ID: 916061911

View in Genome Browser
Species Human (GRCh38)
Location 1:161104898-161104920
Sequence CTAAAGTAGCTTGAGATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916061911_916061914 2 Left 916061911 1:161104898-161104920 CCCTTCATCTCAAGCTACTTTAG 0: 1
1: 0
2: 0
3: 5
4: 170
Right 916061914 1:161104923-161104945 ATTCATTTCAACAAATGCCTTGG 0: 1
1: 0
2: 1
3: 39
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916061911 Original CRISPR CTAAAGTAGCTTGAGATGAA GGG (reversed) Intronic
904045548 1:27606178-27606200 CCCCAGTAGGTTGAGATGAAGGG + Intergenic
905301786 1:36990669-36990691 TTATAGGAGCTTGAGATAAAGGG + Intronic
907676981 1:56527079-56527101 CTAAAGTAACTGGAGCAGAAAGG - Intronic
910556492 1:88540118-88540140 CTAAAGTATCTTGAGCTTCAGGG + Intergenic
910670118 1:89763774-89763796 CTAGAGTAGAATGAAATGAAGGG + Intronic
912962413 1:114207992-114208014 TAAAGGTGGCTTGAGATGAAAGG - Intergenic
916061911 1:161104898-161104920 CTAAAGTAGCTTGAGATGAAGGG - Intronic
917665010 1:177217967-177217989 GTTAAGTAGGTTGGGATGAATGG + Intronic
920073133 1:203317552-203317574 CTAAAGTAGGTGGAAAGGAAGGG - Intergenic
921999214 1:221457584-221457606 CTAAACAATTTTGAGATGAAGGG - Intergenic
922353437 1:224754499-224754521 GTAAAGAAACTTGAAATGAATGG - Intergenic
1062913321 10:1228635-1228657 TTTGAGTCGCTTGAGATGAATGG + Intronic
1065331381 10:24603869-24603891 CCCAAGTAGCTTGAGATTACAGG - Intronic
1068550723 10:58404905-58404927 ATTAAGTTTCTTGAGATGAAGGG - Intergenic
1071932862 10:90493173-90493195 CTAAAGCAGCGTTAGAGGAAAGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075923428 10:126232158-126232180 ATGAAGGAGCTGGAGATGAAGGG + Intronic
1076305637 10:129464054-129464076 CAAAAGTAGCTTGGGAAGACAGG + Intergenic
1077292561 11:1804916-1804938 CTAAAATAGCTGGAGGTCAAAGG - Intergenic
1077645636 11:3921100-3921122 CTTAAGTATCTTAAGATGCAAGG + Intronic
1080133776 11:28828568-28828590 CAAAACTAGCTTGAAATGCAAGG - Intergenic
1081208351 11:40301065-40301087 CTAAAGAAGCTTGGGAAGGAAGG + Intronic
1084472261 11:69369875-69369897 GTTAAGGAGCTTGAGAGGAAGGG + Intergenic
1085856576 11:80182131-80182153 CTAAAAGATCTTGAGAGGAAAGG - Intergenic
1086728955 11:90223965-90223987 CTAAATAACCTTGAGATCAATGG - Intergenic
1086912577 11:92489995-92490017 CAAAAGTAGTTTCAGAAGAAAGG - Intronic
1088664696 11:112082923-112082945 GGAAAGTAGCTACAGATGAAAGG + Exonic
1088908941 11:114176078-114176100 CTGAAGTTGCTTCAGAAGAAAGG + Intronic
1091213711 11:133886465-133886487 CTCAAGAAGCCTGAGATGATAGG - Intergenic
1092683024 12:11009304-11009326 GAAAAGTAGCTAGAGGTGAAAGG - Intronic
1094765411 12:33588824-33588846 CTAAAGTAGGGTGAAAGGAATGG + Intergenic
1098965512 12:76783751-76783773 ATTAAGTATCTTGAGATGGAGGG + Intronic
1100471099 12:94893890-94893912 CAAAAGTAACTTTTGATGAAGGG - Intergenic
1101123646 12:101609088-101609110 CTCAAGAAGCTTGTGATCAAAGG + Intronic
1103986767 12:124772567-124772589 GTAAAGTTGTTTGAGAGGAAGGG + Intergenic
1104347603 12:128015549-128015571 CTAAATTAGCTATAGATTAAAGG + Intergenic
1105888888 13:24667824-24667846 CTGAAGAAGCTAGTGATGAACGG - Intergenic
1112156756 13:96825577-96825599 CTAAAGTAGGTAGAGATCACAGG - Intronic
1114926545 14:27407768-27407790 CTAAAATAACTTGGGGTGAAGGG + Intergenic
1115607499 14:35018919-35018941 CAATAGTAGCTTAAGATTAATGG - Intronic
1117008349 14:51445156-51445178 CTGAAGCAGCAAGAGATGAATGG + Intergenic
1117872223 14:60213096-60213118 CAGAAGTGGCTTGAGAAGAAGGG - Intergenic
1120419282 14:84262625-84262647 CTTAAGTAGCTTGAGATTTTAGG + Intergenic
1120486050 14:85114176-85114198 CCAAAGTAGGTTGAGAAGGAAGG + Intergenic
1124111008 15:26787355-26787377 CTAAAATAGCTTTAGGTTAAAGG - Intronic
1125109958 15:36020997-36021019 TTAAAGTACCCTGAGAGGAAAGG - Intergenic
1125252131 15:37716746-37716768 CAAAAGTAGCTATAGATTAAAGG + Intergenic
1126148775 15:45503011-45503033 GTAAATTATCTTTAGATGAATGG - Intronic
1126373905 15:47975333-47975355 CTAAAGAAGTTTGAGAGGCAGGG + Intergenic
1126961969 15:54006811-54006833 CCAGAGTAGCTGGAGATGGAAGG - Intergenic
1131943321 15:97591690-97591712 CTAAAGTTGTTTGTGAGGAATGG - Intergenic
1132095003 15:98977434-98977456 CTAAATAAGCCAGAGATGAAAGG - Intronic
1133957239 16:10455206-10455228 ATTAAGTACCTTGAGATGATGGG + Intronic
1136688769 16:32012422-32012444 AGAAAATATCTTGAGATGAATGG + Intergenic
1136789365 16:32955943-32955965 AGAAAATATCTTGAGATGAATGG + Intergenic
1136880448 16:33897993-33898015 AGAAAATATCTTGAGATGAATGG - Intergenic
1137811599 16:51357905-51357927 ATAAAGTAGCTTTAAATGATTGG + Intergenic
1140766578 16:78165075-78165097 CTAGTGTGGCTGGAGATGAATGG + Intronic
1140779455 16:78281453-78281475 TTAAACTAGCTTAAGAGGAAAGG + Intronic
1203091562 16_KI270728v1_random:1217438-1217460 AGAAAATATCTTGAGATGAATGG + Intergenic
1143601197 17:7947401-7947423 TTAAAGTAGCTGGAGAGGGAAGG - Intronic
1143968309 17:10773223-10773245 CTAAAGTGGCTTGCAAAGAATGG - Intergenic
1146065425 17:29631243-29631265 CTGAAGCAGTTTGAGATGAGGGG + Exonic
1147059479 17:37863398-37863420 CAAAAGTAGCCAGACATGAATGG + Intergenic
1149149910 17:53549544-53549566 CTAATGAAGCTTGAGTTGCATGG + Intergenic
1149237025 17:54604260-54604282 CTAACCTAGTTTGAGAAGAAAGG + Intergenic
1150290221 17:63976888-63976910 CAAAAGTAGTTTCAGTTGAAGGG - Intergenic
1152506898 17:80755291-80755313 CCAAAATAGTTGGAGATGAAGGG + Intronic
1159576883 18:70190043-70190065 CTTAAGTAGCAAGAAATGAATGG + Intronic
1159979328 18:74757357-74757379 TTAAAACAGTTTGAGATGAATGG - Intronic
1163652884 19:18529134-18529156 CTCAAGTAGCTTGGGATTACAGG - Intergenic
1164913506 19:32031070-32031092 CTAAATTTGCTTCAGATGATAGG - Intergenic
1165834902 19:38748356-38748378 CTGAAGTAGCTTAAAATGAAAGG + Intronic
1167474653 19:49692708-49692730 CAAAAGAAGCTGGAGATGAAAGG - Intronic
925234865 2:2269140-2269162 CTAAATTATCTGGAGATAAAGGG + Intronic
929466356 2:42148075-42148097 CTAAAGTAGCTTGAGGGTAGGGG - Intergenic
931943880 2:67283782-67283804 CTAGAGTAAATTAAGATGAAAGG + Intergenic
933356463 2:81216267-81216289 CTAAATTAGCTTCAGAATAAAGG - Intergenic
933764932 2:85700575-85700597 CTGAAGTAGCTTGGGATTACAGG + Intergenic
935322835 2:101905748-101905770 CCAAAGTAGCAAAAGATGAAAGG + Intergenic
937193674 2:120130448-120130470 CTAAAATAGCTTGTGCTGCATGG + Intronic
938706014 2:133927724-133927746 CTTAGTTAGCTTGAGTTGAAAGG + Intergenic
941449066 2:165637162-165637184 ATAAAATAGCTTGAAATTAAAGG + Intronic
942246659 2:174014091-174014113 CTATTGTATCTTGAGATGTATGG + Intergenic
942969969 2:181946749-181946771 TTAAAGTAGCCAGAGTTGAAGGG - Intergenic
943507226 2:188776508-188776530 AGAAACTATCTTGAGATGAATGG - Intronic
944366366 2:198924496-198924518 ATAAAGTACTTTGAAATGAATGG + Intergenic
1169004220 20:2193490-2193512 CTAAAATAGATTGAGTAGAATGG + Intergenic
1169692869 20:8352658-8352680 CTGAAGTAACTGGAAATGAATGG + Intronic
1169783962 20:9339033-9339055 CTAAGGTAGCTTCAGTTAAATGG + Exonic
1171006812 20:21474369-21474391 CCAAAGTAGCTGGAGAAGTAAGG - Intergenic
1173607070 20:44338946-44338968 CTCAAGTAGCTTGGGATTACAGG - Intronic
1173701827 20:45078711-45078733 CTTAAGTTGCTTCAGATGACTGG - Exonic
1174898310 20:54473834-54473856 CATAAGGAGCTTGAAATGAAGGG - Intergenic
1179557789 21:42191529-42191551 CTCATGTAGCTGGAGTTGAAAGG - Intergenic
1182747563 22:32617268-32617290 CTGAAGTATTTTCAGATGAAAGG + Intronic
1183213158 22:36463453-36463475 CTTAAGTAACTTGGCATGAATGG - Intergenic
952213903 3:31256419-31256441 CTCAAGTACCTTGAGATAAAAGG - Intergenic
953280051 3:41546392-41546414 CTAAACTAGCCTGAAATTAAGGG - Intronic
955899751 3:63739970-63739992 GTTAAGAATCTTGAGATGAAGGG + Intergenic
956319083 3:67975462-67975484 CTAAAGTAGTATGAGATCTATGG + Intergenic
956688984 3:71858686-71858708 CTAAATTAGATTGGGAGGAAAGG + Intergenic
957181440 3:76883561-76883583 CTAAATTGGTTTGAGATAAATGG - Intronic
957195791 3:77065845-77065867 CCTAAGTAAATTGAGATGAATGG + Intronic
959858094 3:111184885-111184907 CTAAAGTAGCTCTAGAAGATAGG - Intronic
960462580 3:117954760-117954782 CTAAAATAGCTACTGATGAAAGG + Intergenic
960785694 3:121371344-121371366 CTCAAGGAGCTGGAGATCAAAGG - Intronic
963738161 3:149045233-149045255 CTAAAGGAGATTGGGATTAAGGG - Intronic
965898352 3:173607125-173607147 CTAAAGTTGTATGAGAAGAAAGG - Intronic
967206990 3:187132892-187132914 ATAAAGTAGCTTGAAATCCAAGG + Intronic
970573666 4:17406837-17406859 CCAGAGTAGCCTGAGAAGAAAGG - Intergenic
972918940 4:43914089-43914111 TGAAAGGAACTTGAGATGAAAGG + Intergenic
974087608 4:57277906-57277928 CTAAAGAAGCTTGAAATAGAGGG - Intergenic
974674924 4:65076936-65076958 TTAAAGTAGCGTGAAATCAAAGG - Intergenic
975215498 4:71749192-71749214 CTAAAGTAGAGTGCGATGAATGG - Intronic
978699072 4:111621138-111621160 CTAAACTAGCTTTAAATGCAAGG - Intergenic
979887124 4:126042134-126042156 CTAAAGTAGCTATAGATGTGAGG - Intergenic
981366179 4:143906237-143906259 TTAAAGTAGGTTAAAATGAAAGG + Intergenic
981376294 4:144020017-144020039 TTAAAGTAGGTTAAAATGAAAGG + Intergenic
981386807 4:144141365-144141387 GTAAAGTAGGTTAAAATGAAAGG + Intergenic
983117140 4:163832348-163832370 CGATAGAAGCTTGAAATGAAGGG - Intronic
983282159 4:165694764-165694786 CTAAAGTAGCTCCAGAAAAATGG + Intergenic
986522689 5:8638144-8638166 TTAATGTGGCTTGAGAGGAAAGG - Intergenic
987474476 5:18374246-18374268 CAAAACAAACTTGAGATGAAGGG - Intergenic
987982344 5:25102377-25102399 CTAAAGCAGCTTGTGATAAGTGG - Intergenic
988461082 5:31438513-31438535 CTTAAGTAGCTTGTGAGGAGTGG + Intronic
990562700 5:56999000-56999022 TTAAAGAAGATTTAGATGAATGG + Intergenic
991083844 5:62630288-62630310 CTAAAGTATTTGGAGATAAAGGG - Intergenic
994282604 5:97923640-97923662 AAAAAGTTGCCTGAGATGAAGGG + Intergenic
995354289 5:111220755-111220777 CTAAAGTAGCAGGAGAAAAAAGG + Intergenic
996948026 5:129094028-129094050 CAGAAATAGGTTGAGATGAAGGG + Intergenic
997357120 5:133269964-133269986 TTAAAGAAACTTGAGAGGAAAGG - Intronic
997895737 5:137715277-137715299 CTAAAATAGCTTAAAATTAAGGG + Intronic
1000664095 5:163972830-163972852 AATAACTAGCTTGAGATGAAGGG - Intergenic
1001845687 5:174918604-174918626 CCAAAGTAGCCTGGGATCAAGGG + Intergenic
1002963284 6:1937739-1937761 GTTAAGGATCTTGAGATGAAGGG - Intronic
1003692191 6:8365724-8365746 CTAAAGGAGCTTGGTATAAACGG + Intergenic
1006398609 6:33802773-33802795 CCAGAGGAGCTTGAGCTGAACGG + Intronic
1007157331 6:39758013-39758035 CTAAAAAAGCTTGAGAGGAAAGG - Intergenic
1007991080 6:46256581-46256603 CTTAAGTAGTCTGAGATGTACGG + Intronic
1008156967 6:48027456-48027478 GGAAAATAGCTTGAGATGATGGG + Intronic
1011055068 6:83195086-83195108 CTAATGTTGCTGGAGATAAATGG - Intronic
1013230899 6:108161484-108161506 CTACTGAAGCTTGAGGTGAAGGG - Intronic
1016844308 6:148556107-148556129 CTCAAGTAGGGTTAGATGAATGG - Intergenic
1021357730 7:19673845-19673867 CTAAAAGATCTTTAGATGAAAGG - Intergenic
1023839267 7:44086929-44086951 CTAAGGAACATTGAGATGAAGGG + Intergenic
1026457881 7:70588818-70588840 GGAAAGCAGCTTGAAATGAAAGG + Intronic
1026673672 7:72411265-72411287 CTAAAGTAACTTGAAAAAAACGG - Intronic
1026850604 7:73720983-73721005 CCCAAGTAGCTTGAGATTACAGG + Intergenic
1027718026 7:81698777-81698799 CTAAAGTACATAGAGATTAATGG + Intergenic
1028132773 7:87196000-87196022 TTAAAATAGCCTGAGATGAGAGG - Exonic
1030990250 7:116291052-116291074 CTAAATAAACTTGAAATGAATGG + Intronic
1031619016 7:123913591-123913613 ATTAAGTTTCTTGAGATGAAGGG + Intergenic
1033429422 7:141275448-141275470 CTGCAGGAGCTTCAGATGAAAGG + Intronic
1038506210 8:28087266-28087288 TTATATTAGCTTGAGAGGAAAGG - Intergenic
1038675885 8:29622616-29622638 CAGAAGTAGCTTGGGATGATGGG + Intergenic
1043689120 8:83128326-83128348 CTAAAATGCCATGAGATGAATGG - Intergenic
1045841334 8:106585377-106585399 CTAAAGTTGCCTGAGATAACAGG - Intronic
1047535714 8:125717850-125717872 GAAAAGTAGCTTGAGTTAAAGGG - Intergenic
1047544911 8:125806267-125806289 CAAAAGTAGCTAGAAATAAATGG - Intergenic
1048387184 8:133922663-133922685 ATAAAGAAGCTTGAGCTAAACGG - Intergenic
1048735753 8:137499765-137499787 CTAAAGGAGTTTCAGTTGAATGG + Intergenic
1051394897 9:16609286-16609308 CTCAAGAAGCTTGAGCTGCAAGG + Intronic
1052478095 9:28987746-28987768 TTAAAATATCTTTAGATGAATGG - Intergenic
1057213143 9:93212228-93212250 CTAGAGTAGCCTGGGAAGAAAGG - Intronic
1060176469 9:121500544-121500566 GTAAAGTAGATTGATATGAGCGG - Intergenic
1187642511 X:21310545-21310567 TTAAAGAAGCTAGTGATGAAAGG + Intergenic
1188261728 X:28031709-28031731 ATAAAAGAGCTAGAGATGAATGG + Intergenic
1188577671 X:31672109-31672131 CAAAAATATCTTGAGATAAATGG - Intronic
1188827927 X:34859488-34859510 CAAAAGTAGCTGCAAATGAAGGG - Intergenic
1192093792 X:68188546-68188568 ATAAAGTATCTTGATATGTATGG + Intronic
1192615728 X:72620190-72620212 TTATAGTAGCTGGATATGAAAGG - Intronic
1195848362 X:109254297-109254319 CTAAAGAGACTGGAGATGAAGGG - Intergenic
1196022624 X:111006351-111006373 CTAAAGTATCTAGCGGTGAAAGG + Intronic
1196750855 X:119116166-119116188 CTAAAATAACTTGAGATGTGGGG - Intronic
1198167332 X:134070762-134070784 GTAAACTAGCCTGAGATGATGGG + Intergenic