ID: 916064150

View in Genome Browser
Species Human (GRCh38)
Location 1:161122510-161122532
Sequence TTCCAACAGACATCAGACTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916064150_916064151 1 Left 916064150 1:161122510-161122532 CCGCAGTCTGATGTCTGTTGGAA 0: 1
1: 0
2: 0
3: 18
4: 171
Right 916064151 1:161122534-161122556 CAGAAGATACAGAGCAGAAGAGG 0: 1
1: 1
2: 3
3: 37
4: 447
916064150_916064153 13 Left 916064150 1:161122510-161122532 CCGCAGTCTGATGTCTGTTGGAA 0: 1
1: 0
2: 0
3: 18
4: 171
Right 916064153 1:161122546-161122568 AGCAGAAGAGGTTACAGTAAGGG 0: 1
1: 0
2: 1
3: 20
4: 303
916064150_916064152 12 Left 916064150 1:161122510-161122532 CCGCAGTCTGATGTCTGTTGGAA 0: 1
1: 0
2: 0
3: 18
4: 171
Right 916064152 1:161122545-161122567 GAGCAGAAGAGGTTACAGTAAGG 0: 1
1: 0
2: 0
3: 10
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916064150 Original CRISPR TTCCAACAGACATCAGACTG CGG (reversed) Exonic