ID: 916064146

View in Genome Browser
Species Human (GRCh38)
Location 1:161122503-161122525
Sequence AGACATCAGACTGCGGGTTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916064146_916064151 8 Left 916064146 1:161122503-161122525 CCCGAACCCGCAGTCTGATGTCT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 916064151 1:161122534-161122556 CAGAAGATACAGAGCAGAAGAGG 0: 1
1: 1
2: 3
3: 37
4: 447
916064146_916064152 19 Left 916064146 1:161122503-161122525 CCCGAACCCGCAGTCTGATGTCT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 916064152 1:161122545-161122567 GAGCAGAAGAGGTTACAGTAAGG 0: 1
1: 0
2: 0
3: 10
4: 191
916064146_916064153 20 Left 916064146 1:161122503-161122525 CCCGAACCCGCAGTCTGATGTCT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 916064153 1:161122546-161122568 AGCAGAAGAGGTTACAGTAAGGG 0: 1
1: 0
2: 1
3: 20
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916064146 Original CRISPR AGACATCAGACTGCGGGTTC GGG (reversed) Exonic
903667216 1:25015460-25015482 AGAAATCAGGCTGGGGGCTCAGG - Intergenic
909195955 1:72623574-72623596 ATACATCAGTCAGCTGGTTCTGG - Intergenic
909283969 1:73791105-73791127 AAACATCAGCCTGGGGGTGCAGG - Intergenic
912802179 1:112726949-112726971 TGATACCAGACTGCGGCTTCTGG + Exonic
916064146 1:161122503-161122525 AGACATCAGACTGCGGGTTCGGG - Exonic
920180945 1:204131396-204131418 AGGCAGGAGACTGCTGGTTCTGG + Exonic
920747677 1:208644255-208644277 AAACATCTGACTGCGAGTACAGG - Intergenic
922525770 1:226302186-226302208 AAACATCAGGCTACAGGTTCTGG + Intronic
922983472 1:229848315-229848337 GGACCTCAGACTGCGATTTCTGG + Intergenic
923525500 1:234769468-234769490 AGACATCAGACAGATGGTGCTGG - Intergenic
1075864945 10:125710264-125710286 AGAGATCAGTCTGGGCGTTCTGG + Intergenic
1077156476 11:1094299-1094321 AGACATCACACTGCACCTTCTGG - Intergenic
1079849972 11:25520202-25520224 AGACAACAGACTTTGGGTTATGG + Intergenic
1083644573 11:64165116-64165138 AGGCATCAGAGTGCGGGCTTGGG + Intronic
1089683960 11:120135062-120135084 AGAGTTCAGAGTTCGGGTTCTGG - Intronic
1089757171 11:120695574-120695596 AGAGGTCAGCCTGCGGGGTCTGG + Intronic
1092906254 12:13102527-13102549 AGCCATCGGAGTGTGGGTTCAGG - Intronic
1098652346 12:72989090-72989112 AGACACCAGACTGCAAATTCAGG - Intergenic
1100272249 12:93037585-93037607 AAAAACCAGACTGCTGGTTCTGG - Intergenic
1107210592 13:37849459-37849481 AGTCATCAGACTTTGGGTTGAGG + Intronic
1113705680 13:112431593-112431615 AGAAATGAGACTGAGGGGTCAGG + Intronic
1119536382 14:75406178-75406200 AGAGATGAGACTCCAGGTTCTGG - Intergenic
1123875110 15:24616623-24616645 AAACATGAGACTGGGGGTCCAGG - Intergenic
1127106282 15:55620085-55620107 AGCCATGAGACTGGGGATTCTGG - Exonic
1130196269 15:81782853-81782875 AGACTCCAGACTGAGTGTTCAGG - Intergenic
1131452343 15:92553539-92553561 AGCCAGCAGACTGGGGATTCAGG - Intergenic
1133425248 16:5682803-5682825 ACATATCAGACTGCCAGTTCTGG - Intergenic
1138993896 16:62425022-62425044 AGACATCAGTGTGCAAGTTCAGG - Intergenic
1140811547 16:78583660-78583682 AGCCATCAGGCAGCGGGTTGGGG + Intronic
1143516445 17:7421470-7421492 GGACATGAGACGGCGGCTTCGGG + Exonic
1143983252 17:10889150-10889172 AGACATCAGAATCAGGGTTGTGG - Intergenic
1146702357 17:34972339-34972361 AGACATCAGTGTGCAGGTTCTGG + Intronic
1147263543 17:39222432-39222454 AGAGATCAGACTGTGGCTACAGG + Intronic
1148958061 17:51370226-51370248 AGTCACCTGACTGTGGGTTCTGG + Intergenic
1151966642 17:77434941-77434963 CGACATCAGGCTGCCGGTGCTGG + Intronic
1156334783 18:36160075-36160097 AGACATCAGATTGTGGGGTGGGG - Intronic
1156474074 18:37394739-37394761 AGACAGCAGACTGCTGGGTGTGG - Intronic
1158130904 18:54151511-54151533 GGACATCAGACTGGGGGGTGGGG - Intergenic
1159123774 18:64199652-64199674 AGACTTAAGACTCTGGGTTCAGG - Intergenic
1161535616 19:4817138-4817160 ACACATCGCCCTGCGGGTTCGGG - Exonic
1165925608 19:39324321-39324343 TAACATCAGACTGCTGGTTGGGG - Intergenic
929083928 2:38149035-38149057 AGACCTCAGACTGAGGGTCAGGG - Intergenic
932265565 2:70364630-70364652 ACACATCTGACAGGGGGTTCTGG + Intergenic
934738214 2:96700812-96700834 AGACATGACAACGCGGGTTCTGG + Intergenic
948060858 2:235042524-235042546 TGACTTCACGCTGCGGGTTCAGG + Exonic
1170584818 20:17726634-17726656 AGACATCTGATTGCTGGATCTGG - Intronic
1172930836 20:38585493-38585515 AGCCATCAGACGGAGGGTCCGGG + Intronic
1184673210 22:46026536-46026558 GGACATCAGACTCTGGGTTGTGG + Intergenic
950008096 3:9704257-9704279 AGGGCTCAGCCTGCGGGTTCAGG + Intronic
951904225 3:27688315-27688337 AGACAGCGGACTGCGGGTGGAGG + Intergenic
953861154 3:46545150-46545172 AGACACCAGCGTGCGGCTTCTGG - Exonic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
961124021 3:124399661-124399683 AGAAATCAAACTGCGGATACAGG - Intronic
961647266 3:128399309-128399331 AGACATCAAAATGGGGGTGCGGG + Intronic
969622070 4:8283678-8283700 AGGGATCAGACGGCGGGTCCAGG + Intronic
972768264 4:42171712-42171734 AGACATCAGACTAAGTGTTTAGG - Intergenic
977812147 4:101368614-101368636 AGACATCAAACTGCAGATCCAGG + Intergenic
986844769 5:11739514-11739536 TGACATCAGAGTGTGGTTTCTGG - Intronic
988948708 5:36235537-36235559 AGACATCAGATTGTGCTTTCAGG + Intronic
991284406 5:64955478-64955500 AGCAATCAGACTGCTGATTCTGG - Intronic
992015232 5:72568416-72568438 AGTCTTCAGAGTGTGGGTTCTGG - Intergenic
993250829 5:85520063-85520085 TAACATCATACTGAGGGTTCAGG + Intergenic
995002970 5:107157907-107157929 AGACAGCAGACAGCTGGTGCTGG - Intergenic
995111045 5:108428848-108428870 AGACAGCAGACAGCCGGTGCTGG + Intergenic
998265098 5:140662052-140662074 AGACATTAGCCTGCAGATTCAGG + Intronic
1000311739 5:160051659-160051681 AGAAATCAGACTGGGGGTAGGGG + Intronic
1000339930 5:160269216-160269238 TGACATCACACTGCGGCCTCAGG + Intronic
1003054469 6:2805921-2805943 AGACATCAGCCTGGGGGTGCAGG - Intergenic
1010519323 6:76813071-76813093 AGAAAGGAGACTGCGGATTCAGG - Intergenic
1012723845 6:102783699-102783721 AGAGCTCAGACTGTGGCTTCAGG + Intergenic
1022695833 7:32704695-32704717 AGACACCAGACTGTGGGGTAGGG + Intergenic
1030027317 7:105337225-105337247 AGATATCACACTGGGGGTTAAGG - Intronic
1034528993 7:151683873-151683895 AGACATCAGAGGCTGGGTTCTGG - Intronic
1049012468 8:139896605-139896627 AGAGAGCAGAGTGTGGGTTCAGG - Intronic
1051346744 9:16158227-16158249 AGACATCGGACTCCGGGTTAAGG - Intergenic
1056365814 9:85903546-85903568 GGACATCAGAGTTCTGGTTCAGG - Intergenic
1056889759 9:90480304-90480326 AAAAACCAGACTGCTGGTTCTGG + Intergenic
1062701097 9:137903920-137903942 ATCCATCAGGCTGCTGGTTCTGG + Intronic
1189713893 X:43844741-43844763 GGACATCAGACTCCAGGTTTTGG + Intronic
1191090638 X:56616855-56616877 AAAGACCAGACTGCTGGTTCTGG - Intergenic
1194362797 X:92975555-92975577 AGCCATTAGCCTGCGGTTTCTGG + Intergenic
1199634140 X:149799516-149799538 AGACATGAAACTGCAGATTCAGG - Intergenic