ID: 916060454

View in Genome Browser
Species Human (GRCh38)
Location 1:161094901-161094923
Sequence ATGGAGAGGTGGAATAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916060454_916060458 -8 Left 916060454 1:161094901-161094923 CCATCCTTATTCCACCTCTCCAT No data
Right 916060458 1:161094916-161094938 CTCTCCATCATTCTCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916060454 Original CRISPR ATGGAGAGGTGGAATAAGGA TGG (reversed) Intergenic
No off target data available for this crispr