ID: 916064146

View in Genome Browser
Species Human (GRCh38)
Location 1:161122503-161122525
Sequence AGACATCAGACTGCGGGTTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916064146_916064151 8 Left 916064146 1:161122503-161122525 CCCGAACCCGCAGTCTGATGTCT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 916064151 1:161122534-161122556 CAGAAGATACAGAGCAGAAGAGG 0: 1
1: 1
2: 3
3: 37
4: 447
916064146_916064153 20 Left 916064146 1:161122503-161122525 CCCGAACCCGCAGTCTGATGTCT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 916064153 1:161122546-161122568 AGCAGAAGAGGTTACAGTAAGGG 0: 1
1: 0
2: 1
3: 20
4: 303
916064146_916064152 19 Left 916064146 1:161122503-161122525 CCCGAACCCGCAGTCTGATGTCT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 916064152 1:161122545-161122567 GAGCAGAAGAGGTTACAGTAAGG 0: 1
1: 0
2: 0
3: 10
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916064146 Original CRISPR AGACATCAGACTGCGGGTTC GGG (reversed) Exonic