ID: 916059457

View in Genome Browser
Species Human (GRCh38)
Location 1:161088818-161088840
Sequence CAGCCGTTCCAGAGCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916059450_916059457 -10 Left 916059450 1:161088805-161088827 CCCCAGTTCCAGGCAGCCGTTCC 0: 1
1: 0
2: 1
3: 14
4: 201
Right 916059457 1:161088818-161088840 CAGCCGTTCCAGAGCCCAGGGGG 0: 1
1: 0
2: 4
3: 23
4: 219
916059448_916059457 10 Left 916059448 1:161088785-161088807 CCAGCTGAGCTCTGAGTCAGCCC 0: 1
1: 0
2: 4
3: 26
4: 216
Right 916059457 1:161088818-161088840 CAGCCGTTCCAGAGCCCAGGGGG 0: 1
1: 0
2: 4
3: 23
4: 219
916059447_916059457 27 Left 916059447 1:161088768-161088790 CCTGATGACTGCAGAAACCAGCT 0: 1
1: 0
2: 1
3: 12
4: 166
Right 916059457 1:161088818-161088840 CAGCCGTTCCAGAGCCCAGGGGG 0: 1
1: 0
2: 4
3: 23
4: 219
916059446_916059457 28 Left 916059446 1:161088767-161088789 CCCTGATGACTGCAGAAACCAGC 0: 1
1: 0
2: 0
3: 11
4: 179
Right 916059457 1:161088818-161088840 CAGCCGTTCCAGAGCCCAGGGGG 0: 1
1: 0
2: 4
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916059457 Original CRISPR CAGCCGTTCCAGAGCCCAGG GGG Intronic
900238810 1:1605109-1605131 CTGCCCTCCCAGCGCCCAGGAGG + Intergenic
900338552 1:2176859-2176881 CAGCCCTTCCAGAGCCCAGCTGG + Intronic
900342491 1:2195445-2195467 CAGCCACTCCAGGGCCCAGCAGG - Intronic
900502186 1:3011755-3011777 CACCCGTGACAGAGGCCAGGCGG + Intergenic
900587566 1:3440480-3440502 CAGCCACTCCAGCCCCCAGGGGG + Intergenic
901033056 1:6319744-6319766 CAGCCCTTCCAGAGCAGATGGGG + Intronic
901685889 1:10943134-10943156 GAGCCGTTCCAGATCCCAGATGG - Intergenic
901813067 1:11778761-11778783 CAGTGGCTCCAGAGCCGAGGGGG - Exonic
902681568 1:18047576-18047598 TAGCTGTTCCAGGGCCCAGGAGG + Intergenic
902754128 1:18537896-18537918 CACCCGAGCCAGGGCCCAGGAGG + Intergenic
903441767 1:23393723-23393745 CTGCTAGTCCAGAGCCCAGGGGG + Intronic
903698611 1:25229342-25229364 TTGCTGTTCCAGAGCCCTGGAGG + Intronic
905271605 1:36791124-36791146 CAGTCATTGCAGAGCCCTGGTGG - Intergenic
906044382 1:42817002-42817024 CAGCCGCTCCTGGGGCCAGGGGG + Intronic
907641850 1:56198525-56198547 CAGTCATTCCAGAGCCCATGTGG + Intergenic
911048045 1:93644820-93644842 CAGGAGGTCCAGAGCTCAGGAGG - Intronic
912548012 1:110465299-110465321 AAGGCTTTCCAGAGTCCAGGTGG - Intergenic
913180781 1:116319115-116319137 CAGCCATTCCAGAGCACAAATGG + Intergenic
915473348 1:156138589-156138611 CAGCGGCTCAGGAGCCCAGGTGG + Exonic
915737364 1:158093566-158093588 CAGCCGCTGCAGAGACCAGCAGG + Intronic
916059457 1:161088818-161088840 CAGCCGTTCCAGAGCCCAGGGGG + Intronic
917625964 1:176846558-176846580 CAGCCCTTCCAGTAGCCAGGTGG - Intergenic
920342404 1:205283969-205283991 AAGGTGTTCCAGAGCTCAGGGGG - Intergenic
922880817 1:228979223-228979245 CCGCCTTTCCTGAGCCCAGTGGG + Intergenic
1063494166 10:6491401-6491423 CTGCCGTACCATAGCCCTGGGGG - Intronic
1063819538 10:9819132-9819154 CAGCTGATGCAGAGCCCAGAGGG + Intergenic
1064843933 10:19629788-19629810 CAGCCGTTCCAGGGCCACTGGGG - Intronic
1069922900 10:71828019-71828041 CGGCCATGCCAGGGCCCAGGCGG + Exonic
1073307539 10:102515084-102515106 CGGCAGTTCCAGACCCCACGGGG - Intronic
1075904866 10:126072335-126072357 CAGCCCTTCTAGAGCACAGAAGG - Intronic
1077240581 11:1508452-1508474 CCACCGTTCCAGAGCGCAGAGGG - Intergenic
1077334879 11:1998773-1998795 CAGCCCTTCCACATCCCAGAGGG - Intergenic
1077424644 11:2468924-2468946 CAGCCGTTCCACTTCCCAGCGGG - Intronic
1081598438 11:44475411-44475433 CATGCCTACCAGAGCCCAGGTGG + Intergenic
1083266811 11:61550661-61550683 CTCCATTTCCAGAGCCCAGGTGG + Intronic
1084858709 11:72004642-72004664 CAGGAGTTCCAGGGCCCTGGTGG + Exonic
1084980315 11:72825352-72825374 CAGCCCCTCCAGTGGCCAGGAGG - Exonic
1085393540 11:76194703-76194725 CAGCGGTTCCCGGGCCCGGGTGG + Exonic
1090105686 11:123851917-123851939 CAGCCTGTGCAGAGCCCAGGGGG - Intergenic
1202817862 11_KI270721v1_random:53955-53977 CAGCCCTTCCACATCCCAGAGGG - Intergenic
1091850591 12:3693868-3693890 CAGCTGATGCAGAGCCCAGAGGG - Intronic
1092126946 12:6081090-6081112 CAGCCTTTCCTGAACGCAGGAGG - Intronic
1093655277 12:21687602-21687624 CAGCCTGTGCAGAGCCAAGGGGG + Intronic
1096174296 12:49502263-49502285 CTGCAATTCCAGAGACCAGGAGG - Intronic
1100270455 12:93019719-93019741 CAGGCTTCCCACAGCCCAGGAGG + Intergenic
1102806675 12:115787509-115787531 CAGCCCTTCTGGGGCCCAGGAGG + Intergenic
1103935119 12:124471656-124471678 CAGGAGTGCCTGAGCCCAGGAGG - Intronic
1104161651 12:126186860-126186882 CAGACCTTACAGAACCCAGGTGG + Intergenic
1106903985 13:34385891-34385913 CAGCCAATCTAGAGCACAGGTGG + Intergenic
1108310865 13:49189248-49189270 CAGAGGTTGCAGAACCCAGGAGG - Intronic
1109391302 13:61697202-61697224 CAGCCTTGTCAGAGTCCAGGAGG + Intergenic
1114083574 14:19220820-19220842 CAGCTGATCCAGTGCCCAGAAGG + Intergenic
1115341046 14:32293175-32293197 CAGTCTTTCCAGAGCCCATAGGG - Intergenic
1117372567 14:55092166-55092188 CAGCTATTCAAGAGCACAGGAGG - Intergenic
1118182052 14:63503531-63503553 CAACTGTTCCAGAGCAAAGGAGG + Intronic
1121282354 14:92708348-92708370 CAGCACTTTCAGGGCCCAGGTGG + Intronic
1122313889 14:100814507-100814529 CAGCCATTCCTCAGACCAGGTGG + Intergenic
1122417151 14:101555529-101555551 CAGCTGTTCCATGGCCCAAGCGG + Intergenic
1122695144 14:103548783-103548805 CAGCAGGAGCAGAGCCCAGGGGG - Intergenic
1122770747 14:104096579-104096601 CAGACCTTCCCGAGCCCTGGGGG + Intronic
1122904279 14:104794943-104794965 AAGCAGTTCCGGGGCCCAGGAGG + Intronic
1122979672 14:105185860-105185882 CAGGCATGACAGAGCCCAGGTGG + Intergenic
1123113634 14:105884103-105884125 GACCCGTCCCAGAGCCCAGGAGG - Intergenic
1123115859 14:105893742-105893764 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1123120101 14:105912457-105912479 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1202895185 14_GL000194v1_random:2589-2611 CAGCTGATCCAGTGCCCAGAAGG + Intergenic
1123402839 15:20004043-20004065 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1123512176 15:21010697-21010719 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1123721241 15:23063757-23063779 CAGCCTGTGCAGAGCCCAGAGGG + Intergenic
1126227711 15:46290216-46290238 CAGCCTGTGCAGAGCCCAGAGGG - Intergenic
1128133540 15:65246349-65246371 CAGCCATTCCAGAGGCCTTGAGG + Intronic
1129023519 15:72546836-72546858 CAGCACTTTCAGAGGCCAGGTGG - Intronic
1130052350 15:80494397-80494419 CTGCCTTTCCACAGCCAAGGAGG + Intronic
1130972787 15:88747177-88747199 GAGCTGTTCCAGTTCCCAGGAGG + Intergenic
1132561293 16:595426-595448 CAGCCGTCCCCAGGCCCAGGTGG - Intronic
1135436291 16:22428831-22428853 CAGCCGGCCCAGGGCCCAGATGG - Intronic
1135567632 16:23524141-23524163 ATGCCTTTCCAGAGTCCAGGAGG + Exonic
1136412572 16:30085898-30085920 GAGCCCCTCCAGAGCCCATGGGG + Exonic
1137061515 16:35794965-35794987 CAGCAGCTCCACAGCCCAGGTGG + Intergenic
1137632961 16:49960356-49960378 CAGCCTTTCCAGAGCGGAGTGGG + Intergenic
1138145838 16:54611220-54611242 CAGCTGTTCCAGTTCCCATGTGG + Intergenic
1139574327 16:67831697-67831719 CAGCCTCTCCAGAGGACAGGAGG + Intronic
1139967555 16:70754193-70754215 CAGCCACCCCAGAGCACAGGGGG - Intronic
1141787203 16:86209513-86209535 CAGCCCTTCCTGAGACCACGTGG - Intergenic
1142597416 17:1036305-1036327 CAGAGAGTCCAGAGCCCAGGAGG + Intronic
1142933500 17:3308455-3308477 AAGCTGTTTCAGAGCCCAGAGGG - Intergenic
1143794119 17:9322492-9322514 GAGCACTTCCACAGCCCAGGGGG + Intronic
1144132423 17:12259778-12259800 CTGCCTTCCCAGAGCCCAGGAGG - Intergenic
1144763828 17:17722423-17722445 CAGCCGCTCCAGAGCCCTGGGGG - Intronic
1144858235 17:18282751-18282773 CAGCCATGCCAGAGCCCATCAGG - Exonic
1146466713 17:33092025-33092047 CAGCCCTCCCAGAGCTGAGGGGG + Intronic
1147957116 17:44142186-44142208 GAGCAGTTCCGGAGGCCAGGGGG - Intronic
1148048808 17:44759363-44759385 CAGCCGGTCCGGAGCGCGGGAGG + Intronic
1148601119 17:48895048-48895070 CAACAGTTTCAGAGCTCAGGTGG + Intronic
1148760697 17:49998305-49998327 CTGCTGTGCCAGTGCCCAGGTGG - Intergenic
1149131032 17:53302795-53302817 CAGCCTGTGCAGAGCCCAGTTGG + Intergenic
1149578393 17:57729835-57729857 AAGCCCTTCCAGAGCCCTGGGGG - Intergenic
1151141102 17:71993011-71993033 CAGCCTGTGCAGAGCCCAGAGGG + Intergenic
1151534402 17:74730539-74730561 CAGCACTACCAGAGCCCAGCCGG - Intronic
1152569939 17:81117197-81117219 CAGCCCTTCCTGGGGCCAGGAGG - Exonic
1152880134 17:82809726-82809748 CAGGCTTCCCAGAGCCCTGGCGG + Exonic
1153595510 18:6721189-6721211 CAGGTGGTGCAGAGCCCAGGAGG + Intergenic
1154371321 18:13765576-13765598 CAGCCTTTGCAGAACCCAGAGGG + Intergenic
1154500253 18:14992482-14992504 CAGCTGATCCAGTGCCCAGAAGG + Intergenic
1155034850 18:22017613-22017635 CAGATGTTGCAGAACCCAGGAGG - Intergenic
1156338064 18:36187348-36187370 CACCCGCTCCCGCGCCCAGGTGG + Intergenic
1158726151 18:59974546-59974568 CTGCCGTTTCAGAATCCAGGAGG - Intergenic
1160308415 18:77763757-77763779 CAGCCGTGACAGAACCCAGGTGG - Intergenic
1161063669 19:2227429-2227451 GAGCCTTGCCAGAGCCCGGGCGG - Intronic
1163525939 19:17821468-17821490 CAGCAGCACCAGCGCCCAGGCGG + Exonic
1163713108 19:18858654-18858676 CAGCGTCCCCAGAGCCCAGGAGG + Intronic
1163848625 19:19651234-19651256 CAGCCTGACCAGACCCCAGGCGG - Intronic
1163869093 19:19803241-19803263 CTGCCATTCCAGAGACCTGGAGG + Intronic
1163924076 19:20322113-20322135 GTGCCATTCCAGAGGCCAGGAGG + Intergenic
1163931143 19:20393250-20393272 CTGCCATTCCAGAGACCTGGAGG - Intergenic
1163984988 19:20937812-20937834 CTGCCCTTCCAGAGTCCTGGAGG - Intronic
1164008043 19:21169922-21169944 CTGCCCTTCCAGAGACCTGGAGG - Intronic
1164116358 19:22223063-22223085 CTGCCCTTCCAGAGGCCTGGAGG - Intergenic
1164141230 19:22466280-22466302 CTGCCCTTCCAGAGGCCTGGAGG - Intronic
1164224395 19:23229315-23229337 CTGCCCTTCCAGAGGCCTGGAGG + Intronic
1164239563 19:23372665-23372687 CTGCCCTTCCAGAGGCCTGGAGG + Intronic
1164297197 19:23922455-23922477 CTGCCCTTCCAGAGGCCTGGAGG - Intronic
1166037949 19:40182913-40182935 CAGCCCTGCCAAAGCCCAGGAGG + Intergenic
1167207239 19:48110813-48110835 CAGCTGTTCCAGAGCTCACCCGG + Exonic
1168465528 19:56598279-56598301 CAGCAGATGCAGAGGCCAGGAGG + Intronic
1168659400 19:58154646-58154668 CAGACGTTCCCGAGCTCAGAAGG - Intronic
925405670 2:3604202-3604224 CAGCCCTTCCAGGCACCAGGAGG + Intronic
927205768 2:20609376-20609398 AAGCCGTTCCAGGGGCCCGGGGG + Intronic
927212426 2:20646972-20646994 CAGCTGCTCCAGAGCCCAGGTGG + Intronic
927215820 2:20667342-20667364 GGGCCGGTCCGGAGCCCAGGGGG + Exonic
929547454 2:42864841-42864863 CACCCGTTCCTGAGCCCTGGGGG + Intergenic
931413047 2:62052988-62053010 CAGCCTTCACTGAGCCCAGGAGG + Intronic
934654303 2:96109249-96109271 CAGCCTTTCCCAAGCCCAGATGG + Intergenic
935234288 2:101125179-101125201 CAGCACCTACAGAGCCCAGGGGG + Intronic
936097600 2:109544284-109544306 CAGAAGTTCCAGAGCACAGAAGG - Exonic
937115757 2:119404064-119404086 CAACAGTTGCAGAGCCCTGGAGG - Intergenic
938493014 2:131775813-131775835 CAGCTGATCCAGTGCCCAGAAGG - Intergenic
938499458 2:131822828-131822850 CAGCTGATCCAGTGCCCAGAAGG + Intergenic
940405757 2:153300027-153300049 CAGCTGTTCTAGAGCTCAGAAGG + Intergenic
940984422 2:160038481-160038503 GGGGCGCTCCAGAGCCCAGGTGG + Intronic
942642147 2:178071991-178072013 CAGGGGTTCCTGAGCCCGGGAGG + Exonic
943576955 2:189641221-189641243 AAGCCTTTCCTGAGCACAGGAGG - Intergenic
943983501 2:194589281-194589303 CAGCCCTTTGAGAGGCCAGGCGG + Intergenic
1170071437 20:12373497-12373519 CAGCTGTTCCAAATCCCATGAGG - Intergenic
1171997023 20:31739396-31739418 CAGCCGTTCCAAACTCCGGGAGG - Exonic
1173389708 20:42621200-42621222 CAGGCGATCTAGAGCCCAGGGGG - Intronic
1173504506 20:43576275-43576297 CAGCCGCTACAGATCCCCGGAGG + Exonic
1174991301 20:55513127-55513149 CAGCCTGTACAGAGCCCAGCAGG + Intergenic
1176614887 21:9018576-9018598 CAGCTGATCCAGTGCCCAGAAGG + Intergenic
1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG + Exonic
1179408224 21:41142684-41142706 TCGCCCCTCCAGAGCCCAGGTGG + Intergenic
1179887388 21:44319999-44320021 CAGCCGTGACAGAGCCCAGGAGG - Intronic
1180294402 22:10872447-10872469 CAGCTGATCCAGTGCCCAGAAGG - Intergenic
1180497208 22:15901861-15901883 CAGCTGATCCAGTGCCCAGAAGG - Intergenic
1181486040 22:23232352-23232374 CAGCCCTACCACTGCCCAGGTGG - Intronic
1182483271 22:30623469-30623491 CAGCCTTCCTAGAGCCCAAGTGG + Intronic
1183730752 22:39617277-39617299 CTGCCTTCCCAGAGCCCAGAGGG - Intronic
1184127765 22:42500286-42500308 CCGCCCTGCCAGAGCCCCGGCGG - Intergenic
1185068154 22:48642234-48642256 CAGCCCTGCCAGAGCCCCAGGGG + Intronic
950460935 3:13121887-13121909 TGGCCGTCCCCGAGCCCAGGGGG - Intergenic
952669900 3:35953799-35953821 CAGCCTGTGCAGAGCCCAGAAGG - Intergenic
954136236 3:48583418-48583440 CATCCCTTCCAGGGCCCACGGGG - Exonic
957966259 3:87324760-87324782 CAGCTGTCTCAGAGCCCATGGGG + Intergenic
960949421 3:122989443-122989465 AAGCCTTACCAGAGCCCTGGTGG - Intronic
962264035 3:133933172-133933194 CAGCTGTTCCAGAGGACATGGGG + Exonic
965477027 3:169169468-169169490 CAGACATTCCAGAATCCAGGTGG + Intronic
968521961 4:1038091-1038113 CAGCCCTCCCACAGCCCAGGAGG - Intergenic
968653579 4:1769392-1769414 CTGCCTTTCCAGAGGCAAGGGGG - Intergenic
971140907 4:23923987-23924009 ATGCCTTTTCAGAGCCCAGGAGG + Intergenic
973339051 4:48986003-48986025 CAGCGCTGCCAGAGCCCAGGAGG - Intergenic
973697030 4:53500191-53500213 CAGCCAGGCCAGAGCCCATGAGG + Intronic
975897224 4:79107095-79107117 CAGCCAGTGCAGAGCCCAGAGGG - Intergenic
976623474 4:87152940-87152962 AAGACGTTCCATAGACCAGGGGG - Intergenic
981511800 4:145566091-145566113 CAGCTGGTGCAGAGCCCAGAGGG + Intergenic
982540678 4:156666230-156666252 CTGCTGTTCCAGAGGACAGGAGG + Intergenic
983413258 4:167424526-167424548 CAGCCCGTGCAGAGCCCAGCAGG + Intergenic
985257317 4:188083269-188083291 CAGGCGTTCCATAGCACTGGAGG + Intergenic
985664748 5:1176287-1176309 CAGTGATGCCAGAGCCCAGGAGG - Intergenic
987990983 5:25212490-25212512 CAGCCAGTGCAGAGCCCAGAGGG + Intergenic
992071630 5:73154185-73154207 CAGCCCTTCCAGAGACAGGGTGG - Intergenic
992944214 5:81793917-81793939 CAGCAGGTCCAAAGCCCAGGGGG - Intergenic
993178538 5:84519052-84519074 CAGCCAGTGCAGAGCCCAGTGGG - Intergenic
994439734 5:99787511-99787533 CAGCTATTCCAGAGCTGAGGTGG - Intergenic
996888620 5:128389630-128389652 CAGCCTGTGCAGAGCCCAGAGGG - Intronic
997667967 5:135647633-135647655 CATGTGTCCCAGAGCCCAGGAGG - Intergenic
998150951 5:139757159-139757181 CCCCCATCCCAGAGCCCAGGAGG - Intergenic
998168340 5:139857127-139857149 GAACCATTCCAAAGCCCAGGGGG - Intronic
998276029 5:140753986-140754008 CAGCTGGTGCAGAGCCCAGAGGG - Intergenic
999721199 5:154400468-154400490 CACCAGCTCCAGAGCCCAGGAGG + Intronic
1001603322 5:172943301-172943323 CAGGCCTTCCAGAGCTCCGGGGG - Intronic
1004596522 6:17104513-17104535 AAGCCATTCCAAGGCCCAGGAGG + Intronic
1005870860 6:29973849-29973871 CAGTGGTTCCAGGGGCCAGGGGG + Intergenic
1006253787 6:32813301-32813323 CAGCCGTTCCAGAGACTCAGGGG + Intronic
1006985169 6:38171147-38171169 TATCCTTTCCAGAGCCAAGGGGG - Exonic
1007621114 6:43215242-43215264 ATGCCGCTCCAGAGCCCATGGGG + Exonic
1009446552 6:63749587-63749609 CAGCCGATACAGAGCCCAGAGGG - Intronic
1011519830 6:88193398-88193420 CAGCTGGTCCCCAGCCCAGGTGG - Intergenic
1013027091 6:106286291-106286313 CAACCGTTCCAAAGCACATGGGG + Intronic
1015539115 6:134296937-134296959 CGGCTGCCCCAGAGCCCAGGAGG - Intronic
1018581264 6:165310229-165310251 AATCCTTTCCAAAGCCCAGGGGG + Intergenic
1019032047 6:169022236-169022258 CAGCCGTTCCAGTGGGCAGGGGG + Intergenic
1019127918 6:169853609-169853631 CAGCCGCGCCCGAGCTCAGGGGG - Intergenic
1019188778 6:170238051-170238073 CAGTCGTTTAAGAGCACAGGTGG - Intergenic
1019289195 7:242068-242090 CAGGCCTGCCAGAGCGCAGGGGG - Intronic
1019538749 7:1541978-1542000 CACCAGCTACAGAGCCCAGGCGG + Exonic
1019978603 7:4604757-4604779 CAGCCATAACAGAGCCCTGGTGG + Intergenic
1022449771 7:30504327-30504349 CAGCCGGTGCAAAGGCCAGGAGG + Intronic
1023865926 7:44238449-44238471 AGGCCTTTCCAGAGCGCAGGCGG - Intronic
1023984670 7:45087853-45087875 CAGCCGTTCCCCTGCCCTGGGGG - Intronic
1024385709 7:48748955-48748977 CAGCAGGTGCAGAGCCCAGAGGG - Intergenic
1028347341 7:89798787-89798809 CAGCTGGTACAGAGCCCAGAGGG - Intergenic
1028370492 7:90086897-90086919 CAGCCTGTACAGAGCCCAGGTGG + Intergenic
1028639676 7:93028844-93028866 CAGCCAGTGCAGAGCCCAGAGGG + Intergenic
1029283892 7:99453229-99453251 CAGCCAGTCCAGAGCCCAGCAGG - Intronic
1029596181 7:101538661-101538683 CAGCAGGGCCTGAGCCCAGGGGG + Intronic
1030837953 7:114311869-114311891 AAGAGGTTCCAGGGCCCAGGAGG - Intronic
1032094211 7:128929537-128929559 CAGCCCTGCCAGGGGCCAGGGGG + Intergenic
1039672044 8:39612516-39612538 CAGCCTGTGCAGAACCCAGGGGG + Intronic
1040387552 8:46923801-46923823 CAGCAGCACCAGAACCCAGGTGG - Intergenic
1041307420 8:56476802-56476824 CAGAAGTTCCAGAGCACAGAAGG - Intergenic
1044999644 8:97868845-97868867 CGTCCGTGCCTGAGCCCAGGCGG - Intronic
1046198062 8:110888971-110888993 CAGAAGTTCCAGAGGCCTGGAGG + Intergenic
1046281461 8:112038264-112038286 CAGCAGTTCAAAAGCCCAGTGGG - Intergenic
1047409907 8:124615867-124615889 CAGCCGTTCAGGATCACAGGAGG + Intronic
1048433912 8:134397568-134397590 AAGCCGTTCCAAATCCCAGTAGG + Intergenic
1051961562 9:22770746-22770768 CCGCCTTTCCAGAGCTCAGGTGG + Intergenic
1053448574 9:38172919-38172941 CAGAGTTTCCAGAGCCCAGGAGG - Intergenic
1053848368 9:42265113-42265135 CAGCACTTTCAGAGGCCAGGAGG + Intergenic
1060155586 9:121317897-121317919 CAGCTGGCCCAGGGCCCAGGGGG - Intronic
1061382080 9:130264837-130264859 CAGCCGTGCCTGAGCCCATCTGG + Intergenic
1061790231 9:133055285-133055307 AAGCCGCTCCACAGCCCTGGGGG + Intronic
1062331327 9:136046136-136046158 CAGCCCCTCCAGAGAGCAGGAGG - Intronic
1062447999 9:136603773-136603795 AAGGAGTTCCAGACCCCAGGAGG - Intergenic
1062647508 9:137556395-137556417 CAGCCCTTTCAGAGCCCAAGTGG - Intronic
1186900468 X:14049902-14049924 CAGCAGTTTCAGAGCTCATGTGG - Intergenic
1187055584 X:15738632-15738654 CAGCTGTTCCAGAGAAAAGGGGG + Intronic
1188833694 X:34931703-34931725 CAGCCAGTGCAGAGCCCAGAGGG + Intergenic
1189558231 X:42166614-42166636 CAGCCTCTGCAGAGCCCAGAGGG - Intergenic
1191207973 X:57854028-57854050 CATCTGGTGCAGAGCCCAGGGGG - Intergenic
1192437983 X:71154444-71154466 CGGCTGCTCCCGAGCCCAGGCGG - Intronic
1193341653 X:80355508-80355530 CAGCCTGTGCAGAGCCCAGAAGG - Intronic
1196473819 X:116059202-116059224 CAGCCTATACAGAGCCCAGAGGG - Intergenic
1198216070 X:134555970-134555992 CAGCATTTTCAGAGGCCAGGAGG + Intergenic
1199640677 X:149858274-149858296 CAGCCTGTGCAGAGCCCAGATGG + Intergenic
1199720878 X:150542079-150542101 CAGACAGTCCGGAGCCCAGGAGG - Intergenic
1199756586 X:150870654-150870676 CAGCAGTTCCTGAGCCTGGGAGG - Intronic
1200169015 X:154058512-154058534 CTGTCGTTCCAGGACCCAGGAGG - Intronic