ID: 916074614

View in Genome Browser
Species Human (GRCh38)
Location 1:161193280-161193302
Sequence GGGGCCACGCCTGTGTAGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916074603_916074614 19 Left 916074603 1:161193238-161193260 CCCAGTGCCTGGGCCTGGCAGGT 0: 1
1: 0
2: 3
3: 37
4: 361
Right 916074614 1:161193280-161193302 GGGGCCACGCCTGTGTAGCGAGG 0: 1
1: 0
2: 1
3: 7
4: 66
916074605_916074614 12 Left 916074605 1:161193245-161193267 CCTGGGCCTGGCAGGTGAGTTTG 0: 1
1: 0
2: 1
3: 24
4: 299
Right 916074614 1:161193280-161193302 GGGGCCACGCCTGTGTAGCGAGG 0: 1
1: 0
2: 1
3: 7
4: 66
916074606_916074614 6 Left 916074606 1:161193251-161193273 CCTGGCAGGTGAGTTTGCACTGG 0: 1
1: 0
2: 2
3: 21
4: 359
Right 916074614 1:161193280-161193302 GGGGCCACGCCTGTGTAGCGAGG 0: 1
1: 0
2: 1
3: 7
4: 66
916074604_916074614 18 Left 916074604 1:161193239-161193261 CCAGTGCCTGGGCCTGGCAGGTG 0: 1
1: 0
2: 7
3: 67
4: 459
Right 916074614 1:161193280-161193302 GGGGCCACGCCTGTGTAGCGAGG 0: 1
1: 0
2: 1
3: 7
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916074614 Original CRISPR GGGGCCACGCCTGTGTAGCG AGG Exonic
900906037 1:5558431-5558453 AGGGCCACACCTTTGTAGTGGGG + Intergenic
903278050 1:22233960-22233982 GGGGCCACGGCTGCCCAGCGAGG - Intergenic
906319459 1:44807361-44807383 GGGGCCAGGGCTGTGCAGCCAGG - Intergenic
916074614 1:161193280-161193302 GGGGCCACGCCTGTGTAGCGAGG + Exonic
1065135135 10:22660066-22660088 GGGCCCACATCTGTGTAGCAAGG - Intronic
1065455015 10:25898296-25898318 GGGGCCAGGCATGTGTAACATGG + Intergenic
1067993321 10:51240714-51240736 GGGGCCTCCTCTGTGTAGCCTGG + Intronic
1069848608 10:71390545-71390567 GAGGCCACCCCTCTGCAGCGTGG - Intergenic
1075086673 10:119418464-119418486 GGGGACACAGCTGTGTAGCCTGG - Intronic
1076340378 10:129741397-129741419 GTGGCCACGCGTGTGGTGCGAGG + Intronic
1076438748 10:130464649-130464671 CGGCCCAGGCCTGTGTGGCGTGG - Intergenic
1076685640 10:132197391-132197413 GAGGCCCCTCCTGTGGAGCGGGG + Intronic
1077010410 11:376869-376891 GGGGCCTCGGCTGTGTGGCCTGG - Exonic
1077063089 11:626252-626274 GAGGCAACCCCTGTGTAGCGGGG - Intergenic
1079101440 11:17544444-17544466 GGGGCCAGGCCTCTGTGGGGCGG + Intergenic
1084717212 11:70881771-70881793 GGGGCCACGGCACTGTAGCCTGG - Intronic
1089565795 11:119370919-119370941 TGGGCCATGCCTGTGTGGGGAGG + Intronic
1092054672 12:5499084-5499106 GGGGCCAGGGCTGTGGAGGGTGG - Intronic
1094871232 12:34600310-34600332 GGTGCCACGCCTGTGTGGTTGGG - Intergenic
1096677574 12:53233836-53233858 GGCGCCCCGCCTGTGTGGCAGGG + Intergenic
1112271822 13:97976246-97976268 GGGGCCAGGGCTGCGTCGCGGGG - Intronic
1113647752 13:112011110-112011132 GGGGCCAGGCCTGGGCAGAGGGG - Intergenic
1121452947 14:94020993-94021015 AGGGCCTGGCCTGTCTAGCGGGG - Intergenic
1122886345 14:104712107-104712129 GGGGCCCGGACTGTGTAGTGGGG - Intronic
1131063132 15:89416697-89416719 GGGGCCTGGCCTGGGAAGCGCGG + Intergenic
1132604850 16:789351-789373 GGGGCCACGGGTGTGTGGCTTGG + Exonic
1134114078 16:11535057-11535079 GGTGCCAAGCCTGTGTCTCGAGG - Intergenic
1147904962 17:43816637-43816659 GGGGCCACGCCTGTGGACAGCGG + Intronic
1147964468 17:44186789-44186811 GGGGCCACGCCTGGTGGGCGGGG - Intergenic
1152689539 17:81711915-81711937 GGGGCCACGTGTGTGCGGCGTGG - Intergenic
1153922443 18:9803827-9803849 GGGGCCACGTCTGTGGACCGAGG - Intronic
1160417275 18:78720190-78720212 GGGGAGAGGCCTGTGTAGGGAGG - Intergenic
1160428449 18:78794281-78794303 GGAGCCACACCCGTGTAGCAGGG + Intergenic
1161514645 19:4689784-4689806 GGGCCCACTCCTGTGGGGCGTGG - Intronic
1162218635 19:9157530-9157552 GGGGCCTCTCCTGGGTATCGAGG + Intronic
1162515050 19:11142715-11142737 GGGGCCAGGCATGTGGAGTGGGG + Intronic
1162747383 19:12806372-12806394 GGGGCCCCGCCTGCGTGGCCCGG - Intronic
1163324470 19:16594331-16594353 GGGGCCACTGCTGTGTGGCTGGG - Intronic
1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG + Intronic
1168171789 19:54594526-54594548 GGGGCCACCCCCGTGCAGCTGGG + Intronic
1168689509 19:58368343-58368365 GGGGCCACGCCGGTGGCGCTCGG + Exonic
925959785 2:9003824-9003846 CGGGCCGCGCCTGTGCAGGGCGG - Intergenic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
926321171 2:11749280-11749302 GGGCCCATGCCTGTGTGTCGAGG + Intronic
937976937 2:127588228-127588250 GGGGCCATGCCTGGGTAGAGGGG + Intronic
937977264 2:127589492-127589514 GGGGCCACGCCTGGGTAGAGGGG + Intronic
945392155 2:209277521-209277543 GGGTCCACACCTGTGGAGGGGGG + Intergenic
948381305 2:237551596-237551618 GGGGCCATGGCTGTGTAGCTGGG - Intronic
1173004921 20:39132922-39132944 GGGGCCACCCCTGGGGAGTGGGG + Intergenic
1184164772 22:42720768-42720790 GGGGCCGCGCCGATGTTGCGGGG - Intronic
1185135503 22:49069500-49069522 GGGTACACACCTGTGCAGCGTGG + Intergenic
952166309 3:30753172-30753194 GGGGTGGGGCCTGTGTAGCGTGG - Intronic
953819899 3:46198581-46198603 GGTGCCAAGACTGTGTAGAGCGG + Intronic
954084867 3:48236302-48236324 GGGGCCAGGCATGTCTAGCATGG + Intergenic
954698595 3:52440341-52440363 GGGGCCAGGCCAGGGAAGCGAGG - Intronic
968447072 4:657528-657550 GGGGTCACGGCTGTGTGGCAGGG + Intronic
968447231 4:658033-658055 GGGGTCACGGCTGTGTGGTGGGG + Intronic
968447280 4:658193-658215 GGGGTCACGGCTGTGTGGCGGGG + Intronic
968447301 4:658262-658284 GGGGTCACGGCTGTGCGGCGGGG + Intronic
968447341 4:658394-658416 GGGGTCACGGCTGTGTGGCAGGG + Intronic
969791763 4:9497969-9497991 GGGGCCAGGCCTGGGCACCGGGG - Intergenic
985672315 5:1213177-1213199 GGGGCCAGGCCTGTGGAGTCCGG - Intronic
985807081 5:2053772-2053794 GGGCCCACCCCTGTGCAGCAAGG - Intergenic
993049766 5:82912845-82912867 GGAGGCAAGCCTGTGTTGCGTGG + Intergenic
998131724 5:139654880-139654902 GGGGCCAGGCTGGGGTAGCGTGG + Intronic
999644271 5:153702393-153702415 GGGGCCACCCCTGTGAAACAAGG + Intronic
1001743433 5:174071858-174071880 GGAGCCATTCCTGTGTAGCCGGG - Intronic
1019233015 6:170584547-170584569 GGGGCCAGGCCTGTGGAGCTGGG - Exonic
1035546040 8:483191-483213 GGGGCCAAACCTGGGGAGCGTGG - Intergenic
1036092037 8:5676861-5676883 TGTGCCACGCCTGGGTAGCCAGG - Intergenic
1045231439 8:100310292-100310314 GGGGCCACCCGGGTGCAGCGGGG - Intronic
1056711443 9:88994903-88994925 TGGGCCAAGCCTGTGCAGCTGGG + Exonic
1057950595 9:99366346-99366368 TGGGCCAGGCCTGGGTGGCGGGG - Intergenic
1191861402 X:65668602-65668624 GGGGCCACACCTTTCTAGAGTGG + Intronic
1194067296 X:89277186-89277208 GGGGCCACCCCTATGGAGCAGGG + Intergenic