ID: 916059442

View in Genome Browser
Species Human (GRCh38)
Location 1:161088735-161088757
Sequence CCTGATGCCCAGAGAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 7, 3: 78, 4: 493}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916059442 Original CRISPR CCTGATGCCCAGAGAGTGGA TGG (reversed) Intronic
900392807 1:2441063-2441085 CCAGGTGCCCAGGAAGTGGAGGG + Intronic
900713875 1:4131804-4131826 CCTGATGCCCAGGGCCTAGATGG + Intergenic
900884299 1:5404287-5404309 CCTGATGCCTGGAGAGGGAATGG - Intergenic
901510715 1:9716897-9716919 CCTGGTGTCCAGGGAGTGGTTGG + Intronic
901874826 1:12161522-12161544 GCTGAAGCCCAGAGAGGGGTAGG + Intergenic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902374535 1:16024087-16024109 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902379476 1:16045851-16045873 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902936377 1:19767761-19767783 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
903016400 1:20364914-20364936 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
903022050 1:20401472-20401494 ACTGAGGCCCAGAGAGGGAAAGG + Intergenic
903185093 1:21624406-21624428 CCTGAGGCCCAGAGACGGGCAGG + Intronic
903189367 1:21648193-21648215 ACTGAAGCCCAGAGAGGGGATGG + Intronic
903228507 1:21907364-21907386 TCTGAGGCCCAGAGAAGGGAAGG - Intronic
903368794 1:22821483-22821505 CCTGAAGCCCAAAGAGAGGAAGG + Intronic
903465686 1:23551220-23551242 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903653222 1:24933457-24933479 TGTGAGGCCCAGAGAGAGGAGGG - Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903677551 1:25073923-25073945 ACTGAGGCCCAGAGAGGGAACGG - Intergenic
903706802 1:25291887-25291909 GCTGATGCCTGGAGAGGGGAAGG + Intronic
903708909 1:25307228-25307250 CCTGAGGCCCAGAGAGGGGTGGG + Intronic
903718210 1:25385190-25385212 CCTGAGGCCCAGAGAAGGGTGGG - Intronic
903720431 1:25401454-25401476 GCTGATGCCTGGAGAGGGGAAGG - Intronic
903889561 1:26560552-26560574 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
903891420 1:26572859-26572881 ACTGAGGCTCAGAGAGTTGAAGG + Intronic
903972737 1:27129640-27129662 GATGAAGCCCAGAGAGGGGACGG + Intronic
904031911 1:27538481-27538503 CCTGAAGCCCAGAGAGGGAAGGG - Intronic
904047395 1:27616774-27616796 ACTGAGGCCCAGAGAAGGGAAGG - Intronic
904684719 1:32251706-32251728 CCTGAGGCCCAGAGAGAACAAGG + Intronic
904953794 1:34266336-34266358 CAGGATGCACAGAGAGTGAATGG - Intergenic
905679267 1:39855833-39855855 ACTGAGGCCCAAAGAGTAGAAGG - Intronic
907256008 1:53179696-53179718 TCTGAATCCAAGAGAGTGGAAGG + Intergenic
907320794 1:53601007-53601029 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
907404805 1:54247373-54247395 CCTGCTGCCCAGAAAATGGCTGG - Intronic
908984614 1:70002276-70002298 TCTGATGCCCATAGAGAAGAAGG - Intronic
912540883 1:110414367-110414389 TCTGAGGCTCAGAGAGGGGAAGG + Intergenic
912674463 1:111664578-111664600 CTTGAAGCCCAGGGAGAGGAAGG - Intronic
912701508 1:111881716-111881738 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
913081484 1:115391570-115391592 CCTGAGGACCAGAGAGTAGTGGG - Intergenic
913089221 1:115465302-115465324 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
915098892 1:153484495-153484517 CCTAATTCCCAGAGTGAGGAGGG - Intergenic
915104778 1:153527020-153527042 CCTGAAGGCCAGAGGGTGAATGG + Intergenic
915628892 1:157137080-157137102 CCTTCTGGCCAGTGAGTGGAAGG + Intronic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
916385666 1:164264975-164264997 CCTGATGACTAGAAAGTTGAGGG - Intergenic
917478043 1:175385759-175385781 CCTGAGGCCCATAGTGGGGAAGG + Intronic
918655961 1:187027101-187027123 TCTGATCCCAAGAGGGTGGATGG - Intergenic
919762253 1:201105657-201105679 ACTGAGGCCCAGAGAGAGCAAGG - Intronic
920159587 1:203986114-203986136 CCTGATACCCCTAGAATGGAAGG - Intergenic
920185053 1:204154300-204154322 ACTGAGGCCCAGAGAATGGAAGG - Intergenic
920801646 1:209194051-209194073 GCTGAGGCCCAGAGAGGGCATGG - Intergenic
922216726 1:223526107-223526129 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
922418803 1:225445761-225445783 CCTGAGGCCCAGAGAAGGGATGG - Intergenic
922741004 1:228014205-228014227 CCTGAAGCTCTGAGAGAGGAGGG - Intronic
923414111 1:233738127-233738149 CCTGATGCCCAGAATGTGCTTGG - Intergenic
923473733 1:234314050-234314072 GCTGATGTCCAGAGAGTGGAAGG + Intronic
924486333 1:244487359-244487381 CATCATGCCCAGCCAGTGGAGGG + Intronic
1063315265 10:4998302-4998324 AAAGATGACCAGAGAGTGGACGG - Intronic
1063970599 10:11379000-11379022 GCTGAGGCCCAGAGAGGGCAAGG - Intergenic
1063979700 10:11443767-11443789 CCTGACGCCGAGACCGTGGAAGG + Intergenic
1069625078 10:69862774-69862796 CCTGAGGCCCAGAGAGTTTATGG - Intronic
1069716177 10:70522890-70522912 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
1069716950 10:70527193-70527215 ACTGAGGCCCAGAGAGGGAAAGG - Intronic
1069789656 10:71011545-71011567 TCTAAGGCCCAGAGAGGGGAAGG - Intergenic
1069799306 10:71072390-71072412 GCTGCTGTCCAGACAGTGGAAGG + Intergenic
1069800974 10:71081239-71081261 ACTGAGGCCCAGAGAGGGGACGG + Intergenic
1070774971 10:79104136-79104158 TCTGAGGCCCAGAGAGGGGAGGG - Intronic
1070778797 10:79125813-79125835 ACTGAGGCCCAGAGATAGGAGGG + Intronic
1073079966 10:100853503-100853525 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1073474300 10:103742810-103742832 CCTGAAGCCGAGAGAATGGGGGG + Intronic
1074306928 10:112287679-112287701 CCAGAAGCCCAGAGGGAGGAAGG + Intronic
1074720904 10:116264297-116264319 CTTGAAGCTCAGAGAGGGGAGGG - Intronic
1074859280 10:117498004-117498026 GCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1074869992 10:117568803-117568825 ACTGAGGCCAAGAAAGTGGAGGG + Intergenic
1074882058 10:117667222-117667244 GCTGAAGCCCAGAGAGAGGTTGG + Intergenic
1074975695 10:118579854-118579876 ACTGAGGCCCAGAGAGGGTATGG - Intergenic
1075017280 10:118919255-118919277 AGTGATGCCCAGATAGAGGAGGG + Intergenic
1075592534 10:123703119-123703141 ACCGAGGCCCAGAGAGGGGAAGG + Intergenic
1076531399 10:131147615-131147637 GCCGAGGCCCAGAGAGGGGAGGG - Intronic
1078317178 11:10303707-10303729 CCTGAAGCCCAGCGACTCGACGG - Intergenic
1079015718 11:16867055-16867077 ACTGCAGCCCAGAGAATGGATGG + Intronic
1080555932 11:33417545-33417567 CCAGATGCAGAGACAGTGGATGG - Intergenic
1080681202 11:34477804-34477826 CTTGGTGCCCAGGGAGTGGGAGG + Intergenic
1081636059 11:44723049-44723071 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1082120172 11:48371677-48371699 CCTGATGCCTGTGGAGTGGAAGG + Intergenic
1082254115 11:50013548-50013570 CCTGATGCCTGTGGAGTGGAAGG - Intergenic
1082952162 11:58829007-58829029 ACTGAGGCTCAGAGAGTTGAAGG + Intergenic
1083487768 11:62994410-62994432 CCTGAGCCCCAGAGAGTGCAGGG + Intronic
1083626124 11:64072985-64073007 CCTGCAGCCCAGAGAGGGGTCGG + Intronic
1083660594 11:64250292-64250314 CTTGAGGCCCAGAGAGGGGAAGG - Intergenic
1083718765 11:64593677-64593699 GCTGAAGCCCAGAGAGTTCAAGG - Exonic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1084105330 11:66976891-66976913 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1084264810 11:67999406-67999428 ACTGAGGCCCAGAGGGCGGAAGG + Intronic
1084456542 11:69271043-69271065 CATGATATCCAGAGAGTGGCAGG + Intergenic
1084942495 11:72620438-72620460 ACTGAGGCCCAGAGAGTAGCAGG + Intronic
1085154981 11:74285275-74285297 ACCGAGGCCCAGAGAGGGGAAGG - Intronic
1085201959 11:74707230-74707252 ACTGAGGCCCAGAGAAGGGAAGG + Intronic
1085270023 11:75264777-75264799 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1085463578 11:76709652-76709674 AGTGAGGCTCAGAGAGTGGAAGG - Intergenic
1085619930 11:78030418-78030440 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1085709583 11:78816942-78816964 GGTGAGGCCCAGAGAGGGGAAGG - Intronic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1086941735 11:92805184-92805206 CCTGGTGCAAAGTGAGTGGAAGG + Exonic
1087517538 11:99182605-99182627 GATGATGCCCAGAGGATGGAGGG - Intronic
1088987835 11:114925699-114925721 CCTGGTACCCTGAGAGAGGAAGG + Intergenic
1089100452 11:115958443-115958465 CATGCTGCCCAGGGAGGGGAGGG - Intergenic
1089634768 11:119805049-119805071 GCTTAAGCCCAGAGAGGGGAAGG + Intergenic
1089884237 11:121803858-121803880 CCTATTGCCCAGAAAGTGGGGGG + Intergenic
1091193306 11:133712068-133712090 CCAAATGCACAGGGAGTGGATGG + Intergenic
1091227321 11:133965306-133965328 TCTGAAGCCCAGCGAGGGGAGGG - Intergenic
1091289622 11:134430577-134430599 ACTGAGGCCCGGAGAGGGGAGGG + Intergenic
1091770838 12:3150289-3150311 GCTGATGCCCAGAGAGATTAGGG + Intronic
1091825387 12:3508682-3508704 CATGACGCTGAGAGAGTGGATGG - Intronic
1092954244 12:13534875-13534897 CCAGATGCCCACAGAGGGGCTGG + Intergenic
1094073349 12:26444595-26444617 ACTGAAGCACAGAGAGTGTAAGG + Intronic
1094719865 12:33052663-33052685 CCTTATGCCCCGTGAGGGGATGG - Intergenic
1096181056 12:49550547-49550569 CCTGGGGCCGAGCGAGTGGAGGG + Intronic
1096215042 12:49793888-49793910 ACTGTTGCCCATAGGGTGGATGG - Exonic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1097450810 12:59734455-59734477 CCTGGGCCCCAGAGAGTGCAGGG + Intronic
1097733179 12:63151885-63151907 CCTGATTCCCACAGCGGGGATGG + Intergenic
1100441056 12:94617228-94617250 CCTGATGAACAGAGAGAGAAAGG + Intronic
1101865235 12:108515487-108515509 ACTGAGGCCCGGAGAGGGGAGGG - Intronic
1101875846 12:108596653-108596675 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1101926193 12:108973243-108973265 ACTGAGGGCCAGAGAGGGGAGGG + Intronic
1101960311 12:109244355-109244377 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102157936 12:110745337-110745359 ACTGAGGCCTAGAGAGGGGAAGG - Intergenic
1102167021 12:110814845-110814867 CCAGGTGCCCAGAAAGTGGAAGG - Intergenic
1102466035 12:113131314-113131336 ACTGAGGCCCAGAGAGGGAAGGG - Intronic
1102914745 12:116744485-116744507 GCTGAGGCTCAGAGAGGGGAAGG + Intronic
1103348074 12:120264689-120264711 CCTGACGCAGAGAGGGTGGAGGG + Intronic
1103721549 12:122978169-122978191 CCTGAGGCCCAGAGAGGGGAAGG - Intronic
1105706672 13:22971595-22971617 CCTGAGGCCCAGTGTGGGGATGG + Intergenic
1106402724 13:29445225-29445247 TCTGATGCCCGGGGTGTGGAGGG + Intronic
1106409118 13:29498854-29498876 CCTGATGCCCAGACACTGCACGG + Intronic
1107363847 13:39648917-39648939 CCTGAGGCCCACAGACTGCATGG - Intergenic
1107482310 13:40795033-40795055 CCAGATGCCCAGGGAACGGAAGG + Intronic
1107552784 13:41492845-41492867 TCTGAGGCCCAGAGAGGGGAAGG - Intergenic
1107784164 13:43937671-43937693 ACTGAGGCTCAGAGAGGGGAGGG + Intergenic
1110870930 13:80451970-80451992 CCTGGGTCCCAGAGGGTGGAGGG - Intergenic
1112127016 13:96479323-96479345 ACTGAAGCATAGAGAGTGGAAGG + Intronic
1113358334 13:109604457-109604479 CCTGATGCGCAGAGAGGGCTAGG + Intergenic
1113559791 13:111269585-111269607 AGGGCTGCCCAGAGAGTGGAGGG + Intronic
1115707355 14:36012860-36012882 GCTCATGCCCAGAGAGAGAAAGG - Intergenic
1117637057 14:57754875-57754897 ACTGAAGCCCAGAGAGGGAAAGG + Intronic
1118670751 14:68124004-68124026 TCTGATGCACAGAGAGTCCAGGG - Intronic
1118743727 14:68759245-68759267 ACTGATGCCCAGAGAGGTAAAGG + Intergenic
1119439933 14:74621434-74621456 TCTGAGGCCCAGGGAGGGGAAGG - Intergenic
1119617120 14:76106157-76106179 GTTGATGCACAGAGAGGGGAGGG - Intergenic
1120408587 14:84121040-84121062 CCTGAAGCCCACAAGGTGGAGGG + Intergenic
1121664677 14:95663426-95663448 ACCGAAGCCCAGAGAGTGGATGG + Intergenic
1121727113 14:96160847-96160869 CCTGGAGCCCAGAGATTGAATGG + Intergenic
1121739081 14:96238837-96238859 ACTGTGGCCCAGAGGGTGGAGGG - Intronic
1121942347 14:98083104-98083126 CCTGAGAACCAGAGAGTTGATGG - Intergenic
1122067172 14:99181807-99181829 CCTGAAGTCCAGAGTGGGGAAGG - Intronic
1122129851 14:99598637-99598659 CCTGCTGCCCAGAGAGTTCCAGG - Intronic
1122156639 14:99754062-99754084 ACTGAGTCCCAGAGAGGGGAAGG - Intronic
1122306428 14:100769532-100769554 GCTGATGCCCAGGAAGTGGCGGG - Intergenic
1122429910 14:101634005-101634027 CCTGAAGCTCAGAGAGGTGAAGG - Intergenic
1122794106 14:104197130-104197152 GGTGAGGCCCAGAGAGGGGAAGG - Intergenic
1122829616 14:104389413-104389435 GCTGATGCCCAGAGAGATGTGGG + Intergenic
1123954718 15:25323427-25323449 TCTGAAGCACAGAGAGGGGATGG - Intergenic
1125845618 15:42850230-42850252 CCTAATGCCCAGAGAAAGCATGG - Intronic
1126419743 15:48459028-48459050 ACAGAGGCCCAGAGAGGGGAAGG - Intronic
1127385011 15:58460160-58460182 GCCGAGGCCCTGAGAGTGGAAGG - Intronic
1127661461 15:61103554-61103576 CCTGGTGCCCACAGAGTGTCTGG + Intronic
1127901694 15:63345719-63345741 CCTGGAGCCCAGAGAGAGGCAGG + Intronic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128336288 15:66787647-66787669 ACTGAGGCCCAGAGAGGGCAGGG + Intergenic
1128413163 15:67419184-67419206 ACTGAAGCTCAGAGATTGGAGGG + Intronic
1128721889 15:69956133-69956155 CTTGATGCCCACAGTGTGCAAGG - Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129467697 15:75733103-75733125 GCTGATGCCCAGAGAAAGGAGGG + Intergenic
1129523549 15:76200401-76200423 ACTGAGGCCCAGAGAGGGGATGG + Intronic
1129659068 15:77543065-77543087 ACTGAGGCCCAGAGAGAGGCAGG - Intergenic
1129719516 15:77870488-77870510 GCGGATGCCCAGAGAAAGGAGGG - Intergenic
1129851309 15:78795484-78795506 CCTGAGGCTCAAAGAGAGGAAGG - Intronic
1130306265 15:82713995-82714017 GTTGAGGCCCAGAGAGAGGAAGG - Intergenic
1131153134 15:90059423-90059445 ACTGAGGCCCAGGGAGGGGAAGG - Intronic
1131266009 15:90915851-90915873 CCTGAGTCCCAGAGCGTGGGGGG + Intronic
1131908389 15:97169207-97169229 GCTGAGGCCCAGAGAGGAGATGG + Intergenic
1132299606 15:100767827-100767849 GCTGAAGCTCAGAGAGTGGCAGG + Intergenic
1133317015 16:4891179-4891201 CCTCATGACCAGACAGTGGCAGG - Intronic
1133430975 16:5736491-5736513 CCTGCTTCCCAGTGAGAGGAGGG + Intergenic
1133483960 16:6200252-6200274 CCTAATGACAAGAGGGTGGACGG + Intronic
1133607948 16:7406453-7406475 CCTGTGGCCCAGAGGGTGGATGG + Intronic
1133843919 16:9436766-9436788 CCTGAACCCCAGAGAGTGAGTGG - Intergenic
1134426420 16:14151760-14151782 ACTGATGCCCAGAGAATGCTAGG - Intronic
1134827291 16:17294823-17294845 CCTGGTGTCCAGACAGTGCATGG + Intronic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1137253748 16:46758684-46758706 TCTGACGCCCAGAGATGGGAAGG + Intronic
1137384668 16:48030326-48030348 GCTGAGGCCCAGAGAGGTGAAGG - Intergenic
1137445836 16:48531663-48531685 CCTGACACCCAGAGAAGGGAAGG + Intergenic
1137547164 16:49412137-49412159 GCTGATGCCCAGAGAAGGGAAGG + Intergenic
1137726180 16:50658239-50658261 GCTGAGGCCCAGAGAGGGAAAGG - Intergenic
1137876580 16:52002424-52002446 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1138429995 16:56962546-56962568 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1138476612 16:57273917-57273939 CCTCAGGCCCAGAGAGAGAAAGG - Intronic
1138515942 16:57535741-57535763 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1138519527 16:57563165-57563187 CTTGAAGGCCAGAGACTGGATGG - Exonic
1140409769 16:74734614-74734636 CCTGCTGCCCAGAGGGTGGGCGG + Intronic
1141422591 16:83926375-83926397 ACTGAGGCCCAGAGAGCTGAAGG + Exonic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142325931 16:89414631-89414653 ACTGAGGCTCGGAGAGTGGAAGG + Intronic
1142407082 16:89896216-89896238 CCTTAAGCCCAGAGAGAGGAAGG - Intronic
1143615394 17:8046446-8046468 CCTGAGGCTCAGGGAGAGGAAGG + Intronic
1143921782 17:10336082-10336104 ACTGAGGCCCAGAGAGGTGAAGG + Intronic
1144441775 17:15289504-15289526 CCTGGGTCCCAGAGTGTGGAAGG + Intergenic
1144761285 17:17709032-17709054 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1145018162 17:19412160-19412182 ATTGAGGCCCAGAGAGGGGAAGG + Intronic
1145695176 17:26781933-26781955 ACTGAGGCCTAGAGAGTGAAGGG - Intergenic
1145885047 17:28376225-28376247 CCTGAGGCCCAGCGAAGGGAAGG - Intronic
1146260152 17:31415657-31415679 ACTGAGGCCGAGAGAGGGGAAGG + Intronic
1147006187 17:37406329-37406351 TCTGAAGCCCAAAGAGGGGATGG + Intronic
1147161527 17:38571964-38571986 CCTCATGCCCTGGGAGGGGAGGG + Intronic
1147689558 17:42307064-42307086 ACTGAGGCACAGAGAATGGATGG - Intronic
1148049664 17:44763497-44763519 CCTGAGGCCCAGAGAAGTGAGGG + Intronic
1148431741 17:47649180-47649202 ACTGAAGCCCAGAGAGGGTATGG - Intergenic
1148438747 17:47701022-47701044 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1148841662 17:50502680-50502702 CCTTCTGCCCAGAGCGAGGATGG + Intergenic
1148957465 17:51365568-51365590 GCTGGTGCCCAGAGAGAGAAAGG - Intergenic
1149576205 17:57715402-57715424 ACTGAGGCTCAGAGAATGGAAGG + Intergenic
1150444333 17:65216963-65216985 CTTGAGGGCCAGAGAGTGGATGG + Intronic
1150638216 17:66931409-66931431 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
1150959700 17:69900171-69900193 ACTGTTGCCCATAGTGTGGAAGG + Intergenic
1151340330 17:73466874-73466896 ACTGAGGTCCAGAGAGGGGAAGG + Intronic
1152098444 17:78286749-78286771 ACTGCTGCCCAGTGAGTGGCGGG - Intergenic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152277223 17:79364900-79364922 CCTGGTGCCCAGGGAGTGGCTGG + Intronic
1152737425 17:82004336-82004358 CCAGATGCCCCGAAACTGGAAGG - Intronic
1152899113 17:82929852-82929874 CCTGGAGCCCTGAAAGTGGAGGG - Intronic
1153366686 18:4265018-4265040 TCTGATGCACAGAGAAAGGAAGG - Intronic
1154324526 18:13380277-13380299 CCTGATTCCCAGCGAGCGGCTGG + Intronic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155532937 18:26785944-26785966 CCTGATGCACTAAGCGTGGAAGG + Intergenic
1157964242 18:52190197-52190219 ACTGAGGCCCAGAGAGGGCAAGG - Intergenic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1158157763 18:54444490-54444512 CCTGACGCCCAGAGACAGGGTGG - Intergenic
1160455652 18:78997165-78997187 CATGCTGCCCAGAGGGGGGAGGG - Exonic
1160688133 19:446808-446830 ACCGAAGCCCAGAGAGGGGATGG + Intronic
1160750960 19:734234-734256 TCTGGTGGCCAGAGAGGGGATGG + Intronic
1160775877 19:855489-855511 ACTGAGGCCCGGAGAGGGGAGGG + Intronic
1160798579 19:956797-956819 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1160970484 19:1765738-1765760 CCTGATGTCCAGAGAGGCCAGGG + Intronic
1161232278 19:3180240-3180262 ACTGAGGCCCAGAGAGGGGCCGG - Exonic
1161272630 19:3398473-3398495 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1162524968 19:11201720-11201742 CCAGATCCCCAGGGAGGGGAGGG - Intronic
1163450304 19:17373264-17373286 CCAGATGCCCAGAGTATGGTAGG - Intronic
1163502594 19:17685940-17685962 GATGGTGCCCAGAGAGGGGAGGG - Intronic
1163600862 19:18248289-18248311 CCTGGTGCCCAGACAGTTAAGGG - Intronic
1164588142 19:29490426-29490448 ACTGAAGCCCAGAGAGGGGACGG + Intergenic
1164852859 19:31499349-31499371 CCTGCAGCCCAGAGAGGTGAAGG - Intergenic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1165314780 19:35048116-35048138 GCTGAGGCTCAGAGAGGGGAGGG + Intronic
1165900148 19:39165728-39165750 ACTGAGGCCCAGAGAAGGGAAGG - Intronic
1166114224 19:40642957-40642979 GCTGAGGCTCAGAGAGAGGAAGG + Intergenic
1166119185 19:40674727-40674749 ACTGGAGCCCAGAGAGGGGAGGG - Intronic
1166225310 19:41391487-41391509 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166311071 19:41962942-41962964 ACTGAGGCCCAGAGACGGGAGGG - Intergenic
1166354630 19:42219631-42219653 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166359402 19:42246604-42246626 CCTGAGGCCCAGAAAGGGGAAGG - Intronic
1166390795 19:42407777-42407799 CATGTTGGCCAGAGACTGGAGGG + Exonic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
1166797506 19:45436160-45436182 ACTGAGGCTCAGAGAGAGGATGG - Intronic
1166873274 19:45883397-45883419 ACTGAGGCTCAGAGAGGGGATGG - Intergenic
1167029480 19:46947964-46947986 CCTGGTGCCCAGGGAGGGCATGG - Intronic
1167084535 19:47300217-47300239 CCTCGTGCCAAGGGAGTGGAGGG + Intronic
1167281801 19:48573548-48573570 GCTCAGGCCCAGAGAGTGGCAGG + Intronic
1168591955 19:57643751-57643773 CTTGAGGGCCAGAGAGGGGAGGG - Intergenic
925295721 2:2775387-2775409 GCTGATCCCCAGACAGTGTATGG + Intergenic
927158280 2:20234905-20234927 CCTGATGCACACAGCTTGGATGG - Intergenic
927198316 2:20563295-20563317 ACTGAGGCCCAGAGAGGGAAGGG + Intronic
927717118 2:25360077-25360099 GCTCTTGCCCAGAGAGTGGCAGG + Intergenic
927811416 2:26182537-26182559 CCAGAGGCCCAGAGAGGGAAAGG + Intronic
927870499 2:26619959-26619981 CCTGAAGCCCACAGCGGGGAAGG + Intronic
927881773 2:26694159-26694181 CCTGAGACCCAGACAGGGGAAGG - Intronic
929696912 2:44125323-44125345 ACTGATCCCCAGAGAGATGAGGG + Intergenic
930005475 2:46892779-46892801 CCTGCTGCCCAGGGAGGGGAGGG - Intergenic
932398359 2:71463369-71463391 CCTGGGCCCCAGAGAGTGCAGGG + Intronic
932592057 2:73073588-73073610 CCTAATGCCCAGGGCATGGATGG - Exonic
933760681 2:85669920-85669942 CATGAAGCCCATAGACTGGAGGG - Intergenic
934504594 2:94880458-94880480 TCTGATGCCCAGGGAGGGAAGGG + Intergenic
934538426 2:95155928-95155950 CCTGAAGCTCAGAGAGAAGAGGG + Intronic
936721715 2:115259163-115259185 CCTGGTGCCCAAAGGGAGGAAGG + Intronic
937426653 2:121805552-121805574 ACTGGGGCCCAGAGAGGGGAGGG + Intergenic
940377383 2:152971254-152971276 CCTGAAGGCCAAAGAGTGAATGG - Intergenic
940789826 2:158020430-158020452 CCTCAAGTCCAGAGACTGGACGG + Intronic
941696761 2:168561195-168561217 CCTGATGAAAAGAGATTGGAAGG + Exonic
941925583 2:170891200-170891222 CCTGATACCCAGAGAAAGGCAGG + Intergenic
942220738 2:173766742-173766764 AATGATGCCCTGAGACTGGAGGG + Intergenic
943258611 2:185629494-185629516 CCTTTTGCACAGAGAGAGGAAGG + Intergenic
944280055 2:197885476-197885498 GCTGATGCCCACAGTGGGGAGGG + Intronic
945049087 2:205806483-205806505 CCTGATGCCCAGAAGGCTGAGGG - Intergenic
946026841 2:216676975-216676997 TCTCATCCCCAGAGAGTTGAGGG + Intronic
946065746 2:216985862-216985884 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
946269361 2:218577607-218577629 CCTGATGCCCACAGAGAAGATGG - Intronic
946409532 2:219509222-219509244 CCTGCTTCCCAGAGAGGGGGAGG - Intergenic
947054892 2:226088444-226088466 CCTGAACCCCTGAGAGTGCAAGG + Intergenic
947158288 2:227185934-227185956 GGTGATGCCCAGAGAGAGGCAGG - Intronic
947870678 2:233436178-233436200 CCTGATGGCCAGTGAGGGAAGGG - Intronic
948941660 2:241199909-241199931 CCTGAGGCCCTGAGAGGGGAAGG + Intronic
1168886800 20:1266005-1266027 GCTGAGGCCCAGAGAGGTGAAGG + Intronic
1168954225 20:1823569-1823591 CCTGAGGCTCAGAGAGGGCAGGG + Intergenic
1168955293 20:1830268-1830290 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1168973909 20:1949888-1949910 CCCGCTGCTCAGAGAGTGGTGGG - Intergenic
1169026343 20:2374801-2374823 ACAGAGGCCCAGAGAGGGGAAGG + Intergenic
1169282890 20:4281909-4281931 GCTGATGTCCAGTGAGTGGTGGG + Intergenic
1169309251 20:4521382-4521404 CCTGGGCCCCTGAGAGTGGAGGG - Intergenic
1170613641 20:17933057-17933079 CCTGACGCTCTGAGAGTTGAGGG - Intergenic
1171071549 20:22073502-22073524 CCAGATGCACAGACAGTGGTAGG - Intergenic
1171986435 20:31664628-31664650 GCTGGTGCCCGGAGATTGGACGG - Exonic
1172098637 20:32472962-32472984 CCTGCTGCCCAGAGGCTGGCTGG - Intronic
1172505058 20:35455364-35455386 CCCGAGGCCCAGAGAGGGGCTGG + Exonic
1172594293 20:36139657-36139679 ACTGAGACCCAGAGAGGGGAAGG - Intronic
1172842736 20:37911758-37911780 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1173154082 20:40593244-40593266 ACTGATACCCAGAGAATGAAAGG + Intergenic
1173334467 20:42101531-42101553 CCTGATGACAAGAAAGTGGGGGG + Intronic
1173647894 20:44644946-44644968 ACTGAGGCTCAGAGAGTGGGAGG + Intronic
1173721356 20:45260859-45260881 ACTGAGGCCCAGAGAAAGGAAGG - Intergenic
1173902106 20:46598445-46598467 ACTGAGGCCCAGAGAAGGGAAGG + Intronic
1173978830 20:47207502-47207524 CCTGAAGACCAGAGAAAGGAGGG - Intergenic
1174430362 20:50464050-50464072 TTTGATGCCCAGAAAGTGCATGG - Intergenic
1174605612 20:51759232-51759254 CCTCCAGCCCAGAGAGGGGAAGG + Intronic
1174616228 20:51837674-51837696 GCTGTTGCCCAGACAGTGGCAGG - Intergenic
1175769010 20:61611210-61611232 TCTGATCCCCAGGGAGAGGAAGG - Intronic
1175920333 20:62447671-62447693 ACTGAGGCCCAGAGACTTGAAGG - Intergenic
1175965841 20:62659864-62659886 CTGGATGCCCAGAGCTTGGATGG + Intronic
1177318595 21:19492724-19492746 CCTGTTGCCTGGAGAGTGAAAGG + Intergenic
1179465379 21:41568230-41568252 CCTGCTGCCCAGACAGTGCCTGG - Intergenic
1180092476 21:45540133-45540155 CCTGATGCCCAGAGAGGCCACGG + Intronic
1180618262 22:17143035-17143057 CCTGAGGGCCAGAGAGGAGACGG + Intronic
1180725769 22:17945614-17945636 CCTACTGCCCAGGGAGGGGAGGG + Intronic
1180840558 22:18957037-18957059 CCTGATGCGCAGGCAGTGGCTGG + Intergenic
1182024592 22:27108133-27108155 GCTGAGGCCCAGAGAGGGAAGGG - Intergenic
1182043965 22:27259915-27259937 ACTGAGGCCCAGAGAAGGGAGGG - Intergenic
1182097915 22:27638402-27638424 GCTGAGGCCCAGAGAGGGGTTGG + Intergenic
1182100476 22:27654345-27654367 ACTGAGGCCCAGAGAGGGAAAGG + Intergenic
1182351539 22:29702737-29702759 ATGGAAGCCCAGAGAGTGGAAGG - Intergenic
1182475227 22:30573517-30573539 CCTGAGGCCCAGAGAGGGTGAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182735453 22:32529633-32529655 ACTGAGGCCCAGAGATGGGAGGG + Intronic
1182785590 22:32905020-32905042 ACTGAAGCTCAGAGAGGGGAAGG - Intronic
1183210707 22:36449623-36449645 GCTGAGGCCCAGAGATGGGAAGG - Intergenic
1183346901 22:37313029-37313051 ACTGAGGCCCAGAGATGGGAGGG + Intronic
1183347358 22:37315223-37315245 GCTGAGGACCAGAGAGGGGAAGG - Exonic
1184034656 22:41912749-41912771 CCTGAAGCCCAGAAAGGAGAAGG + Intronic
1184739796 22:46421229-46421251 CCAGGAGCCCAGAGAGGGGAGGG + Intronic
1185011144 22:48315400-48315422 CCTGGAGCCCAGAGAGAGAAAGG + Intergenic
1185422074 22:50740347-50740369 ACCAAGGCCCAGAGAGTGGAAGG - Intronic
949879107 3:8647982-8648004 CCTGGCTCCCAGAGAGAGGAGGG - Intronic
950098134 3:10342033-10342055 ACAGAGGCCCAGAGAGGGGAAGG - Intronic
950195664 3:11007511-11007533 GCTGAGGCACAGAGAGGGGAAGG + Intronic
950269311 3:11600981-11601003 CCAGCTGCCCAGAGAGTCTACGG - Intronic
950432125 3:12956834-12956856 ACAGAAGCCCAGAGAGTGGAGGG - Intronic
950451925 3:13070267-13070289 ACTGAGGCTCAGAGAGGGGAAGG - Intronic
950463944 3:13142264-13142286 GCAGAAGCCCAGAGAGGGGAAGG + Intergenic
950535981 3:13578427-13578449 CATGATTCCCAGAGAGTCCAGGG - Intronic
950563066 3:13746949-13746971 ACTGAGGCCAAGAGAGGGGACGG + Intergenic
952052246 3:29398394-29398416 CCTGATGACCAGAGAGAAAAAGG - Intronic
952961820 3:38596856-38596878 ACTGAGGCCCAGAGACAGGAGGG - Intronic
953235138 3:41099914-41099936 CCTGATGCTCTGTGAGTAGAAGG - Intergenic
953418486 3:42736445-42736467 ACTGAGGCCCAGAGAGTCCAAGG + Intronic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
953875363 3:46663592-46663614 CCTGATGTCCAGAGAGTTCTTGG + Intergenic
954275422 3:49538886-49538908 ACTGAGGCCCAGAGAGGGCAAGG + Intergenic
954681536 3:52348753-52348775 CCTGAAGCCTAGAGGGTGGCAGG - Intronic
955596118 3:60592581-60592603 CCTGCTGCCCAGGCAGTGAATGG - Intronic
956046109 3:65197739-65197761 CCAGTTTCCCACAGAGTGGATGG + Intergenic
959497222 3:107065492-107065514 CCTGCTGCCGAGGGAGGGGAAGG - Intergenic
960619015 3:119621466-119621488 CATGATGGCCTGAGAGTGGCTGG - Intronic
961518686 3:127454785-127454807 ACTGAGGCCCAGAGAGCCGAAGG - Intergenic
961781470 3:129323254-129323276 CCTGATCCCCAGGGAGGGGTGGG - Intergenic
961811663 3:129525463-129525485 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
962383105 3:134912661-134912683 CCTGATGGCCTGGGAGTGGGTGG + Intronic
962843917 3:139258937-139258959 ACTGAGGCCCAGAGAGGGAAAGG - Intronic
966257084 3:177929384-177929406 CCTTCTGGCCAGTGAGTGGATGG + Intergenic
966785620 3:183620147-183620169 ACTGAGGCCCAGTGAGTGGAAGG - Intergenic
966918516 3:184597769-184597791 ACTGAGGCCCAGGGAGAGGAGGG - Intronic
966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG + Intronic
969615720 4:8251620-8251642 GCTGAGGCCCAAAGAGGGGAAGG + Intergenic
969702579 4:8775873-8775895 CCTGAGGCCAGGGGAGTGGAGGG + Intergenic
969703432 4:8780031-8780053 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
970565900 4:17332653-17332675 CATGATGCCAGGAGAGTGGAGGG + Intergenic
970610481 4:17721035-17721057 CCAGATCCCCAAAGAGTGGCTGG + Intronic
970992197 4:22225317-22225339 TCTGGTGCCCAGGGAGGGGAAGG + Intergenic
971981534 4:33757676-33757698 CATGTTTCCCAGAGACTGGAAGG + Intergenic
972322870 4:37988862-37988884 CCTGAATTCCAGAGAGAGGAAGG - Intronic
974564208 4:63563325-63563347 CCTGTTGCTCAGTGAGTGGAAGG + Intergenic
975983845 4:80185563-80185585 CCTCATGCACAGAGTGTGGTTGG + Intronic
977084268 4:92574649-92574671 CCTAAAACCCAGAGATTGGAGGG - Intronic
977115273 4:93016544-93016566 CCAACTGCCCAGAGAGGGGATGG - Intronic
978903852 4:113983615-113983637 CTGGATGCCCAGAGGTTGGAGGG + Intergenic
979455133 4:120918797-120918819 ACTGAAGCCCAGAGAGTTGCAGG - Intronic
980032822 4:127850157-127850179 CCTGATGCCTAGTGTGTTGAGGG - Intergenic
981685909 4:147454706-147454728 CCTGATGCACTGAGGGTGCAAGG - Intergenic
982274047 4:153621828-153621850 CCTGCTGCCCAGAGAGAGGCAGG + Exonic
982592144 4:157326901-157326923 CCTGATGACAAGAGATTGCAGGG + Intronic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
984684905 4:182656431-182656453 CCTGGGGCACAGGGAGTGGACGG + Intronic
985525588 5:399814-399836 CCGGATGGCCACAGAGTGGGAGG - Intronic
986376651 5:7138949-7138971 CCTGATGACCACAGAGAGGCTGG - Intergenic
986641763 5:9878945-9878967 CCTGAAGGCCAGTGAGTGCAGGG + Intergenic
986751516 5:10792167-10792189 GCTGAAGCCCAGAGCATGGATGG - Intergenic
992908392 5:81370820-81370842 CTTCATGCCCAGAGATTGAAGGG + Intronic
993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG + Intergenic
994046742 5:95318641-95318663 ACTGATGCTCAGAGAAAGGAAGG + Intergenic
996708774 5:126523403-126523425 TCTGATGCACAGAGAGAGGATGG - Intergenic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
998154443 5:139776403-139776425 CCTGAGGCCCAGAGAGGAGCAGG + Intergenic
998374220 5:141680710-141680732 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
998391070 5:141787285-141787307 TTTGAGGCCCAGACAGTGGAAGG - Intergenic
999240690 5:150125672-150125694 CCTGAGGCCCAGAGAGGGGCAGG + Intronic
999246974 5:150160242-150160264 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
999281316 5:150368069-150368091 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
999363677 5:151007120-151007142 ACTGAAGCTCAGAGAGTGAAGGG - Intergenic
999443002 5:151616970-151616992 ACTGAGGCCCAGAGAGGGAAAGG - Intergenic
1000480129 5:161763188-161763210 CTTAATGACCAGAGAGTGGGGGG - Intergenic
1001152148 5:169241178-169241200 TCTGGTTGCCAGAGAGTGGATGG - Intronic
1001253754 5:170168124-170168146 ACTGAAGCCCAGAGAGAGGAAGG - Intergenic
1001826126 5:174746474-174746496 ACTGAGGCCCAGATAGGGGAAGG + Intergenic
1001949952 5:175809347-175809369 ACTGAAGCTCAGAGAGTGAAAGG + Intronic
1001974339 5:175984573-175984595 CCTGCTTCCCAGAGAATGGGTGG + Intronic
1002243095 5:177859206-177859228 CCTGCTTCCCAGAGAATGGGTGG - Intergenic
1002296372 5:178233311-178233333 CCTGAAGCCCAGAAAGGGAAAGG + Intergenic
1002514893 5:179750421-179750443 CCTAGGGCCCAGAGAGTGGCTGG + Intronic
1003082975 6:3037255-3037277 CCTGAAGGCCAAAGAGTGAATGG + Intergenic
1003308179 6:4947160-4947182 CCTGACGCCAGGAGAGGGGATGG + Intronic
1004962223 6:20802792-20802814 CCTGAAGGCCAGTGAGTGGGTGG + Intronic
1005898092 6:30195477-30195499 ACTGAGGTCCAGAGAGTGGGAGG - Intronic
1006368985 6:33632986-33633008 AGTGAGGCCCACAGAGTGGATGG - Intronic
1006379518 6:33689358-33689380 CCCGATGCCCAGATAGTAGATGG - Exonic
1006922108 6:37633889-37633911 GCTGAAGCCCAGAGTGGGGAAGG - Exonic
1007081358 6:39107301-39107323 CCTGATGCCCAGGGAGGTCAGGG - Intronic
1007299684 6:40857463-40857485 CCTGAGGCCCAGGGAGATGAAGG + Intergenic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1007476701 6:42124117-42124139 CCAGAGGCCCAGGGAGAGGAAGG + Intronic
1007514276 6:42398990-42399012 ACTGAGGCCCATAGAGGGGATGG - Intronic
1007627275 6:43253668-43253690 CAGGAAGCCCACAGAGTGGATGG - Exonic
1007821889 6:44566482-44566504 CCTGATGACCAGAGAGTAATGGG - Intergenic
1008118944 6:47587982-47588004 TCTGATTCCCAGTCAGTGGATGG + Intronic
1010041341 6:71388536-71388558 CAGGATCCCTAGAGAGTGGAAGG + Intergenic
1010808719 6:80271438-80271460 GCAGATGGCCACAGAGTGGATGG - Intronic
1011149099 6:84249350-84249372 CCTGAGGGTAAGAGAGTGGAGGG - Intergenic
1013380364 6:109563225-109563247 TCTGATGCCAAGGGAGTGGATGG + Intronic
1014158116 6:118135677-118135699 TCTGCTGCCCAGAGAGTGAAGGG + Intronic
1016881964 6:148920436-148920458 TCTGATGCCCTGAGGATGGAGGG + Intronic
1017602097 6:156094801-156094823 CTAGAAGCCCAGAGAGTGGAGGG - Intergenic
1018321818 6:162618885-162618907 TCTGATGCCCTGAGAGAGTATGG - Intronic
1018683285 6:166282534-166282556 CCTGGTGCCCAGAGAATGAGCGG + Intergenic
1018771188 6:166972846-166972868 CCTGAAGGCCAAAGAGTGAATGG - Intergenic
1019313185 7:372717-372739 CCTGATGCCCAGGGGGTCGAGGG - Intergenic
1019475664 7:1242908-1242930 GCAGAGGCCCAGAGAGGGGAAGG + Intergenic
1019485761 7:1288551-1288573 TCCGGTGCCCAGAGAGGGGAGGG + Intergenic
1019570741 7:1710896-1710918 CTTGAAGCCCAGAGAAGGGAAGG + Intronic
1019572965 7:1721871-1721893 ACTGAAGACCAGAGAGGGGAAGG - Intronic
1019696751 7:2450590-2450612 CCTGTTCCCCAGGGAGTGGGGGG - Intergenic
1020149783 7:5673095-5673117 CCGGAGGTCCAGAGAGTGGTGGG - Intronic
1020286141 7:6682632-6682654 CTTGATGACCAGAGACTGGGGGG + Intergenic
1022459714 7:30594096-30594118 CCTCCTGCCCAAAGGGTGGAGGG - Intergenic
1022476060 7:30710669-30710691 AGTGAGGCCCAGAGAGGGGAAGG + Intronic
1023037562 7:36146941-36146963 CCTTATAGCCAGAGAGTGGCTGG - Intergenic
1023993128 7:45142041-45142063 TCTGAGACCCAGAGAGGGGACGG - Intergenic
1025189650 7:56886921-56886943 CCCCATGCCCAGCAAGTGGAGGG + Intergenic
1025682288 7:63689996-63690018 CCCCATGCCCAGCAAGTGGAGGG - Intergenic
1026868760 7:73838296-73838318 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1026972199 7:74475381-74475403 ACTGGGGCCCAGAGAGGGGAAGG + Intronic
1029609070 7:101617025-101617047 ACTGAAGCCCAGAGAGAGGAAGG + Intronic
1030548864 7:110933218-110933240 CCAGATGCCCAAATACTGGAGGG + Intronic
1030617915 7:111757599-111757621 CCTTGTGCCCAGAGATTTGATGG - Intronic
1033514198 7:142090079-142090101 CCTGAGGCCCAGTGTGTGGGTGG + Intronic
1035068462 7:156124416-156124438 CCTGAGGCCCAGGGAGGGCATGG - Intergenic
1035764969 8:2098536-2098558 ACTGAGGCCCAGAGAGGCGACGG - Intronic
1036434583 8:8722031-8722053 ACTGAAGTCCAGAGAGAGGAAGG - Intergenic
1036781680 8:11651980-11652002 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
1037293956 8:17381340-17381362 CCTGACGCCCAGGCAGTGAAGGG - Intronic
1037799932 8:22027201-22027223 CCTCATGCACTGAGGGTGGAGGG + Intronic
1037884047 8:22586985-22587007 CCTGAGGCCCAGGGAGAGGAAGG - Intronic
1038447186 8:27612192-27612214 GCTGAAGCCCAGAGAGGGCATGG + Intronic
1038741801 8:30223129-30223151 CTAGATGCCCAGGGAGAGGAAGG - Intergenic
1039411662 8:37360078-37360100 ACTGAGGTCCAGAGAGGGGAAGG - Intergenic
1039494695 8:37972152-37972174 CCTGAGGCCCAGAGAGGAAATGG + Intergenic
1040747635 8:50664600-50664622 CATGGTGCCCAGAGAGATGAGGG - Intronic
1041083576 8:54236282-54236304 ACCGATGCCCAGTGAGTGGAAGG + Intergenic
1042773184 8:72400834-72400856 CCTGATGAAGAAAGAGTGGATGG + Intergenic
1043259621 8:78180262-78180284 CCTGACGCCCAGTGAGTTAATGG - Intergenic
1045034943 8:98169583-98169605 ACTGAGGCTCAGAGAGTGGAAGG - Intergenic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1046694699 8:117326691-117326713 ACTGAAGCTCAGAGAGTGTAAGG - Intergenic
1047511646 8:125520427-125520449 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1047973441 8:130106883-130106905 CCTGGAGCCCTGAGAGTGGGAGG + Intronic
1048359981 8:133689412-133689434 AGTGAAGCCCAGAGAGAGGAAGG + Intergenic
1049203009 8:141350985-141351007 ACTGAGGCCCAGAGAGGGGCAGG + Intergenic
1049293620 8:141817783-141817805 CCTGATGCCCTGAAAGTGTTTGG - Intergenic
1049435553 8:142584626-142584648 CCTGAAGTCCACAGAGGGGATGG + Intergenic
1050119069 9:2289364-2289386 GCTGATGCCCAGAGAGGCGAGGG - Intergenic
1052851360 9:33380383-33380405 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
1052964586 9:34329921-34329943 ACTGAGGCCCAGGGAGGGGAAGG - Intronic
1053268032 9:36730132-36730154 ACCAATGCCCAGAGAGGGGAAGG - Intergenic
1055530405 9:77177778-77177800 CCAGATGCCCAGAGAGAGCTGGG - Exonic
1056301896 9:85250292-85250314 CCTGAAGCCCTGTGAGTAGAGGG - Intergenic
1056492289 9:87119773-87119795 GGTGCTGCCCAGAGCGTGGAGGG - Intergenic
1057103465 9:92387628-92387650 CTTGATGCCCACATGGTGGAAGG - Intronic
1057506869 9:95641811-95641833 ACTGATGCCCAGAGAGGCTAAGG + Intergenic
1057748691 9:97772595-97772617 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
1057802596 9:98199238-98199260 ACTGAGGGCCAGAGAGGGGAAGG + Exonic
1057892917 9:98882690-98882712 CCTGAGGCCCAGAGAGGGTCAGG + Intergenic
1057899072 9:98933609-98933631 ACTCATGCCCAGAGAGAAGAAGG - Intergenic
1057904525 9:98973944-98973966 CCTGAGGCTCAGAGAAGGGAAGG + Intronic
1057936246 9:99241530-99241552 ATTGAGGCCCAGAGAGGGGAAGG + Intergenic
1057954970 9:99400279-99400301 GCTGGGGCCCAGAGAATGGAAGG - Intergenic
1058380238 9:104369928-104369950 CATGTTGCCCAGAGACTTGATGG + Intergenic
1058680032 9:107432577-107432599 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1058734247 9:107879437-107879459 ACTGAGGCCCAGAGGGTTGAGGG + Intergenic
1058959271 9:109977767-109977789 GCTGATACCCAGAGAGAGGCAGG - Intronic
1059370032 9:113822763-113822785 CCTGAAAACCAGAGAGTGAATGG - Intergenic
1059422619 9:114201648-114201670 ACTGAAGCTCAGAGAGGGGAAGG - Intronic
1059433255 9:114262265-114262287 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1059464928 9:114462432-114462454 ACTGAGGCCCAGGGAGAGGAAGG + Intronic
1059637625 9:116186380-116186402 GCTGAGTCCCAGAGAATGGAAGG - Intronic
1059739232 9:117133468-117133490 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1060044437 9:120328485-120328507 CTTGACGCCAAGAGAATGGAAGG + Intergenic
1060047413 9:120351686-120351708 GCTGAGGCCCAGAGAGTTTAAGG + Intergenic
1060055082 9:120406396-120406418 ACAAAGGCCCAGAGAGTGGATGG - Intronic
1060177260 9:121506168-121506190 TTTGCTGCCCAGTGAGTGGAAGG + Intergenic
1060298109 9:122356668-122356690 ACTGAGACCCAGAGACTGGAGGG - Intergenic
1060519435 9:124285968-124285990 ACTGAGGCCCAGAGAGGGCAAGG + Intronic
1060870657 9:127037363-127037385 CCTGAGACCCAAAGAGAGGAGGG - Intronic
1061141242 9:128768475-128768497 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1061151056 9:128828582-128828604 ACTGAGGCCCAGAGAAGGGAGGG - Intronic
1061211387 9:129195410-129195432 ACTGAGGCCCAGAGAGGGGGGGG + Intergenic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061407828 9:130402559-130402581 ACTGAGGTCCAGAGAGTGGAAGG + Intronic
1061422562 9:130480177-130480199 ACTGAGGCCCAGAGAGAGCAGGG - Intronic
1061488345 9:130931709-130931731 ACTGAGGCCCAGAGAGGGCAAGG + Intronic
1061499451 9:130993642-130993664 CCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1061680247 9:132239517-132239539 CCAGTTGCCCAGAGAGGGAAGGG - Intronic
1061680500 9:132240617-132240639 CTAGTTGCCCAGAGAGGGGAAGG + Intronic
1061765032 9:132876179-132876201 GCTGAGGCCCAGAGAAGGGAAGG - Intronic
1061766396 9:132884161-132884183 ACTGGGGCCCAGAGAGGGGAAGG + Intronic
1061839032 9:133347186-133347208 CCTGCCGCGCAGAGACTGGAGGG - Exonic
1062024617 9:134334625-134334647 ACTGAAGCCCACAGAGGGGAAGG - Intronic
1062150570 9:135016597-135016619 TCTGATGCCTAGGGAGTAGAAGG - Intergenic
1062535561 9:137019762-137019784 CGTGCTGCCCTGGGAGTGGAGGG - Intronic
1062561343 9:137143442-137143464 ACTGGTGCCCAGAGAGGCGAAGG - Intronic
1186083269 X:5956751-5956773 ACAAATGCCCAGTGAGTGGAGGG - Intronic
1187087841 X:16060320-16060342 CCAGATGCCCTGAAACTGGATGG - Intergenic
1189131486 X:38502639-38502661 CCTGATGCTCAGAGAGAGGGTGG + Intronic
1189607405 X:42694631-42694653 CCTGAGGCCCTGAGTGAGGATGG + Intergenic
1190744138 X:53311240-53311262 ACTGAGGCCCAGAGAGAGAAAGG - Intronic
1191776786 X:64823144-64823166 ACTGAGGCCCAGAGAAGGGAAGG + Intergenic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1191842715 X:65524584-65524606 ACTGAGGTCCAGAGAGGGGAAGG - Exonic
1192087044 X:68110530-68110552 CCTGTGGCCCAGAGAGTGGGAGG + Intronic
1192203272 X:69080770-69080792 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
1192213768 X:69143757-69143779 TCTGAGGCCCAGGGAGGGGAAGG + Intergenic
1192234087 X:69285260-69285282 ACTGAAGCCCAGGGAGAGGATGG + Intergenic
1192279977 X:69674845-69674867 CATGAAGCCAAGAGAGTAGAAGG - Intronic
1192342944 X:70279004-70279026 CCTGAGGCTCAGAGAGAAGAAGG + Intronic
1192639340 X:72847520-72847542 GCTGAGGCCCTGAGAGTGGCAGG + Intronic
1192642371 X:72873285-72873307 GCTGAGGCCCTGAGAGTGGCAGG - Intronic
1192953548 X:76044023-76044045 CCAGATGCTCAGAAAGGGGAAGG + Intergenic
1195310697 X:103629400-103629422 GCTGGTGCCCAGAAAGTGGGGGG + Intronic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1196051410 X:111309402-111309424 CCTGCTGCCCAGAGACTTGATGG + Intronic
1197800251 X:130340260-130340282 CCTGCTACCCAGAGGGTGAATGG + Exonic
1198051997 X:132959100-132959122 ACTGAGGCCCAGAGAGGGGTAGG + Intronic
1199195834 X:145029259-145029281 CCAGAGGCTCAGAGAGTTGAAGG + Intergenic
1199297284 X:146173563-146173585 ACTGATACCCAGAGAAAGGAAGG - Intergenic
1199701241 X:150377271-150377293 CGTGAGGCCCAGAGAGGGGAAGG - Intronic
1199815609 X:151394472-151394494 ACTGCGGCCCAGAGAGGGGACGG - Intergenic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1200056239 X:153462835-153462857 GCTGATGCCCAGAGAGGGGTGGG - Intronic