ID: 916069587

View in Genome Browser
Species Human (GRCh38)
Location 1:161162052-161162074
Sequence CAACATGACCAGAGCCCAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916069587_916069589 -8 Left 916069587 1:161162052-161162074 CCTTCTGGGCTCTGGTCATGTTG 0: 1
1: 0
2: 3
3: 21
4: 218
Right 916069589 1:161162067-161162089 TCATGTTGGCCTTCGAAACCTGG 0: 1
1: 0
2: 0
3: 4
4: 75
916069587_916069592 1 Left 916069587 1:161162052-161162074 CCTTCTGGGCTCTGGTCATGTTG 0: 1
1: 0
2: 3
3: 21
4: 218
Right 916069592 1:161162076-161162098 CCTTCGAAACCTGGGAAACACGG 0: 1
1: 0
2: 0
3: 14
4: 131
916069587_916069590 -7 Left 916069587 1:161162052-161162074 CCTTCTGGGCTCTGGTCATGTTG 0: 1
1: 0
2: 3
3: 21
4: 218
Right 916069590 1:161162068-161162090 CATGTTGGCCTTCGAAACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916069587 Original CRISPR CAACATGACCAGAGCCCAGA AGG (reversed) Exonic
900727478 1:4226476-4226498 CAAAATGAAAAGAGCTCAGAAGG - Intergenic
902862863 1:19258404-19258426 CAACATGACCAGGGCAGAGAGGG + Intronic
904888651 1:33761370-33761392 CTACATGGGCAGATCCCAGATGG + Intronic
905859487 1:41340444-41340466 CAACATGACTAGAGTTCACAGGG - Intergenic
906667181 1:47630277-47630299 CAACATGAGCAGAGACATGAAGG + Intergenic
906726607 1:48048925-48048947 CAGCATCACCAGAGGCCAGCGGG - Intergenic
913238782 1:116809119-116809141 GAAGATGACCTGAGCCCAGCAGG + Intergenic
915506665 1:156361345-156361367 CAGGATCACCAGAGCCCAGGAGG + Intronic
915968972 1:160338971-160338993 CAAAATCACCAGAGACAAGATGG + Intronic
916069587 1:161162052-161162074 CAACATGACCAGAGCCCAGAAGG - Exonic
916214177 1:162381994-162382016 CAGGCTCACCAGAGCCCAGAGGG - Exonic
920194759 1:204219554-204219576 CTGAATGAACAGAGCCCAGATGG - Exonic
920223400 1:204420874-204420896 CAGCATAACCATAGCCCAGAAGG - Intergenic
921124952 1:212169293-212169315 CAACAGAAACAGATCCCAGAAGG + Intergenic
922053420 1:222017080-222017102 CCACATGACCCTAGCCAAGAAGG - Intergenic
923271548 1:232359403-232359425 CAAAGTGACCAGTGCCAAGAAGG - Intergenic
1062907596 10:1189307-1189329 CAACTGGACCAGCTCCCAGAAGG - Intronic
1063890819 10:10626553-10626575 CAAAAAGACTAGAGCCTAGAGGG - Intergenic
1065348122 10:24768742-24768764 CAGCATGAACAAAGCACAGAAGG + Intergenic
1065794403 10:29292547-29292569 CTACAACACCACAGCCCAGACGG + Exonic
1065948154 10:30626213-30626235 CTACAACACCACAGCCCAGACGG - Exonic
1066665021 10:37774180-37774202 CAACAGGAGCATGGCCCAGATGG + Intergenic
1067787675 10:49262558-49262580 CCACATGACCAGACCCCAGCAGG + Intergenic
1070429722 10:76325272-76325294 CCATTTGCCCAGAGCCCAGACGG - Intronic
1076911512 10:133392379-133392401 CAATTTGAACAGAGACCAGAGGG - Intronic
1078508360 11:11968149-11968171 CAACATGACCAGAGGACATGGGG + Intronic
1080238527 11:30099650-30099672 CTTGAGGACCAGAGCCCAGAAGG - Intergenic
1080256334 11:30295142-30295164 CTGCATGTGCAGAGCCCAGAGGG + Intergenic
1081989076 11:47327941-47327963 ACACATGTCCACAGCCCAGAAGG - Intronic
1082824074 11:57565452-57565474 CAAGATCACCTGAGCCCAGGAGG - Intronic
1082912723 11:58395302-58395324 CAACAGCTCCAGAGCTCAGAGGG + Intergenic
1083398970 11:62411041-62411063 CAACATGGCCAGTGCCCTAAGGG - Intronic
1084023237 11:66430978-66431000 GAAGATCACCTGAGCCCAGAAGG + Intergenic
1084552496 11:69854271-69854293 GAGGATCACCAGAGCCCAGAAGG - Intergenic
1085307498 11:75496222-75496244 CACCATGACCACTGCCCAGCTGG - Intronic
1087416405 11:97861653-97861675 CAAAATGAACACATCCCAGAAGG - Intergenic
1087696913 11:101389781-101389803 CAGTATGACCAAAGCACAGAAGG - Intergenic
1088275036 11:108076120-108076142 GAAGATCACCTGAGCCCAGAGGG - Intronic
1089659868 11:119978800-119978822 CCACACGACCAGAGCCTGGAGGG + Intergenic
1091251274 11:134146250-134146272 CAACACCAGCAGATCCCAGAAGG - Intronic
1092475796 12:8818096-8818118 CCTCATGAGCAGAGACCAGATGG - Intergenic
1092971201 12:13696980-13697002 CAAAATGACCAAAACCCAGCAGG + Intronic
1093604797 12:21076923-21076945 CCATATAACCAGAGCCCAGCTGG - Intronic
1093623850 12:21323473-21323495 GAAGATCACCTGAGCCCAGAAGG + Intronic
1096181096 12:49550757-49550779 GAGCAGGCCCAGAGCCCAGATGG + Intronic
1096219601 12:49820795-49820817 AAACAAGAGCAGAGCCCAGTGGG - Intronic
1096871283 12:54593990-54594012 GAACATGTCCAGAGCCCAAGGGG - Intergenic
1100775326 12:97967067-97967089 CAAAATGATCAGGGCCCAGTTGG - Intergenic
1101412194 12:104478837-104478859 CCAAATGACCAGAGACTAGATGG - Intronic
1101639990 12:106581003-106581025 CCCCATGCCCAGTGCCCAGAAGG - Intronic
1102162504 12:110781124-110781146 CAGGATGACCTGAGCCCAGAAGG + Intergenic
1103105350 12:118219682-118219704 GAACATCACCTGAGCCCAGGAGG - Intronic
1103610947 12:122124019-122124041 CAACCTGACCAGAGCAGTGAGGG - Intronic
1103685597 12:122729905-122729927 CAGGATGACCAGGGCCCACAGGG + Exonic
1104732943 12:131118626-131118648 CAAAATGTCCAGAGCACAGCTGG - Intronic
1105015845 12:132786491-132786513 AGACTTGACCAGCGCCCAGAAGG - Exonic
1106403887 13:29456669-29456691 AGAAATGAACAGAGCCCAGAAGG + Intronic
1106667854 13:31871180-31871202 GAACATGACCTCAGCTCAGATGG - Intergenic
1106699994 13:32219176-32219198 GAACATGACTTGAACCCAGAAGG - Intronic
1106738706 13:32615712-32615734 CAACATGTCCAGAGCTCACATGG - Intronic
1108118050 13:47151774-47151796 CTACATGACCAGTCCCCAGTGGG + Intergenic
1109479290 13:62928190-62928212 CAACCTGTGCAAAGCCCAGAAGG + Intergenic
1109551104 13:63901811-63901833 CAACAGGACCACAGCCTAGGTGG + Intergenic
1109890260 13:68602514-68602536 CAGCCTGACCAGGTCCCAGATGG + Intergenic
1114533025 14:23407205-23407227 CAAGATGACCGATGCCCAGATGG - Exonic
1116696656 14:48186694-48186716 AAACCTTAGCAGAGCCCAGATGG + Intergenic
1117512323 14:56465444-56465466 CAACATGCTCAAAGCCCAGATGG + Intergenic
1118917316 14:70118466-70118488 CAACATGGCCAGAGCTGAAAAGG - Intronic
1119641730 14:76320455-76320477 CAACATGATCACTGCCCAGGGGG - Intronic
1122207741 14:100156646-100156668 CAAAGAGCCCAGAGCCCAGAGGG + Intronic
1122695144 14:103548783-103548805 CAGCAGGAGCAGAGCCCAGGGGG - Intergenic
1123721241 15:23063757-23063779 CAGCCTGTGCAGAGCCCAGAGGG + Intergenic
1125098609 15:35883776-35883798 CAACGAGCCCAGAGCCCAGTTGG - Intergenic
1126227711 15:46290216-46290238 CAGCCTGTGCAGAGCCCAGAGGG - Intergenic
1127266841 15:57369251-57369273 GAAGATGACCTGAGCCCATAAGG - Intergenic
1127994062 15:64142236-64142258 GAACATCACCTGAGCCCAGGAGG + Intronic
1128416841 15:67454360-67454382 GATCAAGACCAGAGCCAAGATGG - Intronic
1130419753 15:83733262-83733284 CAACTAGGCCAGAGCCCAGCAGG + Intronic
1132230844 15:100182769-100182791 CAAAACAACCAGAGACCAGAGGG - Intronic
1132409336 15:101564878-101564900 CCTGATGACCACAGCCCAGAAGG + Intergenic
1132918580 16:2369402-2369424 CAACATGAGCAAAGCCAAGGTGG - Intergenic
1133827159 16:9288312-9288334 AAACACGACCACAGCCCAGTGGG - Intergenic
1136703901 16:32169646-32169668 GAACATGATCAGAGGCCAGGCGG + Intergenic
1137595760 16:49722482-49722504 CCACATCCCTAGAGCCCAGAGGG + Intronic
1137637138 16:49996365-49996387 CAGCATGAGCAGAGACCAGCAGG + Intergenic
1138284024 16:55794269-55794291 CAGGATGAGCAGAGTCCAGAGGG + Intergenic
1138284978 16:55802718-55802740 CAGGATGAGCAGAGTCCAGAGGG - Intergenic
1140042210 16:71415664-71415686 CCACATGTCCAGAGACCAGTGGG + Intergenic
1140216910 16:73015926-73015948 CAACATGGCCAGTGCCCGTATGG - Intronic
1140295122 16:73702339-73702361 CAGCATCAGCACAGCCCAGATGG + Intergenic
1203066155 16_KI270728v1_random:1020082-1020104 GAACATGATCAGAGGCCAGGTGG - Intergenic
1143266247 17:5640135-5640157 CAACAAGCCCAGAGCCCAGCAGG - Intergenic
1144554292 17:16268156-16268178 CTACATGACCTGAGCCGAGATGG + Intronic
1145776964 17:27535956-27535978 CATCATGGCCAGACCCCACAGGG - Intronic
1145900342 17:28486885-28486907 CAAAATCACCTGAGCCCAGGAGG - Intronic
1148330071 17:46808948-46808970 CTACATGACCTGAGCCAAGTGGG + Intronic
1148769477 17:50058577-50058599 CAGCCTGCCAAGAGCCCAGAAGG + Intronic
1149547062 17:57511494-57511516 CAGCAGGACTTGAGCCCAGATGG - Intronic
1149563788 17:57627781-57627803 CAACATCAACACAGCCCAGAAGG - Intronic
1149586151 17:57788440-57788462 CAACATGACCACAGACTAGTAGG + Intergenic
1150117771 17:62569319-62569341 CAACATGTCAATATCCCAGATGG - Intronic
1150141915 17:62737477-62737499 CAAGAGGAGCAGAGCCCAGCAGG + Intronic
1150272238 17:63873946-63873968 CAACATGGCCTGCGGCCAGAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151141102 17:71993011-71993033 CAGCCTGTGCAGAGCCCAGAGGG + Intergenic
1151483370 17:74383497-74383519 GTACATGTCCAGAGCCCAGAGGG - Intergenic
1151534402 17:74730539-74730561 CAGCACTACCAGAGCCCAGCCGG - Intronic
1154386628 18:13898243-13898265 CAACATCACCAAAGGCCACAGGG - Intronic
1155373873 18:25135023-25135045 CAACTTGACAGGAGCCCACAAGG + Intronic
1155890480 18:31262032-31262054 CCACATGCCCAGAGCCAGGAGGG + Intergenic
1160886376 19:1350882-1350904 CAGGATGACTTGAGCCCAGAAGG - Intergenic
1161651729 19:5489967-5489989 CCACAGCACCACAGCCCAGAGGG + Intergenic
1161669056 19:5594527-5594549 CTTCAAGACCACAGCCCAGAAGG + Intronic
1163646905 19:18494772-18494794 CCACCTGGTCAGAGCCCAGAAGG - Intronic
1163848625 19:19651234-19651256 CAGCCTGACCAGACCCCAGGCGG - Intronic
1165113555 19:33515477-33515499 AAACATGACCACATCCCAGATGG + Intronic
1168407797 19:56120078-56120100 CAAGGTGACCAGACCCCTGATGG - Intronic
925189895 2:1874503-1874525 CATCATGCCCTGAGCCCACATGG - Intronic
926098077 2:10095561-10095583 CAAAAGGCCCAGAGCCCAGCTGG + Intergenic
926109890 2:10175186-10175208 GAGCATGGCCAGTGCCCAGAGGG + Intronic
926381737 2:12297302-12297324 CACCATTACCAGAGTGCAGATGG + Intergenic
926836321 2:17026219-17026241 CAACAAGACAAGAGACCAGCAGG - Intergenic
928538098 2:32259183-32259205 GAAGATCACCTGAGCCCAGAAGG - Intronic
932701601 2:73996057-73996079 CAACATGAACACAGCTCAGTGGG - Intronic
936971566 2:118181374-118181396 CCATATGACCAGAGCCAAGTTGG - Intergenic
936971927 2:118184873-118184895 CCATATGACCAGAGCCAAGTTGG + Intergenic
939893409 2:147764040-147764062 CAACATGACTAGTGGCCACATGG + Intergenic
941631017 2:167884280-167884302 CAGTATGGCCAGAGCACAGAGGG - Intergenic
942540444 2:177009775-177009797 CAACATGGCCAGAGCTCAGAGGG - Intergenic
946652428 2:221908029-221908051 CAACATGCCTAGAGCTGAGATGG - Intergenic
946852533 2:223920999-223921021 CAAACTGATCAGAGACCAGAGGG + Intronic
949078671 2:242079095-242079117 CAACATAACCAGGGCACTGATGG - Intergenic
1170416681 20:16150614-16150636 GAACATCACCTGAGCCCAGAAGG - Intergenic
1171020167 20:21577522-21577544 AAACATGACCAGAGGCCAGCAGG - Intergenic
1174921482 20:54707143-54707165 CAACATGAGCAGAGGAGAGAAGG + Intergenic
1175343503 20:58251273-58251295 TATCATGAACAGAGACCAGAGGG + Intergenic
1176262995 20:64192838-64192860 CAACATAAAGAGAGGCCAGAAGG - Intronic
1180203725 21:46244050-46244072 CAACCTAACCAGAGCACCGAGGG + Intronic
1180676339 22:17588972-17588994 CAAGATCACTTGAGCCCAGATGG + Intronic
1181538949 22:23562908-23562930 CACCATGCCCAGAGACCAGATGG + Intergenic
1182631042 22:31685634-31685656 CAGCTTTACCAGGGCCCAGAAGG - Exonic
1184401733 22:44278555-44278577 CAACATGACCGCAGCCCCCAGGG + Intronic
1184651430 22:45921015-45921037 CCACAGGGCCAGAGCCCAGGAGG + Exonic
1184654605 22:45934812-45934834 CTCCATGACGAGAGACCAGAGGG - Intronic
1185084732 22:48734522-48734544 CACACTGCCCAGAGCCCAGACGG - Intronic
949894933 3:8761894-8761916 CAACAAGACCAGGTCCCAGAAGG + Intronic
952669900 3:35953799-35953821 CAGCCTGTGCAGAGCCCAGAAGG - Intergenic
953104218 3:39860342-39860364 CAGCTTGTACAGAGCCCAGAGGG + Intronic
955066917 3:55541438-55541460 CTACATGACAAGAGCCCTGGTGG + Intronic
956257265 3:67296738-67296760 CAAGAAGATAAGAGCCCAGAAGG - Intergenic
957094694 3:75767998-75768020 GAGAATGACAAGAGCCCAGAGGG + Intronic
959787281 3:110315554-110315576 TATCATGCCCAGAGTCCAGATGG - Intergenic
960278844 3:115758268-115758290 CTACATGACCAGATCCCAGAGGG - Intergenic
962152475 3:132907524-132907546 CAACATGAGCACAGACCAGCTGG - Intergenic
964571946 3:158117384-158117406 CAGGATCACCTGAGCCCAGAAGG - Intronic
965716993 3:171615464-171615486 CAATATTACCACATCCCAGAAGG + Intronic
969443675 4:7232346-7232368 CACCAGGAGCAGAGCCCACAGGG - Intronic
969682100 4:8649068-8649090 CAACCTGACCACAGCCCACGTGG + Intergenic
970396548 4:15673349-15673371 GAGGATCACCAGAGCCCAGAAGG + Intronic
970923512 4:21423042-21423064 CAACATAACCAGGGCCCAGATGG + Intronic
973084090 4:46032571-46032593 CAACCTAAGCAGAGGCCAGATGG - Intergenic
973138510 4:46736156-46736178 TAACATAAGCAGAGCACAGAGGG - Intronic
975344877 4:73282186-73282208 AAACCTGCACAGAGCCCAGAAGG - Intergenic
976632599 4:87254128-87254150 CAACTTAATCAGAGTCCAGAGGG + Intergenic
979096183 4:116553787-116553809 CAGCATATACAGAGCCCAGAGGG - Intergenic
979682705 4:123479197-123479219 CAACAGGACATGAGCCCGGAAGG - Intergenic
980768630 4:137341863-137341885 AATCATGAGCAGAGCCCAGTAGG + Intergenic
982585864 4:157237791-157237813 GAACATTAACGGAGCCCAGAGGG + Intronic
983735337 4:171051965-171051987 CCACAGGACCAGAGCAAAGATGG - Intergenic
983784883 4:171718361-171718383 CACCCTGAGCAGAGCCCAGCGGG + Intergenic
988716842 5:33836820-33836842 CAAGGTGGCCAGAGCCTAGAGGG + Intronic
995568134 5:113452825-113452847 CAACATCACCTGAGACCAAATGG - Intronic
996888620 5:128389630-128389652 CAGCCTGTGCAGAGCCCAGAGGG - Intronic
996907635 5:128619724-128619746 AGACATTACCAGACCCCAGAAGG + Intronic
998107135 5:139475825-139475847 GAACATGACCAGGAGCCAGAGGG + Intronic
1000035065 5:157440389-157440411 CATCATGACCACAGACCTGAGGG + Intronic
1000890653 5:166797820-166797842 CAACAAACCCAGAGCCCAGATGG - Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1004419947 6:15460308-15460330 CAACATGGTCAGAGGCCAGCTGG - Intronic
1004703701 6:18103032-18103054 CAAGATGCCAAGAGCACAGAAGG + Intergenic
1004806325 6:19207086-19207108 GAACATCATCTGAGCCCAGAAGG + Intergenic
1006591696 6:35162788-35162810 CTACATGAACACAGCCCAGGAGG + Intergenic
1006807597 6:36798651-36798673 GAACATGTCCAGCACCCAGAAGG - Intronic
1006906209 6:37535534-37535556 CACCAGGAGCAGAGCACAGAGGG + Intergenic
1010330084 6:74613431-74613453 GAACATCACCTGAGCCCAGGAGG - Intergenic
1011549196 6:88513899-88513921 CAAAAAGCCAAGAGCCCAGAGGG - Intergenic
1013312023 6:108903768-108903790 CAACATAAACAGAGCCTCGAAGG + Intronic
1013674547 6:112443373-112443395 GAAAGTGACCAGAGCCCAGAGGG + Intergenic
1013819713 6:114139782-114139804 CAGTATGACCAGAACCCAGGTGG - Intronic
1014388991 6:120837302-120837324 GAACAGGACAAGAACCCAGAAGG + Intergenic
1015225129 6:130849045-130849067 CAACACGGTCAGAGGCCAGATGG + Intronic
1016811394 6:148264587-148264609 CAACATGACAAGAGGCCACAAGG - Intergenic
1018058337 6:160071082-160071104 CCCCATGTCCAGAGCCCAGGAGG + Intronic
1018343920 6:162881852-162881874 CACCAAGACCAGAGACCAGGGGG + Intronic
1018344043 6:162882328-162882350 CACCATGACCAGAGACCCGGAGG + Intronic
1018368331 6:163144971-163144993 CAACATCAGCAGGGCTCAGAGGG - Intronic
1019128661 6:169858452-169858474 CAACATGATCTGAGGACAGACGG + Intergenic
1022156237 7:27664144-27664166 AAACATGAAAAGAGCCCAGATGG - Intergenic
1022186341 7:27973385-27973407 GAGGATCACCAGAGCCCAGAAGG - Intronic
1022832988 7:34086914-34086936 CAAGATGAACACAGCCCAAAAGG + Intronic
1024385709 7:48748955-48748977 CAGCAGGTGCAGAGCCCAGAGGG - Intergenic
1024709232 7:51996355-51996377 GAACATGCACAGAGGCCAGAAGG - Intergenic
1024903754 7:54352709-54352731 CATCCTGACAACAGCCCAGAAGG - Intergenic
1025150314 7:56542068-56542090 CACCATGATCAGAGGACAGATGG - Intergenic
1027569595 7:79847477-79847499 CCATAGAACCAGAGCCCAGAAGG + Intergenic
1028295448 7:89124103-89124125 CAGCTTGACCAGAAGCCAGAGGG - Intronic
1031932363 7:127698805-127698827 CAACAGCAACAGAGCCCAAATGG - Intronic
1032544688 7:132731869-132731891 CAACAAAACCAGTGCCCATAGGG + Intergenic
1033320633 7:140336334-140336356 CAAGATCACCTGAGCCCAGGAGG + Intronic
1035082914 7:156232728-156232750 CAACAGGACCAGAAGCCAGCAGG - Intergenic
1035536937 8:399116-399138 CAACATAACCAGGGCACTGATGG - Intergenic
1037360976 8:18073439-18073461 CAACATCACCTGAACCCACATGG + Intronic
1037959378 8:23084585-23084607 CAACAGGCCCAGAACCCAGCGGG + Intronic
1038295673 8:26289402-26289424 CATCTTAACCAGAACCCAGAAGG - Intergenic
1039272679 8:35899949-35899971 AAACATGAACAGAGCCCTGTTGG - Intergenic
1039768948 8:40663196-40663218 CAGCATGACTACAGGCCAGATGG - Intronic
1043131956 8:76473055-76473077 CAACCTGTGCAGAGTCCAGAGGG - Intergenic
1044429794 8:92095534-92095556 CAATATCAGCAGGGCCCAGATGG + Exonic
1045033956 8:98162995-98163017 CAGCATGTTCAGAGCCCAGTGGG - Intergenic
1045599753 8:103699314-103699336 CAAGATTACCTGAGCCCAGGGGG - Intronic
1046499854 8:115061465-115061487 CCACACGACCAGAGACCACAAGG + Intergenic
1047271834 8:123367731-123367753 TCACATGACCAGGGTCCAGAAGG - Intronic
1048476592 8:134747886-134747908 CATCAAGACCAAAGCCCAGGTGG - Intergenic
1050008392 9:1159121-1159143 CAGGATTACCTGAGCCCAGAAGG - Intergenic
1053354057 9:37431653-37431675 CTGCATGAACAGGGCCCAGAAGG - Intronic
1056520622 9:87397849-87397871 CAACATGACAACAGCCCTGACGG + Intergenic
1058424328 9:104863375-104863397 CCACATGAACTGAGCCCACATGG + Intronic
1058747734 9:108008112-108008134 CACCATGAGCAGAGCCCTGTTGG - Intergenic
1187559104 X:20383128-20383150 CATCACCACCAGAGACCAGAAGG - Intergenic
1188416762 X:29944777-29944799 CAACATGTCCAAAGACCAGGTGG - Intronic
1188886734 X:35560535-35560557 TAGCATGTGCAGAGCCCAGAGGG + Intergenic
1189257193 X:39649726-39649748 CAACATGACCCAAGCTAAGAAGG - Intergenic
1190689119 X:52898962-52898984 CAAAATCACCATAGCCCAGGTGG - Intronic
1190696864 X:52956830-52956852 CAAAATCACCATAGCCCAGGTGG + Intronic
1192152911 X:68723109-68723131 GAGCATGACCAGTGCCCAGAGGG - Intronic
1192592501 X:72372049-72372071 CAACATGACCAAAAGCCAGGTGG - Intronic
1193341653 X:80355508-80355530 CAGCCTGTGCAGAGCCCAGAAGG - Intronic
1195151177 X:102071855-102071877 CAGCTTGTGCAGAGCCCAGAAGG + Intergenic
1197261414 X:124322859-124322881 CACCATTACCAGAAACCAGAAGG - Intronic
1198431586 X:136572141-136572163 CACAATGACCTGAGCCCTGAAGG + Intergenic
1198531706 X:137554575-137554597 GAAGATCACCTGAGCCCAGAAGG + Intergenic
1199640677 X:149858274-149858296 CAGCCTGTGCAGAGCCCAGATGG + Intergenic
1199987140 X:152960820-152960842 CAACATGGGCAGGGCCTAGAGGG + Intronic