ID: 916066126

View in Genome Browser
Species Human (GRCh38)
Location 1:161137144-161137166
Sequence AACAGCCTGTAGAAGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916066121_916066126 9 Left 916066121 1:161137112-161137134 CCTTGCCACGCCTTCCTACAGGA No data
Right 916066126 1:161137144-161137166 AACAGCCTGTAGAAGGTTGAAGG No data
916066122_916066126 4 Left 916066122 1:161137117-161137139 CCACGCCTTCCTACAGGAGCAAG No data
Right 916066126 1:161137144-161137166 AACAGCCTGTAGAAGGTTGAAGG No data
916066124_916066126 -5 Left 916066124 1:161137126-161137148 CCTACAGGAGCAAGAATAAACAG No data
Right 916066126 1:161137144-161137166 AACAGCCTGTAGAAGGTTGAAGG No data
916066123_916066126 -1 Left 916066123 1:161137122-161137144 CCTTCCTACAGGAGCAAGAATAA No data
Right 916066126 1:161137144-161137166 AACAGCCTGTAGAAGGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916066126 Original CRISPR AACAGCCTGTAGAAGGTTGA AGG Intergenic
No off target data available for this crispr