ID: 916057835

View in Genome Browser
Species Human (GRCh38)
Location 1:161080220-161080242
Sequence ATACAATCCTAGGCTGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916057835_916057837 -6 Left 916057835 1:161080220-161080242 CCTCTTGCAGCCTAGGATTGTAT 0: 1
1: 0
2: 0
3: 11
4: 137
Right 916057837 1:161080237-161080259 TTGTATCCTGAGCAGTTGCAAGG 0: 1
1: 0
2: 1
3: 6
4: 127
916057835_916057839 -2 Left 916057835 1:161080220-161080242 CCTCTTGCAGCCTAGGATTGTAT 0: 1
1: 0
2: 0
3: 11
4: 137
Right 916057839 1:161080241-161080263 ATCCTGAGCAGTTGCAAGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 130
916057835_916057838 -3 Left 916057835 1:161080220-161080242 CCTCTTGCAGCCTAGGATTGTAT 0: 1
1: 0
2: 0
3: 11
4: 137
Right 916057838 1:161080240-161080262 TATCCTGAGCAGTTGCAAGGTGG 0: 1
1: 1
2: 0
3: 2
4: 142
916057835_916057841 1 Left 916057835 1:161080220-161080242 CCTCTTGCAGCCTAGGATTGTAT 0: 1
1: 0
2: 0
3: 11
4: 137
Right 916057841 1:161080244-161080266 CTGAGCAGTTGCAAGGTGGGAGG 0: 1
1: 0
2: 1
3: 34
4: 255
916057835_916057842 16 Left 916057835 1:161080220-161080242 CCTCTTGCAGCCTAGGATTGTAT 0: 1
1: 0
2: 0
3: 11
4: 137
Right 916057842 1:161080259-161080281 GTGGGAGGCTGTAACAGAACAGG 0: 1
1: 0
2: 2
3: 20
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916057835 Original CRISPR ATACAATCCTAGGCTGCAAG AGG (reversed) Intronic
908091807 1:60694044-60694066 AAACCATCCTTGGCTGCATGAGG - Intergenic
911542092 1:99169356-99169378 ATACAAAAATTGGCTGCAAGTGG - Intergenic
911728043 1:101263176-101263198 ATACAATTATAGGCTGCAAATGG + Intergenic
912398384 1:109367025-109367047 ATACAAGCCTAGGCAACATGGGG + Intronic
914976482 1:152368427-152368449 AAGCCATCCTAGGCTGCATGTGG + Intergenic
916057835 1:161080220-161080242 ATACAATCCTAGGCTGCAAGAGG - Intronic
916812168 1:168315095-168315117 AGCCAATGCTAGGCTCCAAGTGG - Intergenic
921372154 1:214435037-214435059 AAGCCATCCTAGGCTGCATGTGG + Intronic
922591043 1:226777304-226777326 GAACAATCCAAGGCTGCCAGAGG + Intergenic
922660159 1:227422985-227423007 ATACATTCCAAGACTGCCAGTGG + Intergenic
923749903 1:236737893-236737915 ATACAAGCATGGGCTGCATGAGG + Intronic
1068860206 10:61840317-61840339 ATATAATCCTAGGGGGAAAGTGG - Intergenic
1070393840 10:75994372-75994394 GTACAATCCTAGGGTGCAGAAGG - Intronic
1070911395 10:80121893-80121915 ATGCAATCCAGGACTGCAAGTGG - Intergenic
1075693579 10:124418223-124418245 AAAAAATCATAGGCTGGAAGAGG + Intronic
1080011211 11:27461549-27461571 AAGCCATCCTAGGCTGCATGGGG - Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1084978329 11:72815243-72815265 ATACAATCGCAGGCGGCCAGAGG - Intronic
1084999361 11:73016010-73016032 AAACAATGATAGGCTGCACGTGG + Intronic
1086474214 11:87153014-87153036 ATAAAATCCAAGGGTACAAGAGG - Intronic
1090696290 11:129246107-129246129 ATACAATCCCTGCCTTCAAGGGG + Intronic
1096617930 12:52844770-52844792 CAACCATCCTAGGCTTCAAGGGG - Intronic
1097631229 12:62065374-62065396 ACAGAATCCTAGTCTGCAATAGG - Intronic
1097788370 12:63786956-63786978 ATACAAAAATTGGCTGCAAGTGG + Intronic
1102620974 12:114194178-114194200 ACACACCCCTAGGCTGAAAGGGG + Intergenic
1102628437 12:114255288-114255310 ATAAAATCCTAAGTTGCAGGTGG - Intergenic
1104187931 12:126450118-126450140 ATACAATCTTAAGATGCAATGGG + Intergenic
1105307634 13:19180316-19180338 TTACACTCCTAGGCTTCAAGGGG - Intronic
1106305139 13:28503139-28503161 ATACAATCTTAGTGTGCAAGTGG + Intergenic
1109474742 13:62864625-62864647 TTACATTCTTAGGCTGCATGTGG - Intergenic
1110133619 13:72038033-72038055 AAGCCATCCTAGGCTGCATGTGG + Intergenic
1114032681 14:18589708-18589730 GTAGGATCCCAGGCTGCAAGTGG + Intergenic
1114077468 14:19168733-19168755 GTAGGATCCCAGGCTGCAAGTGG + Intergenic
1114084697 14:19230830-19230852 GTAGGATCCCAGGCTGCAAGTGG - Intergenic
1117440283 14:55753126-55753148 ATACATTTCTTGGCTGCAAGTGG - Intergenic
1120263142 14:82214021-82214043 ATAGAATCCTTCCCTGCAAGAGG - Intergenic
1120951228 14:90044006-90044028 ATACAATTCTTAGCTGCAGGGGG - Exonic
1123229480 15:17087563-17087585 TTTCAATCATAGGCTGCAAAGGG - Intergenic
1127312909 15:57768179-57768201 ATAAAATCCCAGGCTTCATGGGG - Intronic
1131244813 15:90781738-90781760 AAACCATCCTGGGCTGCATGTGG + Intronic
1136619972 16:31422084-31422106 ATACAAACATTAGCTGCAAGTGG - Intronic
1137424181 16:48363680-48363702 GGAGAACCCTAGGCTGCAAGGGG - Intronic
1137942159 16:52698960-52698982 ATGCCATCCTAGGCTGGATGCGG + Intergenic
1141416399 16:83878778-83878800 ATACAATCTTTGTCTGTAAGGGG - Intergenic
1146686774 17:34846388-34846410 TTACAGACCCAGGCTGCAAGAGG + Intergenic
1152347825 17:79764458-79764480 AAACAATCCAAGGCTGGATGCGG - Intergenic
1155453844 18:25990097-25990119 ATACAATGCTTGGCAGCAAGTGG + Intergenic
1157276189 18:46312536-46312558 ACTCAATCCTAGGGTGAAAGAGG + Intergenic
1159438627 18:68449275-68449297 AAACAAAGCTAGGCTGCATGGGG - Intergenic
1160158848 18:76455582-76455604 ACACAAGCCTGGGCTGCCAGGGG - Intronic
1161571121 19:5031368-5031390 CTACATTTCTAGGCTGCACGTGG + Intronic
1165332070 19:35145509-35145531 AGGCAGTCCTAGGCTGCAGGAGG - Intronic
926597375 2:14805974-14805996 ACATAATCCTTGCCTGCAAGGGG - Intergenic
928560654 2:32481430-32481452 TTAAAAACCTTGGCTGCAAGAGG - Exonic
930158120 2:48126304-48126326 GTAGAATCCTAGGCAGAAAGGGG + Intergenic
930395707 2:50821209-50821231 AAACCATCCTGGGCTGCATGGGG - Intronic
931603927 2:64032663-64032685 CTTCAATCTAAGGCTGCAAGTGG + Intergenic
931793674 2:65689329-65689351 AGACAATCTCAGGCTGCCAGAGG + Intergenic
932454959 2:71843644-71843666 ATACAATTCCAGCCTGCAGGAGG - Intergenic
933444364 2:82359667-82359689 ATACATTGCAAGACTGCAAGTGG - Intergenic
933638239 2:84730626-84730648 AAACCGTCCTAGGCTGCATGTGG + Intronic
933992143 2:87641309-87641331 ATACCATCCTATGCTTCCAGGGG + Intergenic
935893993 2:107714017-107714039 ATAAAAGCATAGGCTGCAAAAGG + Intergenic
936301701 2:111309509-111309531 ATACCATCCTATGCTTCCAGGGG - Intergenic
936586832 2:113765260-113765282 ATATAAGCATAGGCTGTAAGAGG + Intergenic
938380973 2:130836638-130836660 AAACACTCCTAGGCTTCAAGGGG + Intergenic
938491918 2:131765537-131765559 GTAGGATCCCAGGCTGCAAGTGG + Intronic
938948199 2:136233715-136233737 CTTCACTCCTAGGCTGCAAGAGG + Intergenic
939253398 2:139712579-139712601 ATGTAATCATAGGCTGCATGGGG - Intergenic
941379015 2:164768345-164768367 AAACCATCCTGGGCTGCATGTGG - Intronic
943097433 2:183447315-183447337 TTACCAGCCTAGGCTCCAAGAGG + Intergenic
945347125 2:208731818-208731840 ATACAAAGCTATGCTGCAAGTGG + Intronic
947644257 2:231726612-231726634 ATCCTACTCTAGGCTGCAAGGGG + Intergenic
948731553 2:239967007-239967029 ACACAGCCCTAGGCTGGAAGAGG - Intronic
1171544716 20:25991207-25991229 GTACAGTCCGAGGCGGCAAGTGG - Intergenic
1171951081 20:31423105-31423127 ATAGAATCATAAGCTCCAAGAGG + Intergenic
1175039185 20:56029716-56029738 CTTCAAGCTTAGGCTGCAAGAGG - Intergenic
1179131338 21:38639892-38639914 ACAGAATCCTAGGGTGCCAGAGG + Intronic
1180018942 21:45107678-45107700 ATGCAAAAATAGGCTGCAAGTGG + Intronic
1180293275 22:10862363-10862385 GTAGGATCCCAGGCTGCAAGTGG + Intergenic
1180456794 22:15516765-15516787 GTAGGATCCCAGGCTGCAAGTGG + Intergenic
1180496079 22:15891785-15891807 GTAGGATCCCAGGCTGCAAGTGG + Intergenic
1180895569 22:19329558-19329580 ATAAAAAGCCAGGCTGCAAGTGG - Intergenic
1181395668 22:22619460-22619482 AAGCCATCCTAGGCTGCATGTGG + Intergenic
1182888953 22:33800143-33800165 ATATAATCCTTGCCTGCAAGGGG - Intronic
1184622505 22:45692398-45692420 ATACAATCCTAGAAGGGAAGAGG - Intronic
949825954 3:8166137-8166159 TTACAAGCCTAGGCCTCAAGGGG + Intergenic
950813218 3:15670731-15670753 ATAGAAACCTAGGGTGGAAGGGG + Intronic
953278912 3:41532983-41533005 TTCCAAGCCTAGGCAGCAAGAGG + Intronic
954424543 3:50436438-50436460 TTACCATGCCAGGCTGCAAGGGG - Intronic
957545954 3:81636977-81636999 ATACAGTCCAAGACTGCCAGTGG + Intronic
957568429 3:81914702-81914724 AAACAATAGTAGTCTGCAAGGGG + Intergenic
960379794 3:116945952-116945974 ATACAATCCTTGGCTGGGTGTGG + Intronic
961263393 3:125620550-125620572 AAACCATCCTAGGCTGCATGTGG - Intergenic
961971530 3:130973433-130973455 ATACATTCCAAGACTGCTAGTGG + Intronic
962819254 3:139032097-139032119 AAGCCATCCTAGGCTGCATGCGG - Intronic
966560433 3:181313893-181313915 ATACAAATCTATGCTGAAAGTGG - Intergenic
969432924 4:7166517-7166539 ATTCCATCTCAGGCTGCAAGGGG - Intergenic
972629399 4:40830089-40830111 ATACATTTCTAGGCTGCGGGAGG + Intronic
975265864 4:72366382-72366404 ATATAATCCCAGGTTGCCAGAGG + Intronic
978941193 4:114437767-114437789 AAACCATCCTGGGCTGCATGTGG - Intergenic
982189109 4:152835281-152835303 ATCCAATCTTAGGCTGTTAGAGG + Intronic
987127709 5:14830422-14830444 ACACAGTCCTAGGCTGCAGTGGG + Intronic
987274821 5:16351441-16351463 AGAAAGTCCTAGGCTTCAAGAGG + Intergenic
988964207 5:36400375-36400397 ACACAATTCTTGGCTGCATGAGG - Intergenic
989780458 5:45258156-45258178 ATAAAAACCTAAGCTGAAAGAGG + Intergenic
994200079 5:96963598-96963620 GTCCAATCCTAGGCTTTAAGAGG - Intronic
1001141868 5:169151262-169151284 ATACACTCCCAGGCGGCAATGGG - Intronic
1004180756 6:13378778-13378800 ATGCGTTCCTAGGCTGCAGGAGG - Intronic
1005409253 6:25525352-25525374 ATAGAATTCTAGGCTGCTGGGGG - Intronic
1006867842 6:37223477-37223499 ATAGAATCCTAGGTTGGCAGGGG - Intronic
1014227174 6:118861862-118861884 ATTCATTCCTAGGCAGGAAGGGG - Intronic
1015531276 6:134223431-134223453 ATCCACTCCTAGGCTGTATGGGG + Intronic
1016913326 6:149220947-149220969 ATACAATTCAAGGTTTCAAGTGG - Intronic
1019913686 7:4116965-4116987 CCACAATCCCAGGCTGCATGTGG - Intronic
1021702946 7:23337956-23337978 AGACAATCCAAGGCTGGAAGTGG - Intronic
1025029262 7:55543203-55543225 ATAAAATCCTAGGCTGGGTGCGG - Intronic
1025523997 7:61781574-61781596 ATTCAGTCCTAGGCTGAAAAAGG - Intergenic
1025547356 7:62193778-62193800 ATTCAGTCCTAGGCTGAAAAAGG - Intergenic
1025712585 7:63926442-63926464 CTACAATCCCAGCATGCAAGGGG + Intergenic
1026329184 7:69337169-69337191 AAACAAACCCAGGCAGCAAGCGG + Intergenic
1027912820 7:84274464-84274486 ACACATTCCCAGGCTGAAAGGGG + Intronic
1028478467 7:91277380-91277402 ATACATTCCAAGGCTCCCAGTGG - Intergenic
1034283971 7:149872682-149872704 ATACCATCCTAGCCTTCGAGGGG - Intergenic
1034982144 7:155485938-155485960 AAACAATTCTGGGCTCCAAGGGG + Intronic
1038285452 8:26202610-26202632 AAGCTGTCCTAGGCTGCAAGAGG - Intergenic
1039172852 8:34768085-34768107 ATACAATTCTGGGCTTTAAGTGG + Intergenic
1041830543 8:62148076-62148098 ATACACTACCAGGGTGCAAGAGG + Intergenic
1044224119 8:89700710-89700732 ATCCAAGGCTATGCTGCAAGTGG + Intergenic
1045229266 8:100285845-100285867 ATAGAACCCCAGGGTGCAAGAGG - Intronic
1046368890 8:113273636-113273658 ATACACTCCAAGGCTTCCAGTGG - Intronic
1046779664 8:118201682-118201704 ATTCAATCCTGGTCTGCATGTGG + Intronic
1048122539 8:131597990-131598012 ATATAATCTTAGGAGGCAAGAGG - Intergenic
1048996270 8:139795446-139795468 ACACAAACACAGGCTGCAAGTGG - Intronic
1051137841 9:13943233-13943255 ATACATTCTAAGGCTCCAAGTGG - Intergenic
1051401615 9:16689787-16689809 ATACAATGCCAAGCGGCAAGAGG + Intronic
1052035062 9:23671131-23671153 AAGCCATCCTGGGCTGCAAGCGG + Intergenic
1055131358 9:72778779-72778801 ATCCAAGCCTGTGCTGCAAGTGG - Intronic
1055271188 9:74560865-74560887 ATACATTCCCAGGCTGTAACTGG - Intronic
1203384016 Un_KI270438v1:1567-1589 TTTCCATCATAGGCTGCAAGGGG - Intergenic
1203404027 Un_KI270511v1:4728-4750 TTTCAATCATAGGCTGCAAAGGG + Intergenic
1186149085 X:6655298-6655320 ATGCCATCCCAGGCAGCAAGAGG - Intergenic
1188290174 X:28377978-28378000 TTACAATCCTATGCTGCCAATGG + Intergenic
1188552295 X:31377471-31377493 ATAAAATCTTAGGTTGAAAGGGG - Intronic
1191905614 X:66085651-66085673 CTACAATCTTAAGTTGCAAGAGG + Intergenic
1195144489 X:101999766-101999788 ATCCAAGGCTATGCTGCAAGTGG - Intergenic
1198475436 X:136992497-136992519 TTCAAATCCTAGGCTGAAAGGGG - Intergenic
1202184574 Y:22172317-22172339 ATACAATGCTAGGTTGGAACGGG + Intronic
1202206786 Y:22414084-22414106 ATACAATGCTAGGTTGGAACGGG - Intronic