ID: 916059208

View in Genome Browser
Species Human (GRCh38)
Location 1:161087282-161087304
Sequence CTGCTGCAGCAGCAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 913
Summary {0: 1, 1: 1, 2: 11, 3: 106, 4: 794}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916059202_916059208 12 Left 916059202 1:161087247-161087269 CCCCCAGAGCAACCTCAGCTCTG 0: 1
1: 0
2: 3
3: 32
4: 283
Right 916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG 0: 1
1: 1
2: 11
3: 106
4: 794
916059203_916059208 11 Left 916059203 1:161087248-161087270 CCCCAGAGCAACCTCAGCTCTGT 0: 1
1: 0
2: 5
3: 26
4: 264
Right 916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG 0: 1
1: 1
2: 11
3: 106
4: 794
916059207_916059208 0 Left 916059207 1:161087259-161087281 CCTCAGCTCTGTGCAGGTTGTAG 0: 1
1: 1
2: 1
3: 21
4: 197
Right 916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG 0: 1
1: 1
2: 11
3: 106
4: 794
916059200_916059208 19 Left 916059200 1:161087240-161087262 CCTCCAGCCCCCAGAGCAACCTC 0: 1
1: 0
2: 5
3: 67
4: 612
Right 916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG 0: 1
1: 1
2: 11
3: 106
4: 794
916059205_916059208 9 Left 916059205 1:161087250-161087272 CCAGAGCAACCTCAGCTCTGTGC 0: 1
1: 0
2: 2
3: 15
4: 239
Right 916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG 0: 1
1: 1
2: 11
3: 106
4: 794
916059201_916059208 16 Left 916059201 1:161087243-161087265 CCAGCCCCCAGAGCAACCTCAGC 0: 1
1: 1
2: 1
3: 67
4: 539
Right 916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG 0: 1
1: 1
2: 11
3: 106
4: 794
916059204_916059208 10 Left 916059204 1:161087249-161087271 CCCAGAGCAACCTCAGCTCTGTG 0: 1
1: 0
2: 2
3: 22
4: 260
Right 916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG 0: 1
1: 1
2: 11
3: 106
4: 794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916059208 Original CRISPR CTGCTGCAGCAGCAGCAGAG TGG Intronic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900341125 1:2189860-2189882 CTCCAGCGGCAGGAGCAGAGAGG - Intronic
900666769 1:3820812-3820834 CTGCGGCAGCCCCAGCACAGTGG - Intronic
901079279 1:6574725-6574747 CTTCTGCAGCAGCAGCACCATGG - Exonic
901683541 1:10930278-10930300 GGGCGGCAGCAGCAGCAGAAGGG + Intergenic
902242866 1:15100361-15100383 CTGCTGCCCCAGGAGCAGGGTGG + Intronic
902274132 1:15327045-15327067 GTGCTCCAGCTGCAGCAGAGAGG - Exonic
902338552 1:15767781-15767803 CTGCGGCAGGTGCAGCAGCGAGG - Intronic
902779235 1:18693731-18693753 CAGCTGCAGGAGGATCAGAGCGG - Intronic
903057384 1:20645616-20645638 CAGCTGCAGCAGCATCATGGCGG - Exonic
903296484 1:22346589-22346611 CAGCTGCAGCAGCAGAAGCTGGG - Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903759026 1:25684882-25684904 CTGGGCCAGCAGCAGCACAGGGG + Intronic
903794288 1:25916965-25916987 TAGCTGCAACAGCAGCATAGTGG - Intergenic
904312970 1:29641279-29641301 CTATTGGAGCAGCATCAGAGGGG + Intergenic
904334462 1:29787759-29787781 CTGCTGCATCAGTGGTAGAGAGG + Intergenic
904396815 1:30227818-30227840 CTATTGCAGCGGCTGCAGAGTGG - Intergenic
904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG + Intronic
904702156 1:32364101-32364123 ATGCTGTGGCAGCAGCAGAAGGG + Exonic
904961963 1:34340425-34340447 CAGCAGCAACAGCAGCACAGGGG - Intergenic
905339458 1:37268275-37268297 CTGCTGGGGAAGCAGGAGAGAGG - Intergenic
905401279 1:37705464-37705486 GTACTCCAGCAGCAGGAGAGCGG + Exonic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
906003730 1:42449913-42449935 CAGCTGCAGCAGCGGCAGGTAGG - Exonic
906277011 1:44524051-44524073 CTGCTGCTGGGGCACCAGAGTGG - Intronic
906547830 1:46634280-46634302 CTTAGGCAGGAGCAGCAGAGTGG + Exonic
906639742 1:47434514-47434536 CTGCTGCAGCCGCCAAAGAGCGG - Intergenic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
907933704 1:59022998-59023020 CTTCTGCTGCAGCATAAGAGGGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908942833 1:69456020-69456042 CTGTTATAGCAGCAGCAGACAGG + Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
910674101 1:89800008-89800030 TTGCAGCAGCAGCAGCAAAGGGG + Intronic
911357938 1:96844445-96844467 GTGCAGCTGCAGCAACAGAGAGG + Intergenic
912950738 1:114118619-114118641 CTCCTGCTGCTGCTGCAGAGGGG + Intronic
913199931 1:116487697-116487719 GTGCTGTAGCAGCAACAGAATGG - Intergenic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
913609614 1:120497271-120497293 CTGCAACAGCAGCTGGAGAGCGG - Intergenic
914581576 1:149024573-149024595 CTGCAACAGCAGCTGGAGAGCGG + Exonic
914900226 1:151707634-151707656 CTGCTGCTGCATCAGCTGGGGGG + Exonic
915030398 1:152875288-152875310 CTGCTGCAGGAACAGCAAGGAGG + Intergenic
915047682 1:153032383-153032405 CTGCTGCTGCTGAAGCTGAGGGG - Exonic
915243570 1:154541185-154541207 GTGCTGGAGGAGCAGCAGGGTGG + Intronic
915367727 1:155324922-155324944 CAGCTGCAGGAGCAGAAGAAAGG + Exonic
915393155 1:155562436-155562458 CGGCGGCGGCAGCAGCAGAGTGG + Exonic
915409300 1:155688325-155688347 CGGCAGCGGCGGCAGCAGAGTGG + Exonic
915607117 1:156959476-156959498 CTGCTTCTGGAGCAGTAGAGGGG - Intronic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916741187 1:167648651-167648673 CCGCTGGAGCAGCTGCAGATAGG + Intronic
917055617 1:170978338-170978360 CTGCTGTGGCAGTAGCAGAGGGG + Intronic
917585756 1:176425304-176425326 CTACTGTAGCAGTGGCAGAGGGG + Intergenic
917842710 1:178995110-178995132 CTCCTACTGCTGCAGCAGAGGGG + Intergenic
919776483 1:201197427-201197449 CTGCAGCAGCGGCAGCAGCCTGG - Intronic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG + Intronic
919989862 1:202702262-202702284 CTGCTGCAGCTGCAGGAGGCAGG - Intronic
920070938 1:203302720-203302742 CCCATGCAACAGCAGCAGAGGGG + Intergenic
920175250 1:204097124-204097146 CTCCTGTCACAGCAGCAGAGTGG + Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922208234 1:223467465-223467487 CTGTGGCAGCAGCAGTGGAGAGG + Intergenic
922562891 1:226581915-226581937 AAACTGCAGCAGCTGCAGAGAGG - Intronic
923392642 1:233529545-233529567 TTGCTCCAGCAAGAGCAGAGAGG + Intergenic
923461190 1:234211027-234211049 CTGCTCCAGCAGTAGCTGAAAGG + Intronic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924472245 1:244352633-244352655 CTGCTGGATCAACTGCAGAGTGG - Exonic
924650014 1:245917478-245917500 CTGGTGGAGCAGCAGCAATGAGG - Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1064701179 10:18023468-18023490 CTGCTACAGCAGTGGCAGAGGGG + Intronic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1065897569 10:30177747-30177769 CTCATTCAGCAGCAGCAGTGGGG + Intergenic
1066156457 10:32683709-32683731 CTGCAGCAGCAATGGCAGAGGGG + Intronic
1067142192 10:43667389-43667411 CTGCTGGCGCATCAGCACAGTGG - Intergenic
1067421725 10:46158030-46158052 CTGCTGCAGCACCAGCTAGGTGG - Intergenic
1067465025 10:46491374-46491396 CTGATGCAGCTGCAGCACACAGG - Intergenic
1067507031 10:46864119-46864141 CTGCTGCAGCACCAGCTAGGTGG - Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067622163 10:47893227-47893249 CTGATGCAGCTGCAGCACACAGG + Intergenic
1067819963 10:49519888-49519910 CTGAGGCAGCAGGTGCAGAGTGG - Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068130494 10:52889819-52889841 TGGCTGCAGCAGCACCAGGGAGG - Intergenic
1068218298 10:54010922-54010944 CTGCTGTGGCAGTGGCAGAGTGG - Intronic
1068218347 10:54011190-54011212 CTGCAGCAGCAGTGGTAGAGGGG - Intronic
1068335335 10:55627658-55627680 CTGCTGCTGAAGGAGCAGAGGGG - Intronic
1068393228 10:56425926-56425948 CTGCTGCAGCACCAGCTAGGTGG + Intergenic
1068986872 10:63115644-63115666 CTGGTGCACCAGAAGCTGAGTGG + Intergenic
1069121698 10:64576500-64576522 CAGCTGCAGCTGCACCAGGGAGG - Intergenic
1069769782 10:70890942-70890964 CTGCTGCAACCTCAGCAAAGGGG - Intergenic
1070160772 10:73865577-73865599 CAGCAGCAGTGGCAGCAGAGGGG + Intronic
1070817977 10:79337067-79337089 CTACTGCAGCGGCAGAAGGGAGG + Intergenic
1070859203 10:79637172-79637194 CTGCTGCAGCACCAGCTAGGTGG - Intergenic
1071052823 10:81472885-81472907 CTGCAGCAGCAGCGCCAGATGGG - Intergenic
1071079866 10:81798257-81798279 CTGTTGCAGCAGCAGAAAACAGG + Intergenic
1071518510 10:86314830-86314852 CTACTGCAGGAGCATCAGAAAGG + Intronic
1071721123 10:88147186-88147208 ATGAGGCAGCAGCAGCACAGAGG + Intergenic
1072578575 10:96720911-96720933 CTGCTGCCCCAGCAGGAAAGGGG + Intergenic
1072688072 10:97550498-97550520 CAGCTCCTGCAGCAGCAGGGAGG - Intronic
1072804806 10:98417618-98417640 CTGCTGCACCAGCAGGTCAGTGG + Exonic
1073262487 10:102201089-102201111 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1073449789 10:103602591-103602613 GTGCTGGAGAAGCAGGAGAGCGG - Exonic
1073535094 10:104269183-104269205 CGGCGGCAGCAGCAGCAAGGAGG - Exonic
1074906603 10:117869660-117869682 CCTCTGCAGCAGCAGGAGAGTGG - Intergenic
1074919218 10:117990223-117990245 CAGCTGCAGCCTCTGCAGAGTGG + Intergenic
1075520373 10:123140103-123140125 CTGTTGCAGCTGCAGCAGCTAGG - Intergenic
1075534432 10:123258116-123258138 CAGCTGGAGCAGCAGCGGCGAGG - Intergenic
1075651301 10:124129568-124129590 CAGAGGCAGCAGCTGCAGAGTGG - Intergenic
1075725979 10:124611106-124611128 CTCATTCAGGAGCAGCAGAGTGG + Intronic
1076140872 10:128077734-128077756 CAGAAGCAGCAGCAGCAGACAGG + Exonic
1076169599 10:128308304-128308326 CAGCTGCAGCTGGAGCAGCGGGG - Intergenic
1076372957 10:129966865-129966887 GGGCAGGAGCAGCAGCAGAGGGG + Intergenic
1076595136 10:131620476-131620498 CTGCTGCCCCAGCCGCAGACAGG - Intergenic
1076814936 10:132909944-132909966 CAGCTGCTGCAGCAGCAGATTGG - Exonic
1076814937 10:132909949-132909971 CTGCTGCTGCAGCAGCTGCTTGG + Exonic
1077232288 11:1463194-1463216 CTTCTGCTGCGGCGGCAGAGGGG - Intergenic
1077259454 11:1608084-1608106 CAGCTGGAGGAGCAGCAGACGGG + Exonic
1077581282 11:3418826-3418848 CTGCTGCAGCAGGAGGGGGGCGG + Intergenic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1079620064 11:22543135-22543157 AAGCTGCAGCAGCAGAAGTGAGG + Intergenic
1079803173 11:24896431-24896453 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
1079812471 11:25012489-25012511 CTTCAGCAGCACCAGCAGAAGGG - Intronic
1080563544 11:33486831-33486853 CTGCTCCATCATCAGCAGTGGGG - Intergenic
1080943205 11:36942646-36942668 CTGGAGCAGCAACATCAGAGAGG + Intergenic
1081418039 11:42839243-42839265 TTGCTCAAGCAGCAGCAGCGTGG - Intergenic
1081759640 11:45568244-45568266 CTGGTAAAGCAGCTGCAGAGGGG - Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1083171857 11:60927890-60927912 CTGCTGCAGCTGCATCAGCCAGG + Intronic
1083174276 11:60939446-60939468 CTGGTGCAGGAGCAGGGGAGGGG + Intronic
1083490043 11:63009318-63009340 CAGCTGCTGGAGAAGCAGAGAGG - Intronic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084954853 11:72685737-72685759 CAGCTGCAGCAGCTTCAGCGGGG - Intronic
1085139180 11:74124676-74124698 GGGCTGCAGAAGCTGCAGAGAGG - Intronic
1085305661 11:75484337-75484359 CAGCAGCAGCTGCACCAGAGGGG + Intronic
1085635808 11:78158762-78158784 CTGCAGCAGAGGCAACAGAGAGG - Intergenic
1085879524 11:80449382-80449404 CTGTTTCTGCAGCAGCATAGTGG - Intergenic
1085912648 11:80846638-80846660 CTGCTGCAGTAGCAGCTCTGTGG - Intergenic
1086337867 11:85817047-85817069 CTTCTGCAGTAGGTGCAGAGGGG - Intergenic
1087066083 11:94029301-94029323 CTCCTGCAGCAGAGGAAGAGAGG + Intronic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087133852 11:94694660-94694682 CAGCTGGAGCAGCAGCAGCACGG + Intergenic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1088590230 11:111396422-111396444 CTGCTGGAACTGCAGCAGAATGG - Intronic
1088729944 11:112671556-112671578 CTTCTGTAGCAGTAGCAGATAGG - Intergenic
1089609457 11:119661355-119661377 CAGCAGTGGCAGCAGCAGAGGGG + Exonic
1090798403 11:130155064-130155086 CTCCTTTTGCAGCAGCAGAGCGG - Intergenic
1091061103 11:132462957-132462979 TTGCAGCAGCAGGTGCAGAGTGG - Intronic
1091105336 11:132913898-132913920 GAGCTGCAGCAGAGGCAGAGAGG - Intronic
1091109767 11:132955037-132955059 CTGCTGAGGCAGCAGAAGTGAGG + Intronic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091140036 11:133227121-133227143 CAGCTGAGGCAGCAGCACAGAGG - Intronic
1091652612 12:2320976-2320998 CTGCTGCTGCAGCATCCGTGTGG - Intronic
1091708998 12:2724161-2724183 GAGCTGCTGCAGCAGCAGAGTGG + Intergenic
1092197085 12:6555977-6555999 CTCCTGCAGCAGGAGCAGCAGGG - Exonic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1093341210 12:17976209-17976231 CTGTTGCAACATCAGGAGAGCGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1095725191 12:45444812-45444834 CTGCTGCAGCAGCAGGCCAGAGG - Intergenic
1095725193 12:45444823-45444845 CTGCTGCAGCAGCAGCTACCTGG + Intergenic
1095826213 12:46532104-46532126 CTGCTGTAGCAGCTGCACAGAGG + Intergenic
1096031339 12:48418075-48418097 TTGCTAATGCAGCAGCAGAGGGG + Intergenic
1096043812 12:48544351-48544373 CTGCTGCTGCTGCTGCAGACGGG - Intergenic
1096111728 12:49032778-49032800 CAGCAGCAACAGCAGCAGATGGG - Exonic
1096180698 12:49548986-49549008 CAACTGCAGCAGCAGCAGCGAGG + Exonic
1096782015 12:53997059-53997081 CTGCTGCCGCCTCCGCAGAGTGG + Intronic
1097146550 12:56943362-56943384 CTGCTGCAGCCACAGCTGAAAGG + Intergenic
1097712963 12:62935017-62935039 CTGCTGCAGCTGCAGCCGCCTGG - Exonic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1098641131 12:72839418-72839440 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1100665709 12:96750276-96750298 CTGCTGCTGCTGCAGGAGACAGG - Intronic
1100797872 12:98201526-98201548 CTTGTGCAGGAACAGCAGAGAGG - Intergenic
1101007436 12:100414903-100414925 CTGCAGCAGCAGCAGCTCTGGGG - Intronic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1101588580 12:106106931-106106953 CTGCTGTGGCAGCTGCACAGTGG - Intronic
1101824604 12:108210326-108210348 CTGAGGGAGGAGCAGCAGAGAGG - Intronic
1102491202 12:113290550-113290572 CAGCTGCAGCAGCAGTGGTGTGG - Intronic
1102510916 12:113414845-113414867 GTGCAGCAGGAACAGCAGAGAGG - Intronic
1102754585 12:115327078-115327100 CTGCTGCATCAGAAGCCGTGGGG - Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1104196459 12:126543756-126543778 CTGGTGCAGCAACACCAGAGGGG + Intergenic
1104420095 12:128627915-128627937 CTCCTGCAGCAGCAGCTCCGTGG - Intronic
1104642586 12:130476839-130476861 CTTCTGGAACAGCAGCTGAGTGG + Intronic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104864016 12:131942091-131942113 CTGCTCCTGCAGCAGCTGTGTGG - Intronic
1105462733 13:20607242-20607264 CTGCGGCAGCAGCAGGCCAGGGG - Intronic
1105500395 13:20966613-20966635 CTGCTAGGGCAGCAGCAGAGGGG + Intergenic
1105913435 13:24891884-24891906 AGGCTGCAGCAGCACCTGAGTGG - Intronic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106616843 13:31338353-31338375 CTGCTGCAACCTCAGCAAAGAGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107801838 13:44115766-44115788 CAGCTGGAGGAGGAGCAGAGAGG + Intergenic
1107823095 13:44304038-44304060 ATGATGCAGCAGGTGCAGAGGGG - Intergenic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108478479 13:50843561-50843583 CAGCTGCTGCAGCAGGAGTGGGG - Exonic
1108805952 13:54156660-54156682 GTGCTGCAGCTCCAGCAGAGAGG - Intergenic
1109416450 13:62046759-62046781 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1110666363 13:78122163-78122185 CTGCCGCAGCAGAGGCAGATGGG - Intergenic
1111694683 13:91608560-91608582 TGACTGCAGCAGCAGCAGATAGG + Intronic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1111756331 13:92400335-92400357 CTACAGCAACAGCAACAGAGGGG + Intronic
1112644931 13:101319274-101319296 AGGCTGCAGGAGGAGCAGAGAGG - Intronic
1112749849 13:102571164-102571186 CTGCTTCAGCTGGAGCACAGAGG + Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113919358 13:113898309-113898331 GTGCTGCAGCCACAGCTGAGGGG + Intergenic
1114066349 14:19062376-19062398 CCCCTGCAGCAGCAGCGGCGTGG + Intergenic
1114095919 14:19337648-19337670 CCCCTGCAGCAGCAGCGGCGTGG - Intergenic
1114241298 14:20870884-20870906 CAGCTGAAGCAGCAGCTAAGAGG + Intergenic
1114261896 14:21043021-21043043 CAGCAGCAGAAGCAGCAGAAGGG - Exonic
1114519007 14:23321483-23321505 CGGCGGCGGCAGCAGCAGCGGGG + Exonic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1115715966 14:36104159-36104181 TTTCTGCAACAGCAGCAGATGGG - Intergenic
1115942750 14:38627561-38627583 TTGCTGCAGCAGTAGCAGGTTGG - Intergenic
1116075739 14:40108487-40108509 CTGCAGGATAAGCAGCAGAGAGG - Intergenic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116917234 14:50537178-50537200 CTGCTCCAGCTGCAGCTGAAAGG + Intronic
1117501662 14:56358427-56358449 ATACTGCAGAAGCAGCACAGAGG - Intergenic
1118630227 14:67695710-67695732 CGGCTGCAGCGGCACCAGAGCGG + Exonic
1118946908 14:70397505-70397527 CTGCTGCAGCAGCCACACAGAGG - Intronic
1119002081 14:70891439-70891461 TTTCTTCAGCAGCAGCAGACTGG - Intergenic
1119180342 14:72600915-72600937 CTGCTGCAGCTGCGGGAAAGAGG + Intergenic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119442442 14:74637361-74637383 CTGCTCCAGGAGCTGCAGACGGG - Intergenic
1119634664 14:76264194-76264216 TGGCAGCAGGAGCAGCAGAGAGG + Intergenic
1121038360 14:90725334-90725356 CAACAGCAGCAGCAGCAGACAGG - Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121436443 14:93923641-93923663 CTGCTGCAGGGTCAGCACAGTGG + Intronic
1121708220 14:96017164-96017186 ATGCTGGAGGAGGAGCAGAGTGG - Intergenic
1121711050 14:96039452-96039474 CAGCGGCAGCGGCAGCAGCGAGG + Exonic
1122627770 14:103092912-103092934 CTGCAGCACCATCTGCAGAGGGG - Intergenic
1122714295 14:103684670-103684692 CTACTCCAGCAGCTGCAGAGGGG + Intronic
1122738696 14:103858482-103858504 CAGCAGCATCAGCAGCACAGGGG - Intergenic
1122871326 14:104640409-104640431 CGGGGGCAGCTGCAGCAGAGGGG - Intergenic
1122985326 14:105209116-105209138 CTACTGCAGCAGCTGTTGAGTGG - Intergenic
1123579430 15:21703251-21703273 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123616057 15:22145762-22145784 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1124658212 15:31525426-31525448 CTGCTGCAGCTGCAGCTCTGTGG + Intronic
1125241462 15:37582027-37582049 CAGCTGCAGCCGCAGCTGTGTGG - Intergenic
1125828388 15:42694257-42694279 CTGCTCCAGGTGCTGCAGAGTGG + Exonic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126185852 15:45829805-45829827 CAGCTGCAGCTGCACCTGAGAGG + Intergenic
1126347827 15:47715790-47715812 CATCTGCAGTAGCAGCAAAGAGG - Intronic
1126915557 15:53462235-53462257 CTGAGGCAGCAACAGCAGTGGGG - Intergenic
1126963946 15:54030056-54030078 CTGCTGCAGCAGCAGACAATAGG - Intronic
1127294819 15:57599878-57599900 CTGCTTCAGGAGCAGCAAGGGGG - Intronic
1128203953 15:65833988-65834010 CTGCAGCAACAGCACCAGGGTGG - Intronic
1128374181 15:67064269-67064291 CTGCAGCAGCAGCTGCGGATTGG + Intronic
1128581636 15:68814519-68814541 GTGCAGCAGCAGCAGGAAAGAGG + Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1129188531 15:73924748-73924770 CAGCTGCTGCAGCAGAGGAGGGG - Intergenic
1129372488 15:75106245-75106267 CTGCAGCAGCAAGAGCAGAATGG + Intronic
1129387700 15:75204931-75204953 GTGCTGCAGCACCAGCAGGAAGG - Intronic
1129654796 15:77516903-77516925 CTGCTGCAGGACCAGCAGGGTGG + Intergenic
1129919788 15:79310823-79310845 GTGCTGCAGCAGCTGGAGGGTGG + Intergenic
1130040946 15:80404693-80404715 CCGCAGCATCAGCACCAGAGCGG + Intronic
1130224237 15:82045633-82045655 CGGCGGCGGCAGCAGCGGAGGGG - Exonic
1131032725 15:89199958-89199980 CCGAGGCAGCAGCAGCAGAGGGG - Exonic
1131123434 15:89837791-89837813 CTTTTCCTGCAGCAGCAGAGTGG + Intronic
1131509257 15:93040424-93040446 CTAGAGCAGCAGCAGCAAAGGGG - Intronic
1131510434 15:93046876-93046898 CTGCTGGAGCAGCAGCTGGCTGG + Intronic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1132087576 15:98920990-98921012 GCGCGGCAGCAGCAGCAGAGAGG - Intronic
1132433722 15:101780063-101780085 GTGTTCCAGCAGGAGCAGAGAGG - Intergenic
1202988300 15_KI270727v1_random:437496-437518 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132995071 16:2818482-2818504 CTGCTCCTGCAGCAGAAGGGTGG - Intronic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134528514 16:14963585-14963607 CTGCTGCAAGACCACCAGAGGGG + Intergenic
1135892541 16:26370607-26370629 CTCCTGCATCAGCAGGAAAGAGG - Intergenic
1136033867 16:27523812-27523834 TTCCAGCCGCAGCAGCAGAGAGG + Intronic
1136071677 16:27791296-27791318 CTGCTGCAAGACCACCAGAGTGG - Exonic
1136228451 16:28873726-28873748 CTGCTGCAGCTGCACCATTGGGG - Exonic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136622153 16:31436398-31436420 CCGCAGCTGCAGCAGCAGAAGGG + Exonic
1137334452 16:47533877-47533899 CAGCTGCAGCTGCACCAGGGAGG + Intronic
1137584921 16:49658625-49658647 ATATGGCAGCAGCAGCAGAGAGG + Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1138175355 16:54893109-54893131 CTGCTGCTGCAGCTGGAGATGGG - Intergenic
1138179028 16:54930193-54930215 CTGCTGCTGCCGGCGCAGAGGGG + Intergenic
1138280881 16:55771395-55771417 GTGTGGCAGCAGCAGCTGAGTGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139459410 16:67109967-67109989 CTGCAGCAGCCGCGGCAGCGGGG - Exonic
1139877285 16:70156502-70156524 CTCCTGCAGCAGAAGCAGAATGG + Exonic
1139968277 16:70757655-70757677 CTGCTGAAGCAGAAGCAGGGAGG + Intronic
1140200362 16:72889940-72889962 CACCTGCAGCAGCATGAGAGTGG - Exonic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140413981 16:74760167-74760189 CAGCTGCAGCGGCAGCGTAGTGG - Intronic
1140820795 16:78661243-78661265 CTCCAGCAGCAGCAACAGAGAGG + Intronic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141099268 16:81185186-81185208 CAGCTGGAGCAGGAACAGAGCGG - Intergenic
1141111861 16:81276440-81276462 CTGTGGCAGGAACAGCAGAGTGG - Intronic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141190803 16:81823287-81823309 CCGGGGCAGCTGCAGCAGAGAGG + Intronic
1141461584 16:84181274-84181296 CTGCGGGAGCGGCCGCAGAGCGG - Intronic
1141478981 16:84293717-84293739 GTCATGCAACAGCAGCAGAGAGG - Intergenic
1141915499 16:87093896-87093918 CAGCCGCAGCAGCCGCAGGGAGG + Intronic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142226024 16:88877995-88878017 CTGCTGCTGCAGTGGCAGTGAGG - Intronic
1142304826 16:89279345-89279367 CTGCTGCTGCAGCTGCTGGGTGG + Exonic
1142410241 16:89912340-89912362 CTCCTGCAGCTGCAGCACCGTGG - Intronic
1142849384 17:2696897-2696919 CTGCTGCATCAGCTGCAAGGCGG + Exonic
1143187775 17:5020850-5020872 CTGCTGCTCCAGCAGAAGATCGG - Exonic
1144308596 17:13992067-13992089 CTGCAGTAGGAACAGCAGAGGGG + Intergenic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1145192097 17:20851890-20851912 CTGCTGCGGAAGGAGCAGAGGGG - Intronic
1145402318 17:22551923-22551945 CTGCTGCGGAAGGAGCAGAGGGG - Intergenic
1145782030 17:27569734-27569756 GTGGTGCCACAGCAGCAGAGTGG + Intronic
1146260371 17:31416668-31416690 CCCCTGCAGCAGCAGGAGAAGGG + Intronic
1146588868 17:34110438-34110460 CTGAGGCAGCGGCAGCAGAGAGG - Intronic
1146751947 17:35389754-35389776 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1146948660 17:36890965-36890987 CTGGTGCAGGAGCTGCAGAGAGG + Intergenic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147375794 17:40021872-40021894 CAGCTGGGGCAGCGGCAGAGTGG + Intronic
1147719799 17:42532093-42532115 CGGCCGCAGCAGCAGCAAAACGG + Intergenic
1147871585 17:43591471-43591493 CTGGTGCCCCAGCACCAGAGAGG + Intergenic
1148205172 17:45775432-45775454 CAGCTGCAGGAGGAGCACAGAGG - Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1148910647 17:50940601-50940623 CTGCTGGAGGAGCGGCAGGGAGG - Intergenic
1149455736 17:56786586-56786608 TTGCTGGAGCAGTAGCTGAGAGG - Intergenic
1149488424 17:57063873-57063895 CTTCTGCAACTGCAGCAGTGAGG + Intergenic
1150802422 17:68292133-68292155 CTGCTGCCGGTGCAGCAAAGTGG - Intronic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151380032 17:73719522-73719544 CTGCTGCATTTGCAGCACAGAGG - Intergenic
1151474083 17:74335660-74335682 CTGGAGCTGCAGCAGCAGATGGG + Intronic
1151554559 17:74840133-74840155 CAGCTACAGCAGCAACAGAAGGG + Intergenic
1151584975 17:75003422-75003444 CTGCTGCAGCTCCAGCAGCTCGG - Exonic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1151878156 17:76879024-76879046 AGGCTGCAGCAGCAGCATGGTGG - Intronic
1152008254 17:77695680-77695702 CAGGTGAAGCAGCAGCAGATTGG - Intergenic
1152064443 17:78102708-78102730 CTCCAGCAGCGGCAGCAGATGGG + Intronic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152446844 17:80349849-80349871 CTGCTGCAGCCACAGGAGTGTGG - Exonic
1152941813 17:83176793-83176815 TGGCTGCAGGAGCTGCAGAGAGG + Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154068855 18:11134244-11134266 CAGGTGTAGCAGCAGCATAGTGG - Intronic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1154215643 18:12414152-12414174 CTTGGGCCGCAGCAGCAGAGGGG + Intronic
1154219517 18:12440100-12440122 CAGGTGCAGCAGCTGCAGTGAGG - Intergenic
1155654517 18:28177784-28177806 CGGCTGCGGCAGCAGCTGCGCGG - Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1156482530 18:37445229-37445251 CTGCAGAAGCGGGAGCAGAGGGG + Intronic
1157810513 18:50692180-50692202 CTTCTGGAGCAACAGCAGAAGGG - Intronic
1158570930 18:58596483-58596505 CTGCTGCAGCAGCCGCCGCAGGG + Intronic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1159971799 18:74664672-74664694 CAGCTGGAGGAGCAGCAGAAGGG - Intronic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160376986 18:78420986-78421008 CTGCTTCCGCAGCCGCAGGGAGG + Intergenic
1160701094 19:507780-507802 CTGCTGCAGCAGCAGCGCCTGGG + Exonic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161265581 19:3362114-3362136 CTGGTGCAGGAGGAGCAGGGAGG + Intronic
1161465629 19:4428775-4428797 CAGCTCCTCCAGCAGCAGAGCGG + Exonic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162907035 19:13830287-13830309 CAGCTGCAGTCGCAGCAGAGTGG - Exonic
1162930413 19:13954568-13954590 CTCCTACACCAGCAGCAGTGGGG + Exonic
1163049706 19:14673198-14673220 CTGCTGCAGAGGCAGCTGATAGG - Intronic
1163440287 19:17319289-17319311 CCCCTGCAGCAGCATCACAGAGG - Intronic
1163612769 19:18309704-18309726 CAGCAGCAGAAGCAGCAGAAAGG - Exonic
1163702028 19:18790842-18790864 CTGCTGCGGCAGCAGGTGCGGGG - Exonic
1164976064 19:32573629-32573651 GCACAGCAGCAGCAGCAGAGGGG - Intergenic
1165230251 19:34382238-34382260 CTGTGGCAGGCGCAGCAGAGAGG + Intronic
1165309736 19:35022880-35022902 ATCCTGCAGCAGCAGCAGTGAGG - Exonic
1165831355 19:38732063-38732085 CTCCTGCAGTGGCAGCTGAGGGG - Intronic
1165861628 19:38912117-38912139 CCGCAGCAGCAGCAGCTCAGAGG + Exonic
1165867899 19:38950131-38950153 CAGCTGCAGCAGCCACACAGTGG + Exonic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167050025 19:47072435-47072457 CTGCTGCTGCAGCTGCTGCGGGG + Exonic
1167334473 19:48875919-48875941 CCGCTGCAGCAGCAGACGAGCGG - Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167498964 19:49835154-49835176 AAGCTGGAGCAGCAGCAGCGAGG + Exonic
1167617215 19:50541932-50541954 TAGCAGCAACAGCAGCAGAGTGG + Intronic
1167771889 19:51525863-51525885 CTGCAGCAGCAATGGCAGAGGGG - Intronic
1168269163 19:55240292-55240314 CTGCAGCAGCTGCGGGAGAGCGG + Exonic
1202647126 1_KI270706v1_random:152873-152895 GTACTGCAGCAGCTGCACAGGGG - Intergenic
924998302 2:384140-384162 CTGATGCAGCAGGAGCCGGGTGG + Intergenic
925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG + Intergenic
925354389 2:3227770-3227792 CAGCTGGAGCAGCAGCAGCTGGG - Intronic
925390000 2:3488124-3488146 CTGCTGCTGCAGTAGCTGTGTGG - Intergenic
925390003 2:3488132-3488154 CTACTGCAGCAGCAGAACTGGGG + Intergenic
926008738 2:9392315-9392337 CTGCTGCAGCAGCCCTGGAGTGG + Intronic
926017179 2:9463838-9463860 CTGCTGCTGTAGCAGGAAAGAGG - Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926402379 2:12511083-12511105 CTGCTGCATCAGGACCAAAGTGG + Intergenic
926625567 2:15086740-15086762 CTACTGCAACAGCTGCACAGAGG + Intergenic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927181001 2:20446850-20446872 CCGCAGCGGCAGCAGCAGCGCGG + Intergenic
927195026 2:20541027-20541049 CAGATGGAGCAGCTGCAGAGGGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927744644 2:25606384-25606406 CTGCTACAGCACTAGCACAGGGG + Intronic
927875111 2:26650099-26650121 CTGCAGAATGAGCAGCAGAGAGG + Intergenic
927937119 2:27082366-27082388 TGGCGGCAGCAGCAGCAGTGGGG + Exonic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929604364 2:43225376-43225398 CACCTGCAGCAGCAGCAGAAGGG - Exonic
929782547 2:44966319-44966341 CAACTGTAGCAGCAGCAGAGAGG + Intergenic
930023671 2:47016680-47016702 TTGCTGCAGAAGCAGCAGCCTGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
931434695 2:62236289-62236311 CTGTTCCAGCCTCAGCAGAGGGG - Intergenic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
931970075 2:67576284-67576306 ATGCTCCAGCAGCTGCTGAGGGG - Intergenic
932083751 2:68739092-68739114 CTTCTGCAGCAGCAGCAGAGTGG + Intronic
932558524 2:72846832-72846854 CTGGTGTAGCAGGAGCAGAGAGG + Intergenic
932882769 2:75519091-75519113 GTGCTGCAGCAGCTGGGGAGAGG - Intronic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933522873 2:83394884-83394906 TTGCTGCAGCAGCTGTAGTGTGG - Intergenic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
933780419 2:85796927-85796949 CCGGGGCAGCAGCTGCAGAGGGG - Intergenic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934736732 2:96693430-96693452 TGGCTGCAGCAGCAGAGGAGAGG + Intergenic
934770425 2:96904199-96904221 CAGCAGCAGCAACAGCACAGTGG + Intronic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
935852816 2:107241726-107241748 GAGCAGCAGCAGCAGCAGACAGG + Intergenic
936400277 2:112159715-112159737 CAGCTGCAGCAGCTGCTGAAGGG + Exonic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937379637 2:121365112-121365134 CTCCAGCAGCAGGAGCAGAATGG + Exonic
938194123 2:129311088-129311110 ATGCTGCAGTAGTAGTAGAGGGG + Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938483743 2:131682512-131682534 CCCCTGCAGCAGCAGCAGCGTGG + Intergenic
938568320 2:132540317-132540339 CTGCTGCAGCATCAGGGGAGGGG + Intronic
938578516 2:132625700-132625722 GTGCTGAATCAGCAGCACAGAGG - Intronic
938644235 2:133314966-133314988 ATGCTGCAGGAACAGCACAGAGG + Intronic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
940824469 2:158395230-158395252 CTGCTTCAGAAGCAGAAGAGTGG - Intronic
940897050 2:159090760-159090782 CTGCTGCTTCTGCAGCACAGTGG - Intronic
941253665 2:163200067-163200089 CTACTGCACCAGTTGCAGAGAGG - Intergenic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941527892 2:166628799-166628821 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942241035 2:173964439-173964461 CTGCAGCAGCAGCAACAGCACGG - Exonic
942319796 2:174726275-174726297 CTGCCCCAGCAGCAGGAGTGAGG - Intergenic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
942598661 2:177618277-177618299 CTGGTGGAGCAGCTGCTGAGTGG - Exonic
944199283 2:197088712-197088734 CTCCTGCAGCAGCAGCATGAAGG + Intronic
944287760 2:197971258-197971280 CTTCTGCAGCATCAGCTGTGGGG + Intronic
944310778 2:198231677-198231699 TGGATGCAGCAACAGCAGAGTGG - Intronic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
944529096 2:200649999-200650021 CTGCTGGGGCATGAGCAGAGAGG - Intronic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
945270245 2:207930994-207931016 CTGCCGCAGCCGCAGCACGGCGG + Exonic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945671754 2:212810547-212810569 CTACTGAAGCAGCAGAAGACAGG + Intergenic
946278971 2:218652215-218652237 CTGGTGCAGGGCCAGCAGAGTGG + Intronic
946313185 2:218894152-218894174 CTGCTGGAGAAACAGCAAAGGGG + Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947461223 2:230306367-230306389 CTGCTGCAGGAGACACAGAGAGG + Intronic
947716692 2:232343392-232343414 CTTCTGCATCTTCAGCAGAGGGG - Intronic
947827067 2:233113746-233113768 GAGATGCAGCAGCAGGAGAGAGG - Intronic
947905722 2:233760426-233760448 ATCCAGCAGCTGCAGCAGAGGGG + Exonic
947914697 2:233823637-233823659 CTGCCGCATCAGCAGCACAGCGG + Exonic
948173746 2:235927363-235927385 CTGCTGCACCAGCATCTCAGTGG + Intronic
948230030 2:236342678-236342700 ATGCTGCAGCAGGAGAGGAGCGG - Intronic
948350504 2:237336216-237336238 GTTTTGCAGCAGCAGCAGCGGGG + Exonic
948698282 2:239745127-239745149 TTGCGGCAGCAGCAGCTTAGAGG + Intergenic
948830927 2:240597919-240597941 CGGCTCCTGCAGCAGCAGTGGGG - Exonic
948919240 2:241053593-241053615 CAGCTGCTGCATCTGCAGAGTGG - Intronic
1170601699 20:17846320-17846342 GAGCTGGAGCCGCAGCAGAGAGG + Intergenic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1170853224 20:20022963-20022985 CGGCAGCAGAAACAGCAGAGGGG + Intronic
1172104292 20:32506984-32507006 CTGCTCCAGGAACTGCAGAGAGG + Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1173179746 20:40796825-40796847 GGGCAGGAGCAGCAGCAGAGTGG - Intergenic
1173720407 20:45253231-45253253 CTGCTCCAGCTTCAGCAGGGGGG + Intronic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174291297 20:49510700-49510722 ATGCGGCAGCAGCTGCAGACGGG + Intronic
1174295424 20:49542117-49542139 CTGCTCAAGGGGCAGCAGAGAGG + Intronic
1174619331 20:51862283-51862305 CTGCTGCACCAGCCTCAGAAGGG - Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1174943533 20:54958721-54958743 TTGATGAAGCAGAAGCAGAGAGG - Intergenic
1175010308 20:55728023-55728045 CTGTTGCAGAGGCAGCAGAGAGG - Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175166058 20:57045480-57045502 CTGCAGCATCAGCAGCATCGGGG + Intergenic
1175187474 20:57188751-57188773 CTGCCTCACCAGCAGCAGACTGG + Intronic
1175191766 20:57216448-57216470 CTCCTGGAGCAGCTCCAGAGGGG + Intronic
1175381754 20:58568599-58568621 CTCCTGCAGCAGCACCAGCAGGG - Intergenic
1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG + Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175747023 20:61464209-61464231 CTGCTGCTACAGATGCAGAGAGG + Intronic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176008986 20:62881693-62881715 CTGAAGCAGCTGCAGCCGAGCGG - Exonic
1176068388 20:63212687-63212709 TTGCTGCAACAGCAGCACAGAGG + Intronic
1176081366 20:63274950-63274972 CTGCTGCAGGACAAGGAGAGTGG - Intronic
1176246372 20:64099157-64099179 CTGCCAACGCAGCAGCAGAGAGG - Exonic
1176604745 21:8819901-8819923 GTACTGCAGCAGCTGCACAGGGG + Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179052973 21:37904949-37904971 CTGCTGCAGCAGCCAGATAGGGG - Intronic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179086457 21:38222603-38222625 CTGCTGATGCAGAAGCAGACAGG + Intronic
1179613437 21:42566709-42566731 CTGCTTCATCTGCAGCAGAAAGG - Intronic
1179889917 21:44330291-44330313 CTCCCGCAGCAGCAGCAGGATGG + Exonic
1180076920 21:45467739-45467761 CTGCTCCAGCAGGGTCAGAGTGG + Intronic
1180151056 21:45948122-45948144 CTGCAGCAGCCTCAGGAGAGGGG - Intergenic
1180192729 21:46173824-46173846 GTACTGCAGCTACAGCAGAGTGG - Intronic
1180347035 22:11711506-11711528 GTACTGCAGCAGCTGCACAGGGG + Intergenic
1180484827 22:15784967-15784989 CCCCTGCAGCAGCAGCGGCGTGG + Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181145117 22:20840301-20840323 CTGCTGCTGCAGCAGCACAGTGG + Intronic
1181175490 22:21032526-21032548 CGGCTGCGGCAGCAGCAGGTGGG - Exonic
1181430792 22:22880621-22880643 CTGCTGCAGGAGGAGCTGTGTGG - Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181725131 22:24806226-24806248 CTGCTGCAGCCGCGGCGGGGCGG - Intronic
1181725132 22:24806229-24806251 CTGCTGCTGCAGCCGCGGCGGGG - Intronic
1181725136 22:24806237-24806259 CGGCTGCAGCAGCAGCGCCGCGG + Intronic
1181851041 22:25750175-25750197 CTGCTGCCGCAACAGGAGAGGGG + Intronic
1181866176 22:25857236-25857258 CTGCTTCAGCAGCAGAAAAATGG - Intronic
1181977391 22:26740565-26740587 CTGCTGGAACAGCAGCCCAGGGG + Intergenic
1182104301 22:27678279-27678301 CTGCTGCATGGGCAGCAGGGTGG + Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182221372 22:28761617-28761639 CTGCTGTATCAGGAGCACAGAGG - Intergenic
1182355570 22:29720981-29721003 CTGCTCGGGCAGCAGCAGAAGGG + Intronic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1183061955 22:35341627-35341649 GGGCTGCAGCAGGAGCAGATTGG - Intronic
1183161249 22:36114794-36114816 CTGCAGCAGGTGCAGCAGAAGGG - Intergenic
1183357898 22:37369282-37369304 CAGCTGGGGCAGCAGCAGTGGGG - Exonic
1183578620 22:38708682-38708704 CTACTTCAGGAGAAGCAGAGAGG + Intronic
1183589664 22:38772667-38772689 CTGGGGAAGCAGCCGCAGAGGGG - Intronic
1183599618 22:38832364-38832386 CTGCCCCAGCAGGAGCTGAGTGG - Intronic
1183625207 22:38997536-38997558 CTTCTGCATCAGCAGCTGTGTGG - Intergenic
1184069349 22:42138422-42138444 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1184235049 22:43178929-43178951 CTACGGAAGCAGCAGCAGATGGG + Intronic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184322844 22:43756306-43756328 GTGCTGCAGCTGCAGCAGAGAGG - Intronic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1184973058 22:48041190-48041212 CTGTCCCAGCAGCAGAAGAGGGG - Intergenic
1185131887 22:49043934-49043956 TTATTGCAGCGGCAGCAGAGGGG + Intergenic
1185202602 22:49517305-49517327 GTGCTGTGGCAGGAGCAGAGAGG - Intronic
1185236462 22:49716420-49716442 TTGCAGCACCAGCAGCAGCGAGG - Intergenic
1185251535 22:49804237-49804259 CTGCAGCCGCCGCAGCAGGGGGG + Exonic
949875340 3:8623026-8623048 TGGCTGCAGCAGCAGCAGAAGGG + Intronic
952838828 3:37627376-37627398 CTCCCGCAGCAGCCCCAGAGAGG - Intronic
952844070 3:37672158-37672180 CTGCTGGAGAAGAAGCTGAGTGG + Intronic
952884690 3:38005284-38005306 TGGCTGCAGCAGAAGCAGTGAGG - Intronic
953558679 3:43967431-43967453 CTGCTGCACAGGCAGCAAAGTGG - Intergenic
953576075 3:44114155-44114177 CTCCGGCAGCAGCAGCACAAAGG + Intergenic
953801817 3:46030716-46030738 CAGCTGCAGGAGCAGCAGTGGGG + Intergenic
953929320 3:46998104-46998126 CTGCTCCATCAGCAGCTGGGCGG - Exonic
953993037 3:47498544-47498566 TGGCTGTAGCAGCAGCAGGGAGG - Intronic
954304490 3:49718231-49718253 CGGCGGCAGCAGCGGCAGGGTGG + Exonic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
955189898 3:56751525-56751547 AAGCTGCAGAAACAGCAGAGAGG + Intronic
955565982 3:60246795-60246817 TTGCTTCAACTGCAGCAGAGAGG - Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
956023903 3:64961804-64961826 CTACTGCAGCAGAATCAGATTGG - Intergenic
956193467 3:66629571-66629593 TTGCTGCAGCAGCAGCAGCGGGG + Intergenic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956609145 3:71104395-71104417 CAGCAGCAACAGCAGCAGAAGGG - Intronic
956645822 3:71454931-71454953 CAGCTCCAGAAGCAGCACAGAGG - Intronic
957266729 3:77976289-77976311 CTGCTGGAGGAGCATCAGGGTGG + Intergenic
958462245 3:94413195-94413217 GAGCTGAGGCAGCAGCAGAGGGG + Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959932484 3:111999303-111999325 CTGGCCCAGCAGCAGCAAAGAGG - Exonic
960316078 3:116178896-116178918 CTGCTACAGGAGCAGGAAAGAGG - Intronic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961087308 3:124079173-124079195 CAGCTGCAGAGGAAGCAGAGGGG + Intergenic
961636136 3:128334291-128334313 CTCCTGGGGCAGAAGCAGAGAGG - Intronic
961726662 3:128935181-128935203 CTGCTGCAGCAGCAGCTCCGTGG + Exonic
961781130 3:129320539-129320561 CACCTGCAGCAGCAGCGGATGGG + Intergenic
961932318 3:130547280-130547302 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
962173974 3:133133152-133133174 TTGATGCAGCAGCAGCAGCAGGG + Intronic
962230575 3:133661994-133662016 CGGCAGCTGCAGCAGAAGAGCGG + Intergenic
962241535 3:133754817-133754839 CTGCTGCACCAGCAGCACTTGGG + Intronic
962494523 3:135925890-135925912 TTGCTGCAGCAGGCACAGAGAGG - Intergenic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
962839657 3:139222071-139222093 CTGCTGCAGCCTAAGCTGAGGGG + Intronic
963082276 3:141404924-141404946 CTTCTCCAGCAGTTGCAGAGTGG + Intronic
963583336 3:147154226-147154248 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
963786737 3:149542407-149542429 CTGCTGCTGCTGCTGCTGAGTGG + Exonic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
963922364 3:150918132-150918154 ACTCTGCAGCAGCAGCACAGAGG - Intronic
963969277 3:151411431-151411453 CAGATTCAGCAGCAGCCGAGTGG + Exonic
964763250 3:160154252-160154274 ATGCCACAGCAGCAGAAGAGAGG + Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
967832560 3:193933005-193933027 CTGTTGCAGGAGGAGAAGAGGGG + Intergenic
967891848 3:194369428-194369450 CTGTTGAGGCATCAGCAGAGGGG + Intronic
968086664 3:195876960-195876982 CTCCGGCAGCAGCACAAGAGGGG + Intronic
968811353 4:2800951-2800973 CTGCTGAGGCTGCAGCAGAAAGG + Intronic
968811527 4:2801569-2801591 CTGCTGCAGCCCCAGCAGAGGGG + Intronic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969109959 4:4838423-4838445 CTCATCCAGCAGCAGCAGTGGGG - Intergenic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969541513 4:7793388-7793410 CAGCTGCAGCGGGAGCTGAGTGG + Intronic
969570287 4:8004325-8004347 CTGCTGCAGCAGCACAGGGGAGG - Intronic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
971409277 4:26353260-26353282 CTGCTGCATAGGCAGCATAGGGG - Intronic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972125529 4:35760621-35760643 CTGCAGCAGCACTGGCAGAGGGG - Intergenic
972637240 4:40895284-40895306 CTTGTGCACCATCAGCAGAGTGG - Intronic
973045386 4:45530596-45530618 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973373381 4:49271036-49271058 GTCCTGCAGCAGCTGCACAGGGG - Intergenic
973387629 4:49524172-49524194 GTCCTGCAGCAGCTGCACAGGGG + Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
976272844 4:83248132-83248154 GTGCGGCAGAAGCAGCAGATGGG + Intergenic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
977696577 4:99972237-99972259 CAGAGGCAGCAGCAGCACAGGGG - Intergenic
978466256 4:109012617-109012639 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
978514611 4:109557544-109557566 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
979678613 4:123435590-123435612 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
979779016 4:124625802-124625824 CTGCTGCAGGAGATGAAGAGTGG + Intergenic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
980027119 4:127781014-127781036 CTACAGCAGCAGCAGCAGCAAGG - Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
981141569 4:141275648-141275670 CTTCTGCAGCAGCAGCTAAGTGG - Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981692621 4:147526477-147526499 CTGCTGGAGCAAAAACAGAGAGG - Intronic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982265321 4:153533369-153533391 CTGCAGCAGCAGTGGCGGAGGGG + Intronic
984536539 4:180982929-180982951 TAGCTGTAGCAGCAGTAGAGGGG - Intergenic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
984778781 4:183505606-183505628 CGGCTGCAGCTGCCGCTGAGGGG + Intronic
985718574 5:1476555-1476577 CTGCTGCAGCAGGAGCCTGGGGG + Intronic
985986494 5:3520843-3520865 CTGCTGCAGCAGCTGCCTGGTGG - Intergenic
986184497 5:5422986-5423008 GTGCTGCACCTGCTGCAGAGAGG - Exonic
986284099 5:6347349-6347371 CTGGAGCTGCCGCAGCAGAGAGG - Intergenic
986469365 5:8058957-8058979 CTGCTGGAGCAGCTGCCGTGAGG + Intergenic
986540925 5:8843059-8843081 CTGCTGGAGCAGCTGCCGTGAGG - Intergenic
987108802 5:14665346-14665368 CTGCTGCAGCCGCCGGAGAACGG + Intronic
989461818 5:41708498-41708520 CTGCAGCAACAGTGGCAGAGAGG - Intergenic
990322325 5:54642093-54642115 ATGCTACAGCAGCAGCACAGCGG + Intergenic
990876687 5:60494308-60494330 CTGTAGCTGCACCAGCAGAGGGG - Intronic
991711985 5:69417040-69417062 CTACTGTGGCAGCAGCAAAGTGG - Intronic
991967393 5:72107066-72107088 CGGCTGCAGCAGGAGCTCAGCGG + Intergenic
992216339 5:74528238-74528260 CTTCTGCTGCTGCAGCAGTGAGG - Intergenic
992614514 5:78535632-78535654 CTACTGCAGCATCAGCATTGGGG - Intronic
993005123 5:82421433-82421455 CTGCTGAGACACCAGCAGAGCGG - Intergenic
993794532 5:92249845-92249867 CTGCTGTGGGAGTAGCAGAGGGG - Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994559408 5:101347783-101347805 CAGCTGCAGCAAAAGCAGATGGG - Intergenic
995068440 5:107889755-107889777 CTTAAGCAGCAGCAGCAGCGAGG + Intronic
995370599 5:111414377-111414399 CTGCTGCTGCTGCTGCTGAGAGG - Intronic
995540978 5:113186085-113186107 CTGCTGCTGAGGCAGCATAGAGG + Intronic
995913662 5:117217353-117217375 ATGCTGCAACAGCACCAGAATGG - Intergenic
996167011 5:120236611-120236633 TTCCAGCAGCAGCAGCAGCGTGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996720762 5:126628094-126628116 CTGAAGCAGCAGCAGTGGAGGGG + Intergenic
996747092 5:126854748-126854770 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
997013532 5:129905151-129905173 CCGCTGCAGCAGCGGCGGCGAGG + Exonic
997505602 5:134414160-134414182 AAGCTGCAGAAGCAGCAGACAGG - Intergenic
997631750 5:135374027-135374049 CTGCTGCTGCAGCACAGGAGAGG - Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997975413 5:138439077-138439099 CCGCTGCAGCAGCCGCCGCGGGG - Exonic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998810595 5:145962574-145962596 CTGCTGCAGGAACTGAAGAGGGG - Intronic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
999124711 5:149238752-149238774 CTGGTGCAGCAGCTGGAGATGGG - Intronic
999255579 5:150208403-150208425 GTGCTGCGGCTGGAGCAGAGGGG + Intronic
999542070 5:152584788-152584810 CTGCAGCTGCAGTGGCAGAGGGG + Intergenic
1000698796 5:164422215-164422237 CTGCAGCAGCAGGGGCACAGGGG + Intergenic
1001775279 5:174324224-174324246 AGGGTGCAGAAGCAGCAGAGGGG + Intergenic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1003097785 6:3156305-3156327 CTGCAGCAGCCGCTGCTGAGGGG + Intronic
1003437477 6:6105200-6105222 CTTCTCCAGCATCAGTAGAGAGG - Intergenic
1003482616 6:6546942-6546964 CTCCTGCACCCGCAGCGGAGTGG - Intergenic
1003492610 6:6636802-6636824 TTGCTGCAGCAGCAGCTGCCTGG - Intronic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1005706081 6:28454910-28454932 CAGCTGCAGCACCAGCTCAGAGG - Intergenic
1005781809 6:29201030-29201052 CAGCTGCAGCTGCACCAGGGAGG - Intergenic
1006274048 6:32987124-32987146 CTTCTGCAGGGGCAGAAGAGGGG - Intergenic
1006505824 6:34488022-34488044 CTGCTGCAGCAGCGGGACTGTGG - Intronic
1007157806 6:39762930-39762952 CAGCTGTAGTAGCAGCAGAAAGG + Intergenic
1007253817 6:40514815-40514837 TTCCTGGAGAAGCAGCAGAGTGG + Intronic
1007339920 6:41184885-41184907 CAGCAGCAGCAGCAGCACAACGG + Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007409385 6:41653216-41653238 CTGCGGCAGCGGCAGCAGCAGGG - Intronic
1007534729 6:42576424-42576446 GGGCAGCAGCAGCAGCAGAATGG - Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007625339 6:43243496-43243518 CGGCGGCGGCAGCGGCAGAGCGG - Intergenic
1007742798 6:44023039-44023061 AATCTCCAGCAGCAGCAGAGAGG + Intergenic
1008062505 6:47013446-47013468 CTACTGCAGCAGCAGAAGCAAGG + Intronic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1009694867 6:67089182-67089204 CTTGTGCAGCAGCAACATAGTGG + Intergenic
1011083437 6:83512936-83512958 CTGCTTAAGCAGTACCAGAGGGG + Intronic
1011294371 6:85810441-85810463 CTGCTTCAGTACCAGTAGAGTGG - Intergenic
1011872571 6:91914628-91914650 CAGCTGCAGTAGCAGCAGTCAGG + Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012964402 6:105657689-105657711 CCACAGCAGGAGCAGCAGAGGGG - Intergenic
1013366865 6:109443508-109443530 CTGTTGTAGGACCAGCAGAGAGG + Exonic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1014947692 6:127516370-127516392 CTGCAGCAGCAGCAACAGCAGGG - Exonic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1015882295 6:137881394-137881416 CTGTTGCAGTGGCAGCTGAGGGG - Exonic
1016272266 6:142302250-142302272 GTGGAGCAGCGGCAGCAGAGCGG + Exonic
1016718003 6:147256194-147256216 CTTATGGAGCAGCAGCAGTGGGG - Intronic
1017989429 6:159473245-159473267 CCACTGCAGCACCAGGAGAGGGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018650715 6:165989134-165989156 CTGCTGCAGGAGCAGCCGGATGG + Intergenic
1018903299 6:168061823-168061845 CTGCCGCAGCTGTTGCAGAGTGG + Exonic
1018969390 6:168515715-168515737 CTGCTGCAAACGCAGCATAGGGG + Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020423431 7:8036062-8036084 CAGCTACAGCAGAAGCAGATGGG - Intronic
1020513783 7:9090964-9090986 CTACAGCAGCAGTGGCAGAGGGG - Intergenic
1020915244 7:14184601-14184623 TTGCTGCAGCTGCAGCATGGGGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021561361 7:21971859-21971881 GAGCAGCAGCTGCAGCAGAGAGG - Intergenic
1022406276 7:30093186-30093208 CTGCTGCAGCATCAGGACACTGG + Intronic
1022414930 7:30169625-30169647 GTTCTGCAGCATCAGAAGAGAGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022650434 7:32269063-32269085 CTGTGGCAGTAGCAGCACAGAGG + Intronic
1024047496 7:45595229-45595251 CCACTGCATCAGCAGCAGTGGGG + Intronic
1024208209 7:47181794-47181816 CTGCTGCAGCTGCAGCACTCAGG - Intergenic
1024279920 7:47710376-47710398 CTCCTGCAGCACCAGCAGAGGGG + Intronic
1024607946 7:51038278-51038300 CAGGTGCTGCAGCAGCAGCGAGG + Intronic
1024694332 7:51839306-51839328 GTGCTGGAGCCGCAGCAGGGCGG - Intergenic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1026916361 7:74122249-74122271 CGGCTGCAGCAGCAGCTGCCAGG + Exonic
1027779454 7:82503980-82504002 CTGCTGCAGCAGAGGAAGAGAGG - Intergenic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028077489 7:86534234-86534256 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1028477190 7:91265154-91265176 CCGCCTCAGCAGCAACAGAGCGG + Exonic
1028640681 7:93039410-93039432 CAGCTGCAGCAGCACCTGGGAGG - Intergenic
1028673047 7:93426490-93426512 CGGCTGCAGCGCGAGCAGAGCGG + Exonic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029859199 7:103551181-103551203 CTGCTGCTGTGGTAGCAGAGGGG + Exonic
1031141600 7:117948981-117949003 CTGCTGAAGCACCAGCTCAGAGG + Intergenic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1032121944 7:129162849-129162871 CAGCTGCAGCAGGAACACAGCGG - Exonic
1032456445 7:132076577-132076599 CTGCTGGTGGTGCAGCAGAGAGG - Intergenic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1034010429 7:147523623-147523645 AAGCTGCTGCAGAAGCAGAGAGG - Intronic
1034276631 7:149826670-149826692 CTGCTGCAGCTGCTGCACAATGG + Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035014066 7:155748769-155748791 CTGCAGCAGCAGCCACAAAGGGG - Intronic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1036710292 8:11074200-11074222 CTGCTCCAGCAGGAGCAGAAAGG + Intronic
1037388373 8:18366303-18366325 CTGCAGTAGCAGTGGCAGAGAGG - Intergenic
1037465181 8:19152754-19152776 GTGCAGCAGAAGCAGCACAGAGG + Intergenic
1037815017 8:22107552-22107574 CTCCTGCAGCAGCCGCAGGACGG + Exonic
1037821469 8:22137226-22137248 CAGGTGCAGCAGTGGCAGAGGGG + Intergenic
1038170729 8:25128960-25128982 CTGCTGCAGCAGTGGCAGGGCGG - Intergenic
1038346609 8:26737836-26737858 CAGCTGCAGCAGCAGGACACGGG + Intergenic
1038707196 8:29905572-29905594 CTGTTACAGCAGCAGCAGTAAGG - Intergenic
1038828540 8:31033148-31033170 CTGCGGCGGCTGCAGCAGAGGGG - Exonic
1038934111 8:32229461-32229483 CTGCTTTAGCACCAGCAGTGTGG + Intronic
1039896421 8:41719625-41719647 CTGCTGGAGAAGGTGCAGAGTGG - Intronic
1039916113 8:41861563-41861585 CCACTGAATCAGCAGCAGAGTGG - Intronic
1040003698 8:42600286-42600308 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1041012728 8:53559849-53559871 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041643086 8:60223618-60223640 CTGTTGCAGAAGCAGTATAGTGG - Intronic
1041706680 8:60853519-60853541 CTGCTGCAGGGTCAGGAGAGGGG - Intronic
1042169484 8:65978011-65978033 CTGGGTCAGCAGCTGCAGAGGGG - Intergenic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042743337 8:72075736-72075758 CTGCTGCAGCTGCAGGACAGCGG - Intronic
1042759124 8:72251890-72251912 CTGCTGCAGCTGCAGGACAGCGG - Intergenic
1043482572 8:80668231-80668253 CTGCTGCTGCTGCTGCAGTGAGG - Intronic
1043623552 8:82227669-82227691 CTGTGGTAGTAGCAGCAGAGTGG - Intergenic
1043667805 8:82839478-82839500 ATGTTGCAGAAACAGCAGAGAGG - Intergenic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1044436539 8:92170925-92170947 CTGTTGGGGCAGCAGCAGGGAGG + Intergenic
1044923075 8:97186117-97186139 CTACAGCAGCAGCAGCAACGTGG + Intergenic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046260321 8:111758975-111758997 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1046486458 8:114894542-114894564 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1047215609 8:122873497-122873519 CTGGTTGAGCAGCATCAGAGCGG + Intronic
1047251503 8:123184711-123184733 CCTCTGCAGCAGCAGGAGTGAGG - Intronic
1047254970 8:123207600-123207622 CTGCTCCAGCTGCAGCCGCGTGG - Exonic
1047418935 8:124690144-124690166 CGGCGGGAGCAGCAGCAGTGGGG - Intronic
1047757351 8:127928757-127928779 CTGCTGCGGTGGCTGCAGAGAGG + Intergenic
1047777857 8:128088389-128088411 CACTTTCAGCAGCAGCAGAGGGG + Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049040873 8:140110955-140110977 CTGCTGCAGGGGCTGCAGGGGGG - Intronic
1049073078 8:140372230-140372252 GTGCTCCTGGAGCAGCAGAGTGG - Intronic
1049174772 8:141185074-141185096 CTGCTGTAGCAGCAGGTGACTGG - Intronic
1049297208 8:141848517-141848539 CTGCTGCAGGAGCTCCAGGGAGG - Intergenic
1049381199 8:142316917-142316939 CTGCTGCAGAGCCAGCAGCGTGG - Intronic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049453038 8:142672606-142672628 CTGCTGAAGCAGCATCATTGGGG + Intronic
1049746311 8:144264748-144264770 CTGGTGCGGCGGCTGCAGAGTGG - Exonic
1049777865 8:144414781-144414803 CTGCTCCAACAGCAGCTGAGTGG - Exonic
1049791082 8:144473032-144473054 CACCTGCAGCAGCAGCACCGCGG - Exonic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1050182230 9:2934007-2934029 CAGCTGCAGCCGCTGCAGGGTGG + Intergenic
1051065143 9:13093774-13093796 CTGATGCAGGAGCTGCAGTGAGG - Intergenic
1051114282 9:13675971-13675993 ATGCTGCAGCAGCAATACAGAGG - Intergenic
1051346404 9:16154788-16154810 TTGCTGCTGCAGCACCAGCGTGG - Intergenic
1051791320 9:20805895-20805917 ATGCTGCTGCAGCAGCAGCTAGG - Intronic
1051791323 9:20805903-20805925 CTGCTGCAGCAGCATCTTTGGGG + Intronic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052322365 9:27182163-27182185 CTTTTGCAGCATCAGCAGAAGGG - Intronic
1052432119 9:28380052-28380074 CTGCTACTGTAGCAGCAAAGAGG - Intronic
1052799281 9:32952667-32952689 CAGCTGGAGCAGGAGCAGGGTGG + Intergenic
1053317738 9:37066508-37066530 CTCATGCAGACGCAGCAGAGAGG + Intergenic
1053337340 9:37287032-37287054 CTGTTTCAACAACAGCAGAGAGG - Intronic
1053371317 9:37564088-37564110 CTGCTGCAGCTGAAGCAGCTGGG - Intronic
1053607824 9:39679023-39679045 GGGCTGCAGCAGCAGCAAAAAGG - Intergenic
1053865671 9:42435383-42435405 GGGCTGCAGCAGCAGCAAAAAGG - Intergenic
1054245711 9:62663386-62663408 GGGCTGCAGCAGCAGCAAAAAGG + Intergenic
1054559836 9:66697917-66697939 GGGCTGCAGCAGCAGCAAAAAGG + Intergenic
1054750512 9:68900315-68900337 CAGGTGCTGCAGCTGCAGAGAGG - Intronic
1054790418 9:69251437-69251459 CATCTGCAGCAGCAGCAAAGGGG - Intronic
1055373409 9:75624436-75624458 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056234142 9:84574817-84574839 CTGCTGCAGAAGTACTAGAGAGG + Intergenic
1056427213 9:86489096-86489118 CTGCTTCACCATCAGCAGAGAGG + Intergenic
1056968381 9:91183003-91183025 CTGGTGCAGGAGCAGGAGGGAGG - Intergenic
1057684804 9:97222153-97222175 GTCCTGCAGCAGCTGCACAGGGG - Intergenic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1058697893 9:107575106-107575128 CTGATTCAGCAGCCCCAGAGTGG + Intergenic
1059565387 9:115379454-115379476 CTGCTGCAGCAGGAGCAAGTGGG + Intronic
1060411629 9:123404163-123404185 CCGCTGCTGCAGCAGCTGTGGGG - Intronic
1060563633 9:124569126-124569148 GTGATGCAGCAGCAGCACTGAGG - Intronic
1060734746 9:126059757-126059779 GACCTGCAGCAGGAGCAGAGTGG - Intergenic
1060969538 9:127730361-127730383 CTGCTGCAACAGGAGCACAGAGG + Intronic
1061629936 9:131865966-131865988 CAGCTGCAGCAGCTGAGGAGCGG + Intronic
1061768340 9:132897183-132897205 CAGCTGAAGCAGCAGAAGAAAGG - Exonic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062375324 9:136259405-136259427 GTGCTGCAGGCCCAGCAGAGGGG + Intergenic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062562870 9:137149554-137149576 CAGCTGCAGCAGTAGCTTAGGGG + Intronic
1203697088 Un_GL000214v1:109039-109061 CTCCTGCAGCAGCTGCACAGGGG - Intergenic
1203552121 Un_KI270743v1:171990-172012 GTCCTGCAGCAGCTGCACAGGGG + Intergenic
1185492306 X:526937-526959 CAGCTGGGGCAGCCGCAGAGAGG + Intergenic
1185946551 X:4383631-4383653 CAAGTGCAGCAACAGCAGAGAGG + Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1187273822 X:17801582-17801604 CTCCTGCGGCAGGACCAGAGGGG + Exonic
1187701855 X:21970431-21970453 CTCCTTCACCAGCAGCAGAGAGG - Intronic
1187826335 X:23335450-23335472 CTGTTGCAGCAGCTGCGGGGTGG - Intronic
1188835456 X:34948706-34948728 CAGCTGCTGCAGCAGCATTGCGG - Intergenic
1188859746 X:35243283-35243305 CTACTGCAGCAGCTGCACAGAGG - Intergenic
1188871957 X:35383184-35383206 CTGCTGCAGCTGGATCAGGGAGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189204045 X:39222467-39222489 CTGCTATAGCAGCTGCAGGGAGG - Intergenic
1189348804 X:40262127-40262149 CTCCTGCAGCAGCAGCAGCCTGG + Intergenic
1189418174 X:40832881-40832903 CAGCTGCAGCGGCAGGAGAACGG - Intergenic
1189899434 X:45690626-45690648 AGGCTGGAGCTGCAGCAGAGAGG - Intergenic
1189943898 X:46157308-46157330 CTGCTGCACCATCAGGTGAGAGG + Intergenic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1191019400 X:55843097-55843119 CCGCTGCAGCTCCAGCAAAGAGG - Intergenic
1191224710 X:58031144-58031166 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1191743699 X:64463701-64463723 CTGCAGAGGCAGTAGCAGAGAGG + Intergenic
1191846669 X:65552029-65552051 CAGCTGCACCTCCAGCAGAGGGG + Intergenic
1192034126 X:67545301-67545323 CTGCTGCAGCAGCAGCAAACTGG - Exonic
1192756318 X:74049837-74049859 CTGCTGTGGCAGTAGCAGAGGGG - Intergenic
1193317083 X:80076985-80077007 CTGCTGTAGCAGTGGCAGAGGGG + Intergenic
1194201600 X:90958619-90958641 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1194234966 X:91372139-91372161 CTGCTGTTGCAGTGGCAGAGGGG - Intergenic
1194353299 X:92849654-92849676 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1195454373 X:105051477-105051499 CAGCTGCAGCTGCATCCGAGAGG + Intronic
1195687988 X:107602686-107602708 CTGCAGCAGCAGCAGCCCTGAGG + Exonic
1195803306 X:108735957-108735979 CTGCTGCAGCCGCCGCGGCGCGG + Exonic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196192699 X:112811197-112811219 CTTCTGAAGCAGCTGCAGGGTGG - Intronic
1197476725 X:126933861-126933883 CTTCTCCAGCAGCCGTAGAGTGG - Intergenic
1197904687 X:131412418-131412440 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1198433846 X:136595731-136595753 CAGCTGTAGTAGCAGAAGAGTGG - Intergenic
1199266871 X:145838332-145838354 GTGCTAAAGCAGCAGCAGTGGGG + Intergenic
1199336100 X:146620382-146620404 CTGCTGCTGCAGCTGCTGGGTGG + Intergenic
1199711305 X:150471348-150471370 CTGCTGCTGCAGCTGCAAGGTGG - Exonic
1200056695 X:153465339-153465361 TGGCTGCAGCAGAGGCAGAGAGG + Intronic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200547440 Y:4534074-4534096 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1200661657 Y:5966727-5966749 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1200846174 Y:7833964-7833986 CTGCTGCAGTCACAGCTGAGAGG - Intergenic
1200955319 Y:8938473-8938495 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1201153402 Y:11107563-11107585 GTCCTGCAGCAGCTGCACAGGGG + Intergenic
1201980888 Y:19909206-19909228 TAGCTGGAGCTGCAGCAGAGGGG + Intergenic
1202152564 Y:21856629-21856651 CTGTGGGAGCAGCAGCATAGTGG - Intergenic
1202266079 Y:23020720-23020742 ATGCCGCAGCTGCAGCAAAGTGG + Intergenic
1202419072 Y:24654463-24654485 ATGCCGCAGCTGCAGCAAAGTGG + Intergenic
1202451714 Y:25015621-25015643 ATGCCGCAGCTGCAGCAAAGTGG - Intergenic