ID: 916058015

View in Genome Browser
Species Human (GRCh38)
Location 1:161081295-161081317
Sequence TGGTGAGGGGCAGTCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916058009_916058015 -2 Left 916058009 1:161081274-161081296 CCAGGGAGTGCCATGAGCAAGTG 0: 1
1: 0
2: 1
3: 14
4: 209
Right 916058015 1:161081295-161081317 TGGTGAGGGGCAGTCACTGAAGG 0: 1
1: 0
2: 0
3: 26
4: 270
916058008_916058015 4 Left 916058008 1:161081268-161081290 CCTTAGCCAGGGAGTGCCATGAG 0: 1
1: 0
2: 0
3: 50
4: 434
Right 916058015 1:161081295-161081317 TGGTGAGGGGCAGTCACTGAAGG 0: 1
1: 0
2: 0
3: 26
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916058015 Original CRISPR TGGTGAGGGGCAGTCACTGA AGG Intronic
900192024 1:1355937-1355959 AGGGGAGGGGGAGTCACTGGGGG + Intronic
900380074 1:2379537-2379559 TGGTGAGGGGCAGGTGCTCACGG + Intronic
900702826 1:4058747-4058769 GGGTGAGGGGCTGTCAGTGTTGG - Intergenic
901663962 1:10815997-10816019 GGGTGTGGGGCAGAGACTGAAGG + Intergenic
902368002 1:15989969-15989991 TGGTGAGAGGCACTCCCTGCAGG + Intergenic
904082954 1:27883494-27883516 TGATGATGGGCAGCCACAGAAGG - Intronic
904832893 1:33316638-33316660 TGGTGAGGGGCTGTCAGGGAGGG + Intronic
905891549 1:41521495-41521517 TGGAGAGGGGAAGTCACAGAGGG - Intronic
906242073 1:44248265-44248287 TGGTGAGGGGCACCCATTGAGGG - Intronic
906937622 1:50227858-50227880 TGGTGAGGTCCTGTCAATGATGG - Intergenic
907061960 1:51436247-51436269 TGGAGATGGGAAGTCACTGAGGG + Intronic
908123022 1:61003744-61003766 TGGTGAAGGGAAGCCACGGAAGG - Intronic
908144913 1:61230666-61230688 TGGTGAGAGGGAGTCAATGAAGG - Intronic
908491194 1:64645838-64645860 TGGTCAGAGACAGACACTGAGGG - Intronic
908644533 1:66263236-66263258 AGGTGAGGGCCACTCACAGAGGG + Intronic
909712364 1:78666449-78666471 TGGTGATGGTCAGTCAATAAAGG + Intergenic
912474296 1:109925758-109925780 TGGAGAGGGGCAGTCCCTTTGGG - Intronic
914435058 1:147652428-147652450 AGGTGAGGGGCTCTCACTGCTGG - Exonic
914672195 1:149879382-149879404 TGGAGAAGGGCAGCCTCTGAGGG + Intronic
915597924 1:156905913-156905935 TCGTGATGGGCAGTGGCTGAGGG - Intronic
915956250 1:160222720-160222742 TGGTGAGCGGTAGTGACTGTGGG - Exonic
916058015 1:161081295-161081317 TGGTGAGGGGCAGTCACTGAAGG + Intronic
916961739 1:169895870-169895892 TGGGGAGGGGCAGTAAGTCAGGG - Intergenic
917264888 1:173210408-173210430 TGGGGAGGGGCAGTGCCTGTTGG + Intergenic
919981455 1:202644728-202644750 TTGGGGGGGGCAGTCACTCAGGG + Intronic
920310719 1:205046786-205046808 TGGTGTGAGGCAGTGAGTGAGGG - Intronic
920349802 1:205330173-205330195 TGGAGGGGGGCAGTGGCTGAGGG + Intergenic
920546638 1:206823760-206823782 AGGTGAGGAGCCATCACTGAAGG + Intronic
922785192 1:228279148-228279170 TGGGGAGGAGCAGTCGCTGGCGG - Intronic
922905089 1:229168298-229168320 CTGTGTGGAGCAGTCACTGAAGG - Intergenic
1062957187 10:1548090-1548112 TATTGAGGGTCAGTCACTTAGGG - Intronic
1063057073 10:2517252-2517274 TGGTGCTTGGCAGTGACTGAGGG - Intergenic
1063980683 10:11449287-11449309 ATGTGGGGGGCAGCCACTGAAGG + Intergenic
1069582955 10:69577721-69577743 TGGGGAGGGGGAGTCTCTGAGGG - Intergenic
1070380745 10:75878444-75878466 CAGTCAGGGGCAGTCAGTGACGG - Intronic
1072321312 10:94252793-94252815 AGCTGAGGGGCAGGCACAGAGGG + Intronic
1074264871 10:111891620-111891642 TGGTCAGAGGCAATCACTGTGGG - Intergenic
1074536581 10:114332331-114332353 TGGTGAGGGGCAGGAAGTGAAGG + Intronic
1074623812 10:115155710-115155732 TTATGATGGGAAGTCACTGAAGG + Intronic
1075048953 10:119167504-119167526 TGGTGCGGGGTAGGCACTCAAGG + Intergenic
1076019963 10:127064687-127064709 GGCTGAGGGCCATTCACTGAGGG - Intronic
1076292738 10:129360271-129360293 TGGAGAGTGGCAGGCTCTGAGGG + Intergenic
1078479794 11:11665655-11665677 TGGAAAGGGGCAGTAACTTATGG - Intergenic
1081547685 11:44083364-44083386 AGGTGAGGGGCAGTTGGTGAGGG + Intronic
1082806014 11:57451066-57451088 TGGGGAAGGGCAGAGACTGAGGG + Intergenic
1083031238 11:59594522-59594544 TTCTGTGGGCCAGTCACTGATGG - Intronic
1084083714 11:66845097-66845119 AGGTGAGGGGCAGTCCTAGAAGG + Intronic
1084383031 11:68825680-68825702 AGGTGGGGGGCAGGCACTGGAGG - Intronic
1084751791 11:71208983-71209005 TGGTGAGGAACAGTGGCTGACGG - Intronic
1085476934 11:76794835-76794857 TGCGGTGGGGCAGTCACTGCAGG + Intronic
1088853509 11:113725141-113725163 TAGTGAGAGGCAGGCCCTGAGGG - Intergenic
1088912228 11:114200244-114200266 TGGTGAGGGACAGAAACTGCAGG - Intronic
1089192373 11:116662196-116662218 TGGTGAGGGGCAGAGACTTTGGG + Intergenic
1089264582 11:117250162-117250184 TGGGTAGGGGGAGTCACAGAGGG + Intronic
1089340915 11:117756819-117756841 TGGTGTGGGGCACTCACTTTGGG + Intronic
1089760954 11:120722843-120722865 TGGTGAAGGGCAGTCTGTGCTGG + Intronic
1091803452 12:3339724-3339746 GGGTGGGGGGCAGAGACTGATGG + Intergenic
1091803473 12:3339808-3339830 GGGTGGGGGGCAGAGACTGATGG + Intergenic
1092743563 12:11652683-11652705 TGGTGAGATGCAGCCACAGAGGG + Intronic
1097146404 12:56942365-56942387 AAGTGAGGGTCAGTCACTGAGGG + Intergenic
1097651437 12:62302791-62302813 TGGTGATGCCCAGTCACTTAAGG + Exonic
1098078276 12:66756858-66756880 TGGTTAGTGGCAGTCTCTGAAGG - Intronic
1100883636 12:99045446-99045468 TGGTTAGAGGGAGTCACTAAAGG - Intronic
1103321238 12:120093834-120093856 TGCTAAGGGGCAGAGACTGAAGG - Exonic
1104632020 12:130411335-130411357 TGGTGAGGGGAAGTCACACCTGG - Intronic
1104727620 12:131087696-131087718 TGGGAAGGGGCAGTCGCTGGCGG - Intronic
1104973716 12:132542727-132542749 TGGTCGGGGCCAGACACTGAGGG + Intronic
1104979953 12:132569317-132569339 GGGTGACGGGCAGTCACAGTAGG + Intronic
1113487176 13:110662759-110662781 TTGTGAGGAGCAGTCCCTGTTGG + Intronic
1113756826 13:112818194-112818216 TGGTGACGGGCAGTGACTGTTGG + Intronic
1117288698 14:54311613-54311635 TGGTGGGGGATAGTGACTGAAGG - Intergenic
1119186114 14:72643689-72643711 TGGTGATGGGCGGTCACTTGGGG - Intronic
1119544806 14:75463901-75463923 TGGTCATGGAGAGTCACTGAAGG + Intronic
1119567428 14:75640678-75640700 TGCTGACTGGCTGTCACTGATGG + Intronic
1121049971 14:90814047-90814069 TGGTGAGTGGTAGCCATTGATGG - Intronic
1121175473 14:91887673-91887695 GGGTGAGGGGTGTTCACTGATGG - Intronic
1121729105 14:96173955-96173977 TGCTGAGGGGCAGTCACCTCAGG + Intergenic
1121835572 14:97089014-97089036 GGGTGAGGTGGAGCCACTGAAGG + Intergenic
1123018941 14:105388610-105388632 TGGTGCCGGGCTGTCCCTGAGGG + Intronic
1124497144 15:30193467-30193489 GGGGGAGGGGCAGTCATTCAGGG + Intergenic
1124695269 15:31858865-31858887 AGGTGAGGGGCAGTCACATGGGG + Intronic
1124746430 15:32345180-32345202 GGGGGAGGGGCAGTCATTCAGGG - Intergenic
1124864048 15:33471878-33471900 TGGTCAGGGGCAGGTAATGAGGG - Intronic
1125003713 15:34795790-34795812 TGGGGAGGGGCAGGCGCTGAAGG + Exonic
1128568874 15:68718941-68718963 GGGTGAGGGGCATTCTCAGATGG + Intronic
1129269148 15:74410411-74410433 TGGTGAGGGGCTGAGAATGAGGG - Exonic
1130274722 15:82470354-82470376 TGGTGAGGGGCAGTGCTTGGTGG + Intergenic
1130467067 15:84197728-84197750 TGGTGAGGGGCAGTGCTTGGTGG + Intergenic
1130486536 15:84401449-84401471 TGGTGAGGGGCAGTGCTTGGTGG - Intergenic
1130497197 15:84475808-84475830 TGGTGAGGGGCAGTGCTTGGTGG - Intergenic
1130589366 15:85202321-85202343 TGGTGAGGGGCAGTGCTTGGTGG + Intergenic
1131685973 15:94767925-94767947 TGGGGAGGCACAGTCCCTGAAGG + Intergenic
1132133460 15:99307875-99307897 ATGTGAGGGGAAGTCACTGGTGG + Intronic
1132837989 16:1964350-1964372 TGGTGACGGGCATCCACTAAAGG + Exonic
1133829577 16:9309302-9309324 CAGTGAGGGGCAGGCAATGAGGG + Intergenic
1134254301 16:12599017-12599039 TGGTGATGGACAGACGCTGATGG - Intergenic
1134416533 16:14048228-14048250 TGGTCTTGGGCAGGCACTGATGG + Intergenic
1134995487 16:18735359-18735381 TGGTAAGGGGCAGTAACTCCTGG - Intergenic
1137578947 16:49621780-49621802 TGGTGAGAGGCAGACACTGCAGG - Intronic
1138278882 16:55757603-55757625 TGGTGAGGGGCATTCTGTGATGG - Intergenic
1138289651 16:55835985-55836007 TGGTGAGGGGCATTCTGTGATGG + Intergenic
1138818808 16:60233886-60233908 TGGGGAGGGGCAGTGAGTCAAGG + Intergenic
1140192737 16:72832091-72832113 TGGTGATGTGCAGTGTCTGAAGG + Intronic
1140250467 16:73290225-73290247 TGGTTAGGGGCTGTCAGTTAGGG - Intergenic
1140780499 16:78292197-78292219 TGGTGAGAGACAGAAACTGAAGG - Intronic
1141432221 16:83976162-83976184 GGGTGAGGGGCAGTCACCATGGG - Intronic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1143367468 17:6417549-6417571 TGGTGAGGAGCTGTTACTGGGGG + Intronic
1144355390 17:14440974-14440996 TCCTGAAGGGCAGTCATTGAAGG - Intergenic
1144495147 17:15741220-15741242 TGGTGAGAGGCACTCCCTGTGGG + Exonic
1146436458 17:32853353-32853375 TGGTGATGGGGAGCCATTGAAGG - Intronic
1147219605 17:38920569-38920591 AGGTGAGGGGCAGGACCTGAAGG + Exonic
1148153374 17:45409527-45409549 TAGTGAGGGGCCCTCACTGGAGG + Intronic
1148238761 17:45986288-45986310 TAGTGAGGGGCAGGCCCTGGGGG + Intronic
1148837753 17:50474875-50474897 TGGAGAAGGGAAGACACTGAGGG + Intergenic
1149436721 17:56639597-56639619 TGGGGAGCAGCAGCCACTGAGGG + Intergenic
1149574655 17:57702963-57702985 GGGTGAGGGGCAGTCAAGGATGG - Intergenic
1149582470 17:57760767-57760789 TGTGGATGGGCATTCACTGAGGG + Intergenic
1150986900 17:70208421-70208443 TGGTGATGAGCAGACGCTGAAGG - Intergenic
1151358417 17:73573767-73573789 GTGTGAGTGGCAGTCACTGGAGG - Intronic
1151840884 17:76616626-76616648 TGTTGAGGGGCAGTCCCTTGGGG + Intergenic
1152014156 17:77738799-77738821 TGGTGTGGGGCAGGCAGGGAAGG + Intergenic
1152037421 17:77881732-77881754 TGCTGAGCGGAAGTCTCTGAGGG - Intergenic
1152803046 17:82340448-82340470 TGCTGAGAGGCTGTCAGTGATGG + Intergenic
1152810265 17:82378537-82378559 TGCTGTGAGGCAGTCACTGCCGG - Intergenic
1156511905 18:37644041-37644063 TGCTGAGGAGCACTCACTGATGG + Intergenic
1156890411 18:42184322-42184344 TGGGGAGGGGAAGTCACTCCCGG + Intergenic
1157524704 18:48372059-48372081 GGGTGAGGGGAGGTCAGTGAAGG - Intronic
1158361956 18:56684545-56684567 AGATGATGGGCAGTCTCTGAAGG + Intronic
1160767372 19:814413-814435 TGGTGAGTGGCAGGTTCTGATGG - Exonic
1160846598 19:1168786-1168808 TGGGGAGGGGCAGCCAGGGAGGG - Intronic
1161000393 19:1907815-1907837 TGTTGGGGGGCAGTCGCTGTGGG + Intronic
1162405003 19:10468156-10468178 GGGTGGGGGGCAGTCACTGTGGG + Exonic
1163747892 19:19058955-19058977 TGGGGTGGGGTGGTCACTGAGGG - Intronic
1163825788 19:19524147-19524169 TGGTGAGGGGCACGCACAAAAGG - Intronic
1165399216 19:35586939-35586961 TGGAGACCTGCAGTCACTGAGGG - Intergenic
1166299255 19:41904887-41904909 TAGGGAGGGGCAGGCACTGGGGG + Intronic
1166337181 19:42115436-42115458 TTTTGTGGAGCAGTCACTGAGGG + Intronic
1167309248 19:48727456-48727478 AGGTGAGGGGGATCCACTGAGGG + Intronic
1167515815 19:49922595-49922617 TGGGGAGGGGAAGTCACAGAGGG + Intronic
1167721051 19:51180735-51180757 GGGTGATGGGAAGCCACTGAAGG - Intergenic
1168415345 19:56164284-56164306 AGGGGAGGGGCAGTCACCCAGGG - Intergenic
925076148 2:1017949-1017971 TGGCGTGGGGCACTCTCTGAAGG - Intronic
926843515 2:17108013-17108035 TGGTGACAGGCAGTCAAGGAAGG + Intergenic
927261489 2:21095864-21095886 TTTTGTGGGGCAATCACTGAAGG + Intergenic
927515335 2:23668834-23668856 AGGTGAGGGGAAGGGACTGAGGG - Intronic
927735202 2:25514455-25514477 GTGTAAGGGGAAGTCACTGAAGG + Intronic
929556897 2:42931259-42931281 TGGTGGGTGGAAGTCACTGCGGG + Intergenic
931015159 2:57969076-57969098 TGTTTGGGGGCAGTCACAGATGG + Intronic
931026455 2:58117332-58117354 TGGGGAGGGCTAGTCACAGAAGG + Intronic
933856674 2:86420833-86420855 AGGTAAGGGGCAACCACTGAAGG - Intergenic
935235317 2:101133554-101133576 TGGTGAGGGGGGTTCACAGATGG + Intronic
937752576 2:125494725-125494747 TGTTGTGGGCCTGTCACTGAGGG + Intergenic
937879860 2:126857156-126857178 TGGGGAGGGGCAGTGGCTGTGGG - Intergenic
938832536 2:135067252-135067274 GGTTGAGGATCAGTCACTGATGG + Intronic
940107280 2:150114365-150114387 TGGGGAGGGCTAGTCACGGAAGG - Intergenic
945983675 2:216337857-216337879 TGTTGAGTGGCAGGCACTCAAGG + Intronic
947855194 2:233319214-233319236 TGGCGAGGGGCAGTTACCGTTGG + Intronic
948197861 2:236108422-236108444 GGGTGAGGAGCAGACACTGGAGG - Intronic
948762050 2:240198395-240198417 TGGTGATGGGCAGTGATGGACGG - Intergenic
948862963 2:240761819-240761841 TGGTGTGTGGCTGTCATTGACGG - Intronic
1169014938 20:2283915-2283937 TGGTTCGTGGCAGGCACTGAAGG + Intergenic
1169917284 20:10696376-10696398 GGGTGAGGGGAAGGAACTGAAGG - Intergenic
1170753683 20:19176692-19176714 TGGAAAGGGGCAGTCACTTCTGG - Intergenic
1171247549 20:23624521-23624543 TGGGAAGGGTGAGTCACTGAAGG + Intergenic
1171471638 20:25376984-25377006 TGGTGAAGGGCGGCCTCTGAGGG - Intronic
1172515190 20:35528394-35528416 GGGTGAGGGGAGGTCACTGCAGG - Intronic
1175190771 20:57211012-57211034 TGGTGGGGGGCTGTGTCTGAAGG - Intronic
1175803998 20:61817256-61817278 CGGTGAGGGGCACTCACTCGGGG - Intronic
1177469827 21:21546479-21546501 TGGTGGGGGGCAGTGGGTGATGG - Intergenic
1178155096 21:29843761-29843783 TGGGGAGGGGGACTAACTGAGGG + Intronic
1179407006 21:41134753-41134775 TGGGGAGTGGCAGGCACGGATGG - Intergenic
1179982439 21:44903344-44903366 TGGTGAGGCCCAGGCACTGCAGG - Exonic
1180248827 21:46566053-46566075 CAGTGAGGGGCAGTCATGGAGGG - Intronic
1180597676 22:16989419-16989441 TGGAGAGGAGCAGACACTCAGGG - Intronic
1180951075 22:19720907-19720929 TGGTGAGGGGCAGAACCAGAGGG + Intronic
1181902547 22:26168625-26168647 TAGTGAGGGACAATCAATGAGGG - Intergenic
1182543462 22:31058437-31058459 TGCTGAGGGGCAGGCCCTGGAGG - Intergenic
1182638045 22:31744655-31744677 TGGTGAGGGGAAGTCAGATATGG - Intronic
1183370650 22:37430092-37430114 TGGTCTGGGGCAGTGACTGTGGG - Intergenic
1183716310 22:39535459-39535481 TGGGCAGGGGCAGCCACTGTTGG + Intergenic
950221286 3:11198254-11198276 TGGGGAAGGGCAGACACTCAGGG - Intronic
951602301 3:24389844-24389866 TGTTCAGTGGCAGTCACTAAAGG + Intronic
953518279 3:43618195-43618217 TGGTGAGGACCACTCCCTGAGGG + Intronic
953774116 3:45800992-45801014 TGGTGACTGGGAGCCACTGAGGG - Intergenic
954294734 3:49667962-49667984 TGGAGAGGGGCTTTGACTGAGGG + Exonic
954433989 3:50486267-50486289 TGGTGTGGGGCAGGAACAGAAGG - Intronic
957229504 3:77493711-77493733 TGGGAACGGGCAGTCATTGATGG - Intronic
957572624 3:81967613-81967635 TGGTGAGTACCAGTCACTGCTGG - Intergenic
960220265 3:115099567-115099589 AGGTGAGGGGTAGTTGCTGAGGG - Intronic
960974939 3:123164378-123164400 TGGTGATGGGGACTCACTGCTGG - Intronic
962022247 3:131513032-131513054 TGGGGAGGGCTAGTCACAGAAGG + Intergenic
962511744 3:136107930-136107952 TGGCCAGGCGCAGTCACTCATGG + Intronic
962909055 3:139831053-139831075 TTGTGAGGGGGCGTCTCTGAAGG - Intergenic
963500083 3:146114828-146114850 TGGTGAAGGGAAGTCCCTGCAGG + Intronic
963872030 3:150427337-150427359 TTGGGAGGGGAAGTGACTGATGG - Intronic
965782022 3:172296225-172296247 TGGGCACGGGCAGTCACTGGAGG - Intronic
968477959 4:821183-821205 GGGTGAGGGGCATTCACTGCCGG + Intronic
969352248 4:6604485-6604507 TGGGGAAGGGGAGTGACTGAGGG + Intronic
969710509 4:8840572-8840594 GGGCAAGGGGGAGTCACTGAAGG - Intergenic
970471280 4:16381675-16381697 TGGGGAGATGCAGTGACTGAGGG - Intergenic
970836063 4:20409022-20409044 TCGTGAGCTGCAGTCTCTGATGG - Intronic
973858054 4:55033256-55033278 CAGTGAGGACCAGTCACTGAAGG + Intergenic
975237159 4:72012673-72012695 TGTTGATGGGCAGACACTTAAGG - Intergenic
976120202 4:81772233-81772255 TGATGAGGTGCAGACACTGTTGG + Intronic
976374150 4:84325045-84325067 TGGTGGGTGACAGTGACTGATGG + Intergenic
976840911 4:89431495-89431517 TAGTATGGGGGAGTCACTGAAGG - Intergenic
976863346 4:89692703-89692725 TGGTGGGGGGCAGTTAGTGATGG + Intergenic
978542229 4:109830296-109830318 AGGTGACAGGGAGTCACTGAAGG + Intronic
981295787 4:143129588-143129610 TGGTGAAGGGAAGTCCCTGCAGG + Intergenic
984846841 4:184115480-184115502 TGGTGCAGGGCAGTGACTGTGGG + Intronic
985533085 5:445136-445158 TGGTGAGCATCAGTCAATGAGGG - Intronic
985773064 5:1825065-1825087 GGGTGGGGGGCAGTGACAGAGGG + Intergenic
985950391 5:3218188-3218210 TGGTGTGGAGCAGACAGTGACGG - Intergenic
987090454 5:14504799-14504821 TGATGAAGGGCAGTCACTGCTGG + Intronic
989360689 5:40598095-40598117 TGGTGAAGAGCAGTCAGTGAAGG + Intergenic
990144831 5:52747675-52747697 AGGAGAGGGGCAGGCATTGAGGG - Intergenic
990675868 5:58183959-58183981 AGGCAATGGGCAGTCACTGAAGG + Intergenic
992142164 5:73809429-73809451 TGGTTAGGGCCACTAACTGACGG + Intronic
992503320 5:77362856-77362878 TGGCCGGGGGCAGTCACAGAGGG - Intronic
992617669 5:78560578-78560600 TTGTGAGGGGAAGGCTCTGAGGG + Intronic
994682006 5:102899827-102899849 TGGTGAGGGAAAGGCACTGAAGG + Intronic
995539296 5:113169010-113169032 TGGTGATGGGGAGGCACAGAGGG - Intronic
997503142 5:134394444-134394466 TGGTGAGGAGAATTCACTGAAGG - Intergenic
998093482 5:139384130-139384152 AGGTGATGGGCAGTCACACAGGG - Intronic
998995326 5:147865061-147865083 CGGGGAGGGCCAGTCACAGAAGG - Intergenic
999223678 5:150001874-150001896 TGGAGAAGGGCAGTAACTGCAGG - Intronic
999755317 5:154659809-154659831 TGGAGAGGGGCTGACACTGTAGG - Intergenic
1000907141 5:166977285-166977307 TAATGAGGGGCATTTACTGAGGG - Intergenic
1001047463 5:168385881-168385903 GAGTGAGGGGAAGCCACTGAAGG - Intronic
1001764316 5:174233302-174233324 TGCTCAGGGGCAGTCACAGTGGG + Intronic
1003030192 6:2594745-2594767 TGGGGATGGGCAGTTTCTGAGGG - Intergenic
1004084050 6:12426739-12426761 AGGGGAGGGTCAGTCACTGCTGG - Intergenic
1005162700 6:22883173-22883195 TTGTGAGGAGCAGTCAGTAAAGG - Intergenic
1006166798 6:32070106-32070128 GGGTGAGGGGCATTCCCTGCAGG - Intronic
1006907101 6:37539880-37539902 TGCTGTGGGGTAGTCACTTAAGG - Intergenic
1007257322 6:40538195-40538217 TGGGGAGGGGCAGGAAGTGAGGG + Intronic
1007599866 6:43075158-43075180 AGGTGAGGGGCAGTGATGGATGG + Intergenic
1015706439 6:136093268-136093290 TAGTGAGGCCCAGTCACAGAAGG + Intronic
1017754346 6:157517160-157517182 TGAGGAGGGGGAGTCAGTGAAGG - Intronic
1017776715 6:157686440-157686462 TGCTGTGGTGCAGACACTGAGGG + Intergenic
1018130129 6:160722044-160722066 TGGTGAGTGGCTGTCAGTGGGGG - Intronic
1018633908 6:165843807-165843829 AGGGGCAGGGCAGTCACTGAAGG + Intronic
1019804830 7:3116061-3116083 GGGGTAGGGGCAGACACTGAGGG - Intergenic
1021265045 7:18509692-18509714 AGGTGAGGGGAAATCAGTGATGG - Intronic
1021677626 7:23097257-23097279 ATGGGAGGGGCAGTGACTGAGGG + Intergenic
1021811496 7:24406202-24406224 TGGTGAGAGGCACCCACTTAGGG + Intergenic
1023756949 7:43428130-43428152 TGGTGTGGGGTTGGCACTGAAGG - Intronic
1023839044 7:44085701-44085723 TGGTGAGGGGGTGTCCCTGCTGG + Intergenic
1024462236 7:49670588-49670610 TGGGGAGTTGGAGTCACTGAGGG - Intergenic
1026508924 7:71011191-71011213 AGGGGAGTGGCAGCCACTGACGG - Intergenic
1026976055 7:74499137-74499159 TGGTGAGGGGAGGCCACGGAAGG + Intronic
1029650135 7:101885959-101885981 TCATGGGGGCCAGTCACTGAAGG - Intronic
1031914413 7:127549507-127549529 TGGTGATGGACAATCAGTGATGG - Intergenic
1032392188 7:131562548-131562570 TAGTGAAGTGCAGTAACTGAAGG + Intergenic
1032843555 7:135733958-135733980 TGGTGTGGGCCAGTCTCTCAGGG + Exonic
1034422851 7:150998443-150998465 TGGTGGGGGGCACTCACCGAAGG - Exonic
1035034976 7:155888912-155888934 TGGTGAGGGGAACGCACAGATGG + Intergenic
1035735766 8:1886645-1886667 TGTTGAGGAGCTGTCACTCATGG + Intronic
1037748205 8:21662939-21662961 TGGACAGGGGCAGCCCCTGAGGG - Intergenic
1038462096 8:27725858-27725880 TGTTTAGGGGCAGTCACAGGTGG + Intergenic
1038488281 8:27951617-27951639 TGGCCATGGGCAGTCGCTGATGG - Intronic
1039251457 8:35669630-35669652 TGGGGAGGGGCAGGCACAGCTGG - Intronic
1042123866 8:65517100-65517122 TGGTGAGTGGAAGTGACAGATGG + Intergenic
1042852045 8:73226229-73226251 TGGTGATGGGCAGTGACACATGG + Intergenic
1044753025 8:95434314-95434336 AGGTGATGGGTACTCACTGAAGG - Intergenic
1045348628 8:101317421-101317443 TAGTGATAGGCAGCCACTGATGG - Intergenic
1048604779 8:135956325-135956347 TGGTGAGTTGCTGTTACTGATGG + Intergenic
1049972529 9:833903-833925 TGGGGAGGGGCAGCTACAGAAGG - Intergenic
1051680913 9:19607213-19607235 AGGATGGGGGCAGTCACTGAAGG - Intronic
1051748531 9:20318190-20318212 GGGAGAGGGGCAGTCAGAGAGGG - Intergenic
1052040224 9:23729940-23729962 TGGTGAGGGGAAGTTAGTCAAGG - Intronic
1052749210 9:32471996-32472018 TTGTCAGTGCCAGTCACTGAGGG + Intronic
1053143635 9:35697567-35697589 TGGGGAGGGGCAGGCACTTGGGG + Exonic
1053206805 9:36193049-36193071 TGGTGACGGGCAGTTAGGGAAGG + Intronic
1056061093 9:82885543-82885565 TGGGGAGGGCTAGTCACAGAAGG - Intergenic
1056244646 9:84682159-84682181 TGGTGTTGGGCAGTGAATGAAGG - Intronic
1056420873 9:86424991-86425013 AGGTGAGGAGCAGTCACAGAAGG - Intergenic
1057147195 9:92765933-92765955 TGGAGAGGGGCAGTGAGAGACGG - Intergenic
1057256309 9:93550553-93550575 TGGTGAGGGGCAGAAACAAAAGG - Intronic
1058467233 9:105241798-105241820 TGGTGCTGGTCACTCACTGAGGG - Intergenic
1058903211 9:109459861-109459883 AGGTGAGGAGCAGGCACTAAAGG - Intronic
1061560939 9:131402676-131402698 GGGTGTGGGGCAGTCAGGGAAGG + Intronic
1062148439 9:135004450-135004472 TAGAGAGGGGCTGTCCCTGAAGG - Intergenic
1062641482 9:137520923-137520945 TGGGGAGGGGCAGCCTCTGCTGG + Intronic
1062641516 9:137521031-137521053 TGGGGAGGGGCAGCCTCTGCTGG + Intronic
1203440682 Un_GL000219v1:5180-5202 AGGTGAGGGACAATCAGTGAGGG + Intergenic
1203511560 Un_KI270741v1:123563-123585 AGGTGAGGGACAATCAGTGAGGG + Intergenic
1190100411 X:47518410-47518432 GGCTGAGAGGAAGTCACTGAAGG + Intergenic
1192875808 X:75228461-75228483 TGGTGTGGGGAAGTCAAGGAAGG - Intergenic
1195814560 X:108870731-108870753 TGGTGATGAGCAGGAACTGAGGG - Intergenic
1196430869 X:115623781-115623803 TGGTGAGCCACAGTTACTGATGG - Intronic
1196898549 X:120361444-120361466 GTATGAGGGGCAGTGACTGATGG + Intergenic
1199769876 X:150968340-150968362 TGCAGAAGAGCAGTCACTGAAGG - Intergenic
1199864281 X:151828904-151828926 AGGGGAAGGGCAGTCAATGAAGG - Intergenic
1202369069 Y:24185300-24185322 TGGTGAGGGGCAGTGCTTGGTGG - Intergenic
1202501716 Y:25484817-25484839 TGGTGAGGGGCAGTGCTTGGTGG + Intergenic