic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1139472480 16:67185541-67185563 CGGAGGGTCTGGACCACCGAGGG - Intronic
1140045729 16:71439396-71439418 TCTAGGGGCTGGAGCACAGAGGG + Intergenic
1140350021 16:74253178-74253200 CTAAGAGAATGGAGAACAGAAGG + Intergenic
1141939296 16:87263950-87263972 CTAAGGATGAGGAACACAGAAGG + Intronic
1142247092 16:88975165-88975187 CTAAAGATGTGGAGCAGAGAGGG - Intronic
1144562057 17:16329047-16329069 CCAAGGGACTGCAGCACAGGAGG + Intronic
1144577626 17:16439008-16439030 TTAAGGGCCTGGCGCACATAAGG + Intergenic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1144954594 17:19012678-19012700 CCAAGGGTCTGGATCACCCAGGG + Intronic
1145092239 17:19995442-19995464 CTTAGTCTCTGGAGCACAGTTGG + Intergenic
1145166411 17:20615944-20615966 CTATGGGTCCGTAGCACAGCAGG + Intergenic
1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG + Intergenic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146973665 17:37093021-37093043 CTATGGGCCTGGAGCTGAGATGG - Intronic
1149475577 17:56958244-56958266 CTAATTGTCTGTATCACAGAAGG + Intronic
1151783518 17:76263562-76263584 CTAAAGGTCTGCAGAACAGAAGG - Intergenic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1153046149 18:857219-857241 CTCAGGGTCTCAAACACAGATGG + Intergenic
1153158353 18:2175225-2175247 GTAAGAGACTGGAGCACTGAAGG - Intergenic
1153528459 18:6019991-6020013 CTTAGGGTCTGGCACACAGTAGG - Intronic
1157121281 18:44913560-44913582 CGAAGGGCCTGGAAAACAGAAGG + Intronic
1157681230 18:49608671-49608693 CTTAGGATTTGGAGCTCAGAAGG + Intergenic
1158438623 18:57453168-57453190 CTAATGATCTGGTGCACAGAGGG + Intronic
1159711347 18:71764465-71764487 ACAAGGGTCTGGTTCACAGATGG + Intronic
1161209694 19:3059965-3059987 CGAACGGTCTTGAGCACACAGGG + Intronic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162792999 19:13072615-13072637 CCAAGAGTCAGGAGCAAAGAGGG - Intronic
1163450092 19:17371977-17371999 CTAAGGCTTTTGAGAACAGAAGG - Intronic
1166993086 19:46704877-46704899 TTCAGGGTCTGGGGGACAGATGG - Intronic
1166993116 19:46704996-46705018 TTCAGGGTCTGGGGGACAGATGG - Intronic
1167677216 19:50894761-50894783 CAAAGGGCCTGGGGCACAGGTGG - Intergenic
926336817 2:11869700-11869722 CTCAGGGTCTGGATGACAGGAGG - Intergenic
927512105 2:23650195-23650217 CTCAGGGGCTGGAGAAAAGAGGG + Intronic
929271414 2:39976564-39976586 CAAGGCCTCTGGAGCACAGAAGG - Intergenic
929373648 2:41257358-41257380 CTAAGGTTCAGAAGTACAGATGG - Intergenic
930035035 2:47079991-47080013 GTGAAGGTCAGGAGCACAGACGG + Intronic
934065518 2:88337321-88337343 CTAATGGTCTGGAGCACATCAGG - Intergenic
934988272 2:98902660-98902682 GGAAGGGTCTGTAGGACAGAGGG + Intronic
936542181 2:113361567-113361589 CTGAGGGGCTTGTGCACAGATGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937039049 2:118807092-118807114 CTCAAGGTCTGGAGCCCAGAGGG + Intergenic
937229671 2:120390344-120390366 CTGCAGGTCAGGAGCACAGAGGG + Intergenic
937823151 2:126334676-126334698 GTCAGGGCCTGGAGCAGAGAGGG - Intergenic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
947010553 2:225561532-225561554 CCAAGGGCCTGGAGTACAGCAGG - Intronic
1169902224 20:10565198-10565220 CTAAGGTTCCTGACCACAGAGGG - Intronic
1171957738 20:31472862-31472884 CTCAGGTCCTGGAGGACAGAGGG - Intronic
1172739235 20:37152467-37152489 CGGAGGGTCTTGAGCAGAGAAGG + Intronic
1176951657 21:15054758-15054780 GTAAGTGTCTGGCACACAGAAGG - Intronic
1178571450 21:33741100-33741122 TTAGGGGTCTGCAGCACAGATGG + Intronic
1178838641 21:36120473-36120495 CACAGGGTCTGAAGAACAGAAGG - Intergenic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1180572039 22:16734219-16734241 CTGAGGGTCAGGAGTATAGATGG + Intergenic
1181855816 22:25780750-25780772 CTGAAAGTCTGAAGCACAGACGG - Intronic
1181944938 22:26509198-26509220 CTTGGGGGCTGGAGCAGAGAGGG - Intronic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1183501857 22:38184956-38184978 CTAAGAGCCCAGAGCACAGAGGG + Intronic
1185007726 22:48292686-48292708 CCAAGGGTCACGTGCACAGAGGG + Intergenic
951356477 3:21672967-21672989 CAAAGGGGCTGCAGTACAGAGGG - Intronic
953023901 3:39133928-39133950 CCCAGAGTCTGGGGCACAGAGGG + Intronic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
954697208 3:52434249-52434271 CTCAGGCTGGGGAGCACAGAGGG - Exonic
955214121 3:56970985-56971007 CTTAGTGACTGGAGCACAGAAGG + Intronic
955268876 3:57476935-57476957 CTAAGGGGGTGGAGCCAAGATGG + Intronic
955798466 3:62662060-62662082 CTATGTGTCTGGAACTCAGAAGG + Intronic
957387348 3:79514014-79514036 CTAACGGTCTAGAGAACAAAAGG - Intronic
957927091 3:86828206-86828228 CAAAGGTTCAGGTGCACAGATGG + Intergenic
959403875 3:105936842-105936864 ATGAGTGACTGGAGCACAGAGGG - Intergenic
960454982 3:117860066-117860088 ATATGGGTCTGGAGCACAGCGGG - Intergenic
961415774 3:126755442-126755464 CTGAGGCTCTGCAGCACAGCAGG + Intronic
961673661 3:128551876-128551898 CTTAGGGTCTGGGACACAGAAGG - Intergenic
962196739 3:133370265-133370287 CAAAGGGTCAGAAGCAAAGAAGG - Intronic
963060586 3:141221726-141221748 CAAAAGGTCTGGTGCACAGGAGG + Intergenic
963136317 3:141908591-141908613 CTCAGGGGCAGGGGCACAGAAGG - Intronic
963844217 3:150139179-150139201 ATATGGATCTGGAGCTCAGAAGG + Intergenic
964375934 3:156049102-156049124 CTTCGGGTCTGGAGCACAGCAGG + Intronic
965175538 3:165325831-165325853 CTAATGGTCTGGAGAACTTACGG - Intergenic
966380656 3:179341687-179341709 TTAAGAGTTTGGAGAACAGACGG - Intergenic
968591493 4:1462031-1462053 CCAAGGTTCAGGAGCACGGATGG - Intergenic
973187608 4:47349125-47349147 ATACAGGTCTGGAGCACAGAGGG + Intronic
973290965 4:48469984-48470006 CTCAGGGCCTGGAACACAGTAGG + Intergenic
974403413 4:61433723-61433745 ATATGAGTCTGGAGCTCAGAAGG - Intronic
975683028 4:76895881-76895903 CTTGGTGTCTGGAGCAAAGAAGG - Exonic
977331252 4:95640453-95640475 CCAAGTGCCTGGAGCACAGCAGG + Intergenic
980736403 4:136895250-136895272 CTGAGAATCAGGAGCACAGAGGG - Intergenic
984724713 4:183009668-183009690 CTAAGGAGCTGGAGGACAAAAGG + Intergenic
984750086 4:183263866-183263888 CTAAGCCTCTAGAGCACTGAGGG - Intronic
985302349 4:188504049-188504071 ATAAGGTTCTGGAACAGAGAGGG + Intergenic
985302566 4:188505864-188505886 ATAAGGTTCTGGAACAGAGAGGG + Intergenic
986397991 5:7349460-7349482 ATCAGGGTGTGGAGCACACATGG - Intergenic
986503179 5:8422697-8422719 GTAAGGGGCTGGGGCACACAAGG + Intergenic
987026244 5:13929698-13929720 CTCAGGCTCTCAAGCACAGAGGG - Intronic
989295179 5:39817321-39817343 CTAAGGCTCTGAAACATAGAGGG + Intergenic
989666486 5:43859855-43859877 GGAAGGGTCTCAAGCACAGAAGG - Intergenic
990488310 5:56280285-56280307 CTACTGCTCTGGAGCACAGAAGG + Intergenic
990496163 5:56350169-56350191 CAAAAGGTCTGTAGCACAGTGGG + Intergenic
992089570 5:73304947-73304969 TTCAGGGTCTTGAGTACAGAGGG + Intergenic
992357834 5:76003816-76003838 CATAGGGTGTGGAGCTCAGAGGG + Intergenic
992818865 5:80473409-80473431 TAAGGGGTCTGGAGCAAAGAAGG + Intronic
994060944 5:95475959-95475981 CTAAGGCCCTGGAGCAGAGCTGG - Intronic
995504700 5:112848124-112848146 CTAAGGGTCTGGATTCCAAAAGG - Intronic
996315734 5:122158730-122158752 CTATGAGTCTGGAACTCAGAAGG + Intronic
996410593 5:123154846-123154868 CTAAGGGTATGGTTCTCAGAAGG - Intronic
996790323 5:127286232-127286254 CTAATGGTCAGTAGCAGAGAAGG + Intergenic
998620399 5:143788371-143788393 CTAAGTGCCTGGAGCAGAGCAGG + Intergenic
1002616837 5:180461384-180461406 CTATGAGTCTGGGGAACAGATGG - Intergenic
1002934771 6:1662135-1662157 GTAAAGGTCTGGAACACAGAAGG - Intronic
1003291428 6:4782024-4782046 CTAAGGGTCTGAAACACAGAAGG - Intronic
1007353332 6:41291663-41291685 CGAAAGGACTGGGGCACAGATGG + Intergenic
1007930600 6:45687265-45687287 CCAGGGGTCAGGAGCAAAGATGG - Intergenic
1007960510 6:45954852-45954874 CTAAGTTTCTGGTGCACATATGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1010952747 6:82056719-82056741 TTATGGGTCTTGACCACAGAGGG - Intergenic
1010981109 6:82371008-82371030 CTAAGGGCCTGGACCAAACAGGG + Intergenic
1014188837 6:118468018-118468040 CTTAGTGTCTGGACCATAGAAGG + Intronic
1019495696 7:1339419-1339441 CTAAGGGTCTGGAGAGAAAAAGG - Intergenic
1021332303 7:19353928-19353950 CTAAGATTCAGGAACACAGAAGG + Intergenic
1022783134 7:33606590-33606612 CTTAATGTCTGGAGCAGAGAGGG + Intergenic
1023863290 7:44227632-44227654 AGGAGGGTCTGGAGGACAGAGGG + Intronic
1023874462 7:44279209-44279231 CCCAGGGTCTGGGGCCCAGATGG + Intronic
1024337998 7:48228568-48228590 CTGAGGGTGGGGAGCACATAGGG + Intronic
1027119469 7:75506358-75506380 CAAAGGGACTTCAGCACAGATGG + Intergenic
1027646674 7:80809942-80809964 ATCAGGGGCTGGAGGACAGAGGG + Intronic
1029288578 7:99484210-99484232 CTCAGCGTCTGGCACACAGAAGG - Intronic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1031128871 7:117807695-117807717 CTCAGGATCTGGAGCAGTGAGGG + Intronic
1031275199 7:119712520-119712542 TCTAGGGTCTGGAGGACAGATGG + Intergenic
1033586157 7:142775906-142775928 CCACATGTCTGGAGCACAGATGG - Intergenic
1034338473 7:150338184-150338206 CTCTGGCTCTGGAGCACAGGAGG + Intergenic
1035022802 7:155809080-155809102 CTAAGGGGCAGGAGGCCAGAGGG - Intronic
1035160271 7:156944849-156944871 GAAAGGCTCTGAAGCACAGATGG - Intergenic
1035653268 8:1284938-1284960 CTAAGAATCTGGTGCAAAGATGG - Intergenic
1038740294 8:30211280-30211302 CTCAGGGTCTGGCACACAGTAGG + Intergenic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1045343643 8:101275165-101275187 CAAAGGGTGTGGAGAGCAGATGG - Intergenic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1046604040 8:116350950-116350972 CTCAGGGTTTGGAGTAGAGACGG - Intergenic
1048047382 8:130785657-130785679 CTAAGGGTCAGGAGTGGAGATGG + Intronic
1048226779 8:132595257-132595279 ATAAGGTTCTGGAATACAGAAGG - Intronic
1049495189 8:142926916-142926938 GAGAGGGACTGGAGCACAGAAGG - Intergenic
1050317993 9:4423009-4423031 CTAAGGGTCAGGTGGACAGAAGG + Intergenic
1050365039 9:4866208-4866230 CTAAGGGTCAGAAGGACAGAGGG - Intronic
1051301362 9:15654660-15654682 CTAAGGGGGTGGAGCCAAGATGG + Intronic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1055328882 9:75161414-75161436 CACAGAGTCTGGACCACAGAGGG + Intergenic
1055575892 9:77660047-77660069 CTAAGGCTCTGGGGCCCAGCCGG + Intergenic
1055590076 9:77803054-77803076 CCAAGGGCCTGGAGCACAGCAGG + Intronic
1057824255 9:98360072-98360094 CTCAGAGTCCGGAGCACACAGGG + Intronic
1058166151 9:101621633-101621655 CTAAGTCTCAGGAACACAGATGG + Intronic
1186030392 X:5362624-5362646 TTAAAGGGCTGGAGGACAGATGG - Intergenic
1187049001 X:15677452-15677474 CAAAGGATGTGTAGCACAGAAGG + Intergenic
1189835145 X:45012542-45012564 TTAAAATTCTGGAGCACAGAAGG - Intronic
1198649249 X:138843094-138843116 CTAAAGCTCTGGAGCACTGTAGG + Intronic
1199538357 X:148929696-148929718 CTAAGAGTCTGGAACCCAGTAGG + Intronic
1200122045 X:153795670-153795692 CTCTGGGTCTGGACCACAGGAGG - Intronic
1201776476 Y:17671306-17671328 CTAGGGGACTGGAGCATTGAAGG + Intergenic
1201825080 Y:18234686-18234708 CTAGGGGACTGGAGCATTGAAGG - Intergenic
1202342955 Y:23888696-23888718 CCAGGGGTCTGGAGCATAGGAGG - Intergenic
1202527813 Y:25781389-25781411 CCAGGGGTCTGGAGCATAGGAGG + Intergenic