ID: 916058015

View in Genome Browser
Species Human (GRCh38)
Location 1:161081295-161081317
Sequence TGGTGAGGGGCAGTCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916058008_916058015 4 Left 916058008 1:161081268-161081290 CCTTAGCCAGGGAGTGCCATGAG 0: 1
1: 0
2: 0
3: 50
4: 434
Right 916058015 1:161081295-161081317 TGGTGAGGGGCAGTCACTGAAGG 0: 1
1: 0
2: 0
3: 26
4: 270
916058009_916058015 -2 Left 916058009 1:161081274-161081296 CCAGGGAGTGCCATGAGCAAGTG 0: 1
1: 0
2: 1
3: 14
4: 209
Right 916058015 1:161081295-161081317 TGGTGAGGGGCAGTCACTGAAGG 0: 1
1: 0
2: 0
3: 26
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916058015 Original CRISPR TGGTGAGGGGCAGTCACTGA AGG Intronic