ID: 916060458

View in Genome Browser
Species Human (GRCh38)
Location 1:161094916-161094938
Sequence CTCTCCATCATTCTCTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916060451_916060458 14 Left 916060451 1:161094879-161094901 CCTCAACAACATAAGCTTCTCCC No data
Right 916060458 1:161094916-161094938 CTCTCCATCATTCTCTACCTTGG No data
916060453_916060458 -7 Left 916060453 1:161094900-161094922 CCCATCCTTATTCCACCTCTCCA No data
Right 916060458 1:161094916-161094938 CTCTCCATCATTCTCTACCTTGG No data
916060454_916060458 -8 Left 916060454 1:161094901-161094923 CCATCCTTATTCCACCTCTCCAT No data
Right 916060458 1:161094916-161094938 CTCTCCATCATTCTCTACCTTGG No data
916060452_916060458 -6 Left 916060452 1:161094899-161094921 CCCCATCCTTATTCCACCTCTCC No data
Right 916060458 1:161094916-161094938 CTCTCCATCATTCTCTACCTTGG No data
916060450_916060458 15 Left 916060450 1:161094878-161094900 CCCTCAACAACATAAGCTTCTCC No data
Right 916060458 1:161094916-161094938 CTCTCCATCATTCTCTACCTTGG No data
916060449_916060458 21 Left 916060449 1:161094872-161094894 CCTACTCCCTCAACAACATAAGC No data
Right 916060458 1:161094916-161094938 CTCTCCATCATTCTCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916060458 Original CRISPR CTCTCCATCATTCTCTACCT TGG Intergenic
No off target data available for this crispr