ID: 916071150

View in Genome Browser
Species Human (GRCh38)
Location 1:161170704-161170726
Sequence GAAGCAGCTGCTACACAATT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916071150 Original CRISPR GAAGCAGCTGCTACACAATT AGG Exonic
901755489 1:11439090-11439112 GAAGCAGCTGCTACCAAAGAGGG - Intergenic
903438939 1:23372626-23372648 TCAGCAGCTGCTACAGAATAGGG - Intergenic
903861742 1:26368543-26368565 GAAGAATCAGCTGCACAATTAGG - Exonic
904065531 1:27747338-27747360 GAAGCAGCTGTCACAAAAGTGGG + Intronic
906009204 1:42507777-42507799 AAACCACCTGCTTCACAATTTGG - Intronic
907347276 1:53792755-53792777 GGAACAGCTGATACACAAGTTGG + Intronic
908411156 1:63867060-63867082 GTAGTAGCTGCTACACTGTTTGG + Intronic
909780738 1:79543203-79543225 GAACCACCTGCTAAACAATTAGG + Intergenic
911097585 1:94067610-94067632 GAAACAGAAGCCACACAATTAGG - Intronic
911769594 1:101723512-101723534 GAAGCAACTAGTACACAATCAGG - Intergenic
911971135 1:104439447-104439469 AAGGCTGCTGCTACACAATGAGG - Intergenic
912434545 1:109651668-109651690 GAAGAAGCTGCAACACCTTTTGG - Intergenic
916071150 1:161170704-161170726 GAAGCAGCTGCTACACAATTAGG + Exonic
918121133 1:181541627-181541649 GCAGCAGCTGCTAAACCATGTGG + Intronic
922017698 1:221668195-221668217 GAAGCAACCGCTGCACAAGTAGG - Intergenic
922017701 1:221668254-221668276 GAAGCAACCGCTGCACAAGTAGG + Intergenic
922312152 1:224404748-224404770 TAAGCATCTACTACACTATTAGG + Intronic
922352626 1:224746745-224746767 GAAGCAGTTGCTTCCCAATGAGG + Intergenic
1063701756 10:8391499-8391521 GACGCAGCTGCTACAGAAAATGG - Intergenic
1063714692 10:8515044-8515066 GCAGCCGCTCCTACACAAGTGGG - Intergenic
1064818006 10:19288820-19288842 GAAGCAGCAGCTACAGAGTCTGG - Intronic
1065429325 10:25637795-25637817 GAAGCAGCAGCTACAAAAGCTGG + Intergenic
1068750117 10:60582790-60582812 GAAGAAGCTTCTACACAGTGAGG - Intronic
1072822035 10:98567788-98567810 GAGGCAAGTGCTACACAATTTGG - Intronic
1073405025 10:103290033-103290055 AATGCAGATGCTACACAGTTGGG - Exonic
1073665357 10:105526326-105526348 GAAAAAGATGCTACACAATAGGG - Intergenic
1074162956 10:110849113-110849135 GAAGCAGCGGCCAGAGAATTAGG + Intergenic
1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG + Intergenic
1076236065 10:128864624-128864646 CAAGCTGCTGCGACACAACTAGG + Intergenic
1081318979 11:41667414-41667436 GCAGCAGCTGCTGAATAATTAGG + Intergenic
1081451352 11:43173380-43173402 GAAGCAGCTGTTACAGAGGTGGG - Intergenic
1084980094 11:72824385-72824407 GCAGGAGCTCCTACTCAATTGGG + Intronic
1087210798 11:95444868-95444890 GAAGCAGCTCCCACTCAATCAGG - Intergenic
1089839769 11:121405717-121405739 GAAGCTGCTACAACACAAATTGG - Intergenic
1091426220 12:392014-392036 GAAGCTGATGAAACACAATTTGG - Intronic
1093431404 12:19089459-19089481 GAAGAAGCTGCAACACCTTTCGG - Intergenic
1095225539 12:39672879-39672901 GAAGGAGCTGCTTCAGATTTGGG + Intronic
1095553038 12:43467383-43467405 GCAGCAGATCCTATACAATTTGG + Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1096690583 12:53318881-53318903 GAAGCAGCAGCCACAGAAGTAGG + Intronic
1097032216 12:56097913-56097935 TAAGCAGCTGCTATACAGTGAGG + Exonic
1099231351 12:80029205-80029227 GAAGAAGCTGCAACACCTTTTGG - Intergenic
1101990924 12:109484359-109484381 GGAGCAGCTACTACACACCTCGG + Intronic
1103700967 12:122848604-122848626 GCAGCAGCTGCTACTCACATTGG - Exonic
1106296805 13:28421510-28421532 GCAGCAGCTCCTCCACCATTGGG - Intronic
1108594699 13:51939211-51939233 GCATCAGCAGCTACACAAGTTGG + Intronic
1109851871 13:68075854-68075876 GAAGGAGCTGTAACACAAATGGG + Intergenic
1110568709 13:76981580-76981602 GAAGAAGCTGCAACACCTTTCGG + Intergenic
1114248221 14:20934422-20934444 GAAGCCGCTGCTAGAGAAGTGGG - Intergenic
1116143888 14:41038106-41038128 GCAGCAGCAGCTACATTATTTGG - Intergenic
1116159697 14:41253234-41253256 GAAAGAGCTGCAACACAAATAGG - Intergenic
1117511980 14:56461427-56461449 GCAGCAGCTGCAGCCCAATTAGG - Intergenic
1118735951 14:68702173-68702195 GAAGCAGCAGCTCTACAATGGGG - Intronic
1119007179 14:70942513-70942535 GAAGCACCTGCTGCAGAAATTGG - Intronic
1119533141 14:75377530-75377552 GAGGAAACTGGTACACAATTTGG - Intergenic
1126462157 15:48925890-48925912 GAAACAGATACTACAGAATTCGG + Intronic
1126563405 15:50069901-50069923 AAAGCACCTGGTACACAGTTGGG + Intronic
1128842091 15:70858774-70858796 GCAGCTGCTCCTACACAAGTGGG + Intronic
1129946121 15:79540649-79540671 GAAGAGGCTGCTACAGAACTTGG + Intergenic
1130952047 15:88599745-88599767 GAAATATTTGCTACACAATTGGG + Intergenic
1131946235 15:97625085-97625107 GAAGCACCTGCTACTTAATTAGG + Intergenic
1133620019 16:7517487-7517509 GAAGCAGCTGATACAAATTCAGG - Intronic
1134211988 16:12285289-12285311 GAAGCAGAAGATACACAAGTGGG - Intronic
1134509868 16:14837331-14837353 TAAGCACCTGCTACAGAATATGG - Intronic
1134697515 16:16235830-16235852 TAAGCACCTGCTACAGAATATGG - Intronic
1134974328 16:18558845-18558867 TAAGCACCTGCTACAGAATATGG + Intronic
1135544999 16:23359658-23359680 GAAGCAGCAGCTGCAGAATTAGG + Intronic
1136387866 16:29941262-29941284 AAAGCAGCTGTCATACAATTGGG - Intronic
1137658623 16:50183733-50183755 GAAGCATCTGCAAAAGAATTGGG + Intronic
1138045108 16:53714136-53714158 AGAGCAGCTGCAACATAATTTGG - Intronic
1139171944 16:64641120-64641142 GATGCAGCTGCTACAGAAAACGG - Intergenic
1143939550 17:10525773-10525795 GAAGCAGCGGCTGCAGAATGAGG - Exonic
1145886138 17:28383836-28383858 GAAGGAGGTGCTAATCAATTTGG + Intronic
1148647495 17:49227521-49227543 GAAGCAGCTGGGACAAGATTTGG + Intronic
1148973209 17:51502897-51502919 GAAGAAGCTGCAACACCTTTCGG + Intergenic
1149211746 17:54311451-54311473 GAGACAGCTGCTACTCAATGGGG - Intergenic
1153254598 18:3157825-3157847 CTAGCAGCTGCTACACAGTGTGG + Intronic
1157581425 18:48776270-48776292 GAAGCAGCTGGTGCACAAAGAGG - Intronic
1161829724 19:6593641-6593663 AAAGAAGCTGCAACACATTTCGG - Intronic
1164929510 19:32164676-32164698 GAAGCAGCTGGTAGAAAAATTGG + Intergenic
1167787704 19:51649181-51649203 GAAGAAGCTGCAACACCTTTCGG - Intergenic
1167961503 19:53108122-53108144 GAAGCCTCTGCCACACAGTTAGG + Exonic
925962567 2:9031895-9031917 ATGGCAGATGCTACACAATTTGG - Intergenic
929092367 2:38231882-38231904 GAAGAAGCTGCAACACCTTTCGG - Intergenic
933698427 2:85237435-85237457 GGAGCAGCTGCTCCACACTGTGG - Intronic
934930708 2:98420397-98420419 GAGGCAGCTAGTACAGAATTTGG - Intergenic
935603503 2:104946717-104946739 TAAGCACCTGCTACACATTTGGG + Intergenic
938256188 2:129861720-129861742 GCAGCAGCTGCTACTCACTGGGG - Intergenic
938699715 2:133865331-133865353 GAAGCAGGTGCAACAGAATCTGG - Intergenic
939311982 2:140491975-140491997 GCAGCAGCTGCTACACAGCTTGG + Intronic
940143364 2:150520429-150520451 GAATTAGCTGCTAAAGAATTAGG - Intronic
941250243 2:163152655-163152677 GAAGAAGCTGCAACACCTTTCGG + Intergenic
943064568 2:183072349-183072371 GAAGCTGCTGCTGCCCACTTGGG + Intergenic
946243212 2:218369352-218369374 GAAGCAGCTGCTCAACGTTTTGG + Intergenic
1169165178 20:3416470-3416492 GAAGCAGCTGGGTCACATTTTGG + Intergenic
1170512532 20:17093266-17093288 GAAGGTGCTCCTACACAAGTGGG - Intergenic
1175039974 20:56039761-56039783 GTAGCAGCTTCTACATAATTTGG + Intergenic
1176425928 21:6548194-6548216 GAAGCAGCTGCGGCACCATCCGG - Intergenic
1178495678 21:33084123-33084145 GTAGCAGCCGCTACAAAATGGGG - Intergenic
1179701419 21:43156511-43156533 GAAGCAGCTGCGGCACCATCCGG - Intergenic
1180579980 22:16825101-16825123 GAAGCAGCTGCTTAGCATTTGGG - Intergenic
1183794712 22:40106728-40106750 GAAGAAGCTGCAACACCTTTCGG + Intronic
1184128807 22:42505125-42505147 GAAGCAGCTGCTGCAGAGGTGGG + Intergenic
1184137602 22:42558440-42558462 GAAGCAGCTGCTGCAGAGGTGGG + Exonic
952228489 3:31404114-31404136 TCACCAGCTGCTACACAATGAGG - Intergenic
954114366 3:48457293-48457315 GAAGCATGTTCTCCACAATTTGG + Exonic
954294677 3:49667694-49667716 GAAGCATCTGCTGGACAAGTCGG + Exonic
957884554 3:86269266-86269288 GAAGAAGCTGATAAAGAATTAGG - Intergenic
957966042 3:87323329-87323351 GCAGCAACTCCTACACAAGTGGG + Intergenic
961095494 3:124152357-124152379 GAAGAAGCTGCAACACCTTTCGG + Intronic
962763735 3:138542488-138542510 GAAACAGCTGTAACACAAATGGG - Intronic
967594231 3:191311630-191311652 GAAGATGCTGCTACAGAACTAGG - Intronic
971956843 4:33431196-33431218 GAAGCAGCTGATACTCTAGTTGG - Intergenic
974761752 4:66285441-66285463 GAATAAGCTGCAACACAAATAGG - Intergenic
977549055 4:98421254-98421276 GCAGAAGCTGCTGAACAATTGGG + Exonic
982609478 4:157555414-157555436 GAAAGAGATGCTACACAGTTAGG - Intergenic
985007742 4:185550980-185551002 CAAACAGCTGCTGCCCAATTTGG + Intergenic
985208115 4:187562500-187562522 GAAGCAGCTTTTACACAACCTGG + Intergenic
985305884 4:188539072-188539094 GACTCAGCTGTTCCACAATTAGG - Intergenic
989149866 5:38288793-38288815 GAAGCAGTTGCTCAACAATTTGG - Intronic
989214854 5:38893110-38893132 GAGCCAGCTGCTACACAAGTAGG - Intronic
992523546 5:77582690-77582712 GAAGAAGCTGCAACACCTTTCGG - Intronic
992821401 5:80500644-80500666 GAAGAAGCTGCAACACCTTTCGG - Intronic
996176850 5:120369184-120369206 GAAGGAGCTGCAACACAAACGGG + Intergenic
996433054 5:123402206-123402228 AAAGCAGCTGCTGCCCACTTGGG + Intronic
997744230 5:136284825-136284847 GAAGGAGCTGCAAAACATTTGGG + Intronic
999411811 5:151356772-151356794 GAAGAACATGCTACACAACTGGG + Intergenic
1001458348 5:171885485-171885507 GAAGCTGCTGCCCCACAAATTGG - Intronic
1001692487 5:173643437-173643459 GAAGCTGATGCAACAGAATTGGG + Intergenic
1002384919 5:178859700-178859722 AAAACAACTACTACACAATTGGG - Intergenic
1002681824 5:180970627-180970649 CAAGCAGCTGCTGCACCACTCGG - Intergenic
1002783627 6:384984-385006 GGAGCTGCTGCTATACAATGGGG + Intergenic
1003669348 6:8141594-8141616 GAAGCAGCAGCTACAGAAACAGG + Intergenic
1005219203 6:23566655-23566677 GCAGCATCTGCTACACATTCTGG - Intergenic
1005793581 6:29332659-29332681 GAGTCAGCTGCCACACAAGTAGG - Intergenic
1005961538 6:30697217-30697239 GAAGAAGCTGCAACACCTTTCGG + Intergenic
1007483308 6:42164019-42164041 GGAGCAGCTGCTGCAGAATGAGG + Intronic
1007768650 6:44176617-44176639 GATGCAGCTGCTGCACAAGACGG + Exonic
1011353350 6:86447012-86447034 GAAGCAGCAGCTAGACATTGGGG - Intergenic
1011816679 6:91199463-91199485 GAACCAGATGTCACACAATTTGG - Intergenic
1012487735 6:99740898-99740920 GAAGCAGCTGGATCACAAATTGG + Intergenic
1015112494 6:129609283-129609305 GGACCAGCTGCTGCATAATTTGG + Intronic
1023981536 7:45073444-45073466 GAAGCAGCTGCGAAAGAATGTGG - Exonic
1024959605 7:54960387-54960409 GAAGCAGATGATACATGATTGGG + Intergenic
1026866390 7:73826634-73826656 AAAGCAGCTGCTGCGCAGTTCGG - Intronic
1028136807 7:87230913-87230935 AAAGGAGCTGCTACCCACTTCGG + Intergenic
1029056082 7:97744241-97744263 CTAGCAGCTGTTACCCAATTTGG + Intergenic
1029369601 7:100140353-100140375 GAAGAAGCTGCAACACCTTTCGG + Intergenic
1029913889 7:104186118-104186140 ACAGCAACTGGTACACAATTTGG + Intronic
1030353012 7:108510544-108510566 GAAGAAGCTGCAACACCTTTCGG - Intronic
1031195757 7:118610947-118610969 GAGGCAGCTGGTACCCATTTTGG - Intergenic
1041384223 8:57280824-57280846 GAAGCACCTCCTTCAGAATTGGG + Intergenic
1044806168 8:96010550-96010572 GAGGCAGCAGTTACACAATGAGG + Intergenic
1047629021 8:126685667-126685689 GAAGCAGCTGCTACATCACTAGG + Intergenic
1048548435 8:135408501-135408523 GAAACAGCTGATTCACAACTGGG - Intergenic
1055620256 9:78118030-78118052 GATGCAGCTTTTACACATTTGGG - Intergenic
1057734300 9:97639686-97639708 GATGCTGCTGCTAAACACTTTGG - Intronic
1057845168 9:98517274-98517296 GAAGAAGCTGACACACAATGAGG - Intronic
1058270622 9:102967786-102967808 AAAGAAGCAGCTACCCAATTTGG - Intergenic
1060158093 9:121334279-121334301 CAAGCAGCTGCTACAGGATGTGG - Intergenic
1060302387 9:122382778-122382800 GAAGAAGCTGCCATATAATTAGG + Intronic
1062201522 9:135305421-135305443 GAAGACGCTGCTGCACATTTGGG - Intergenic
1062571797 9:137189130-137189152 GAAGCAGCGGCTGCAGAATGAGG + Exonic
1187792305 X:22964262-22964284 CAGCCAGCTGCTACACAAATGGG + Intergenic
1188151966 X:26687524-26687546 GAAGAAGCTGCAACACCTTTCGG - Intergenic
1189585815 X:42460825-42460847 TAAGCAGCTGGTAAGCAATTAGG + Intergenic
1198453425 X:136791348-136791370 GAAGAAGCTGCAACACCTTTCGG - Intergenic