ID: 916075631

View in Genome Browser
Species Human (GRCh38)
Location 1:161198541-161198563
Sequence CACAATGGGGAGCAGGAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 430}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916075624_916075631 -7 Left 916075624 1:161198525-161198547 CCAGCCAGGAGAGCGGCACAATG 0: 1
1: 0
2: 1
3: 4
4: 91
Right 916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG 0: 1
1: 0
2: 1
3: 39
4: 430
916075620_916075631 17 Left 916075620 1:161198501-161198523 CCAGCAGTAGCAGAAGCAGCCAC 0: 1
1: 0
2: 6
3: 60
4: 450
Right 916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG 0: 1
1: 0
2: 1
3: 39
4: 430
916075623_916075631 -2 Left 916075623 1:161198520-161198542 CCACACCAGCCAGGAGAGCGGCA 0: 1
1: 0
2: 1
3: 29
4: 220
Right 916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG 0: 1
1: 0
2: 1
3: 39
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916075631 Original CRISPR CACAATGGGGAGCAGGAGGC AGG Exonic
900189086 1:1345763-1345785 CCCAAGGCGGAGCAGGAAGCTGG + Intronic
900378929 1:2374067-2374089 CACCATGGGGAGAGGGAGGGTGG + Intronic
900395698 1:2452426-2452448 CAGGAGGGAGAGCAGGAGGCAGG - Intronic
900397077 1:2457463-2457485 GACATTGGGGAGCAGGCGGCTGG - Intronic
900658322 1:3771108-3771130 CAGAATGCGGAGCCGGGGGCAGG - Intronic
900799770 1:4729973-4729995 CACAATGGGGAGTAGAAGGAAGG - Intronic
900987258 1:6080366-6080388 CACATCCGGGAGGAGGAGGCTGG + Intronic
901045238 1:6392394-6392416 CAGAATCGGAAGCAGCAGGCTGG - Intronic
901378830 1:8859277-8859299 GACAATGGCCAGCAGCAGGCTGG - Intergenic
902534663 1:17112560-17112582 CCCCATGGCGAGCAAGAGGCAGG + Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
903344155 1:22673648-22673670 CACAGTGGGGGGTGGGAGGCTGG + Intergenic
903669655 1:25028017-25028039 CCCCATGGGGAGCAGTGGGCAGG - Intergenic
903771443 1:25766912-25766934 CACACCTGGCAGCAGGAGGCTGG - Intronic
904364721 1:30002948-30002970 CACAATGGGAGGCTGGGGGCCGG - Intergenic
904391799 1:30190907-30190929 CAGGATGGGCACCAGGAGGCAGG + Intergenic
904432611 1:30474555-30474577 CACTAAGGTGAGGAGGAGGCAGG - Intergenic
904496132 1:30887813-30887835 AGCGATTGGGAGCAGGAGGCAGG - Intronic
904957549 1:34297620-34297642 CACAAAGGGGAGCTGAGGGCAGG - Intergenic
905273032 1:36799451-36799473 CACAGTGGGGAGCGGGGGGAAGG - Exonic
905312389 1:37058993-37059015 GACAGTGGGGAGTGGGAGGCAGG - Intergenic
905770891 1:40637161-40637183 AACAGTGGGGAGCAGGGAGCTGG + Intronic
906566213 1:46803044-46803066 CAGAATGGAGAGGATGAGGCTGG + Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906704110 1:47882224-47882246 CAGCATGGGGAGCATGAGGCAGG - Intronic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908318839 1:62961628-62961650 CAGAATGGGGAGGAGGGGGGTGG - Intergenic
909227238 1:73041515-73041537 GACAATGTGGGGCAAGAGGCAGG - Intergenic
910353273 1:86324331-86324353 CACAAGGCGGAGAAGGAGGTGGG + Intergenic
910538518 1:88327867-88327889 TACAATGGAGAGAAGGCGGCTGG - Intergenic
911401367 1:97379251-97379273 GACAATGGGGAGAGGCAGGCAGG + Intronic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915168375 1:153961421-153961443 CACAATGGGGAGGGGGATGGAGG - Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916664484 1:166953484-166953506 CAAAATGGGGAGCAGAAAACAGG - Intronic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
917534568 1:175864823-175864845 CAGAAAGGGGAGCAGGAGAGTGG + Intergenic
917612231 1:176700258-176700280 CAATATCTGGAGCAGGAGGCTGG + Intronic
918463826 1:184801682-184801704 CACAGTAGAGAGCAGGAGACAGG - Intronic
918465732 1:184819616-184819638 CGCAATGGAGTGAAGGAGGCCGG + Intronic
918851567 1:189697075-189697097 CACAATTGGGAGGCCGAGGCGGG - Intergenic
918944105 1:191038961-191038983 CACATTGTGGAGCAAGAGGCCGG - Intergenic
919591775 1:199512221-199512243 CACGGTGGGGGGCAGGATGCTGG + Intergenic
920513319 1:206566561-206566583 TGCAGTGGGGAGCAAGAGGCAGG + Intronic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923126220 1:231036781-231036803 CAGAATGTGGAGCTGGAAGCTGG - Intronic
923435364 1:233963232-233963254 CACAATGGGGAGAAATAGACTGG - Intronic
924057616 1:240139286-240139308 CACAATGAGGAGCAGGTTGTGGG + Intronic
924575814 1:245280097-245280119 CCCAATGGGGAGCAGCAGCTAGG - Intronic
1063290756 10:4744489-4744511 TACGAAGGTGAGCAGGAGGCTGG + Intergenic
1067771655 10:49131023-49131045 CTCAAGGTAGAGCAGGAGGCTGG - Intergenic
1067789742 10:49278647-49278669 AGCACTGGGGAGCAGGAGGGAGG + Intergenic
1069552875 10:69376675-69376697 CACCATGGGCAGGAGCAGGCAGG - Intronic
1069789358 10:71009876-71009898 CAAAGTGGGGAGCAGGACCCGGG + Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070381112 10:75881332-75881354 CACAATAGGGATAATGAGGCAGG + Intronic
1071338736 10:84623280-84623302 CACCTTGGAGAGCAGCAGGCTGG + Intergenic
1071476653 10:86031405-86031427 CAAAAGGGGGGGCAGGAGGAGGG + Intronic
1071925960 10:90409233-90409255 CACAATGGGAAGCAACAGCCTGG + Intergenic
1071979456 10:90988754-90988776 AAGAATGGGGGGTAGGAGGCTGG - Intergenic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1073321984 10:102621117-102621139 CCAAATGGGTAGCAGAAGGCAGG - Intronic
1075027806 10:118999376-118999398 CACAATGGGGAGAGGGAGAGAGG + Intergenic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1075845779 10:125544210-125544232 GGCAATGGGAACCAGGAGGCTGG - Intergenic
1076271279 10:129154318-129154340 CACAAGGTGGAGCAGTAGCCAGG + Intergenic
1077035894 11:494335-494357 CACACTGGGGAGCACAGGGCAGG - Intergenic
1077174113 11:1180982-1181004 CAGACTGGGGGACAGGAGGCCGG - Intronic
1077385899 11:2269406-2269428 CAGATTGGGGTGCTGGAGGCGGG - Intronic
1077562321 11:3271545-3271567 GGCAAAGGGGAGCAGGGGGCAGG - Intergenic
1077568215 11:3317365-3317387 GGCAAAGGGGAGCAGGGGGCAGG - Intergenic
1081935885 11:46903742-46903764 CACACAGGGGAGCAGGAAGCAGG + Intronic
1082091881 11:48097028-48097050 CTGAATGGGGAACAGGAGGGTGG - Intronic
1082997110 11:59263277-59263299 CACCCTGGGAGGCAGGAGGCCGG + Intergenic
1083288946 11:61679563-61679585 CACAGAGAGGAGCAGAAGGCGGG - Intergenic
1083369472 11:62166832-62166854 GCCAATGGGAAACAGGAGGCAGG + Intergenic
1083745985 11:64736734-64736756 CACGGTGAGGAGCAGGGGGCAGG - Exonic
1083901714 11:65646568-65646590 CTGAATGGTGAGCAGGCGGCCGG + Exonic
1084477844 11:69398950-69398972 CACAGTGGGGACCAGGAAGGGGG + Intergenic
1084524375 11:69686692-69686714 CCTAATGGGGTGGAGGAGGCAGG - Intergenic
1085256609 11:75177116-75177138 CACCATAGGGAGGAGGAGGAGGG + Intronic
1085282587 11:75340825-75340847 GAGATTGGGGAGCAGGAAGCTGG - Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085410780 11:76289142-76289164 GACAAAGGGGAAGAGGAGGCAGG + Intergenic
1085411951 11:76296706-76296728 CACAGAGGGGTGCAGGAAGCAGG + Intergenic
1086408009 11:86515858-86515880 CACAATGGGAGGCAGGAAGGTGG + Intronic
1087175710 11:95092933-95092955 CACACAGGGGAGGAAGAGGCAGG + Intronic
1088175463 11:107048410-107048432 TACAATGGAGTGCATGAGGCTGG - Intergenic
1089466191 11:118688042-118688064 CAGAAGGCTGAGCAGGAGGCTGG + Intergenic
1089693189 11:120199287-120199309 CACAGTGGGAAGAAGGAGTCCGG + Intergenic
1089744494 11:120607364-120607386 CACGTTGGTGTGCAGGAGGCCGG + Intronic
1091295010 11:134467571-134467593 CAGACTGGGAAGCAGCAGGCTGG - Intergenic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092237311 12:6818481-6818503 CCCAATGAAAAGCAGGAGGCCGG - Exonic
1092525890 12:9310181-9310203 CACACTGGGCAGCAGGCAGCAGG - Intergenic
1092890995 12:12969111-12969133 CCCAAAAGGGAGCAAGAGGCAGG + Intergenic
1093514458 12:19969737-19969759 GACAATGGAGATGAGGAGGCAGG - Intergenic
1094511645 12:31100868-31100890 CACACTGGGCAGCAGGCAGCAGG - Intronic
1094524144 12:31220572-31220594 CACAATGGGGAGCACACGGTGGG + Intergenic
1095730426 12:45500803-45500825 CACTATGGGGAAGAGGAAGCGGG + Intergenic
1096072308 12:48782239-48782261 CAGAATGTGGGGCTGGAGGCAGG - Intronic
1096556616 12:52407879-52407901 CACAATGGGAGGCAGAAGGTTGG + Intergenic
1097145514 12:56936903-56936925 AACAAGAGGGAGGAGGAGGCAGG - Intergenic
1097194300 12:57235326-57235348 CACGTGGGGGAGGAGGAGGCAGG - Exonic
1098190006 12:67938042-67938064 CACCAGGGGGTGCAGGAAGCAGG - Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1100316765 12:93451954-93451976 CACAATGTGGTGAAGGAGACAGG - Intergenic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102534455 12:113570147-113570169 CACAAGGTGGACCAGCAGGCTGG - Intergenic
1103040545 12:117691621-117691643 CACCATGGAGAACTGGAGGCAGG - Intronic
1103335111 12:120183614-120183636 GACAATGCGCACCAGGAGGCAGG + Exonic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1103894926 12:124266638-124266660 AAGAGTGGGGACCAGGAGGCGGG + Intronic
1103957497 12:124585856-124585878 CACAGTGGGGAGGCTGAGGCAGG + Intergenic
1104062198 12:125277978-125278000 CACAACTGGGAGAAGCAGGCTGG - Intronic
1104355284 12:128079737-128079759 AATGATGGGGAGCAGGAGGGTGG + Intergenic
1104954337 12:132457137-132457159 TCGAATGGGGAGGAGGAGGCAGG + Intergenic
1104958955 12:132479118-132479140 CAGAGTGGGCCGCAGGAGGCCGG + Intergenic
1105209160 13:18247703-18247725 CCCAATGGGAGGCAGGGGGCAGG + Intergenic
1106204094 13:27573194-27573216 CACAGTGGAAATCAGGAGGCTGG + Intronic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1107095765 13:36533429-36533451 CAAAATGCTGGGCAGGAGGCTGG - Intergenic
1109489043 13:63070779-63070801 CACAATTGGTAGCAGAAGGTAGG - Intergenic
1109649667 13:65309825-65309847 CACACTTGGGAACAGCAGGCTGG + Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1110935220 13:81279204-81279226 GACAATGGGAAGCAAGAGACAGG + Intergenic
1112615537 13:101001412-101001434 CACGATGGGGAGGAGAAGACTGG - Intergenic
1113397625 13:109963404-109963426 CACATTGGGAAGCAGGCGGAGGG + Intergenic
1113714860 13:112496348-112496370 CACCAGGGGGTGCAGCAGGCGGG + Intronic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1118607445 14:67514537-67514559 CACCCTGGGGAGAAGGCGGCGGG + Intronic
1119216798 14:72875635-72875657 CATGGTGGGGAGCAGGAGGCTGG - Intronic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1120692731 14:87611234-87611256 CACACTGGGGAGGCTGAGGCAGG + Intergenic
1121779017 14:96609638-96609660 CACAATGGGCAGCAGGCTGGGGG - Intergenic
1121782338 14:96629967-96629989 AACAATGGGGATCAGGAGCAGGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1124177320 15:27438634-27438656 CACCCGGAGGAGCAGGAGGCGGG - Intronic
1125546184 15:40507326-40507348 CCCACTGGGAAGCAGCAGGCGGG - Intergenic
1126796641 15:52265121-52265143 CCCAATGGGGAACATGGGGCAGG - Intronic
1128547023 15:68575206-68575228 AACAATGGGGAAGAGGAGGGTGG + Intergenic
1129232255 15:74203318-74203340 CTCCAGGAGGAGCAGGAGGCAGG - Intronic
1129364888 15:75048229-75048251 AACCCTGGGGAGCAGAAGGCAGG - Intronic
1129680454 15:77655854-77655876 AGCAATGGGGAGGAGAAGGCTGG - Intronic
1129710804 15:77819499-77819521 CATCGTGGCGAGCAGGAGGCAGG - Intronic
1132258460 15:100399899-100399921 CAAAACGTGGAGCAGGAGACAGG + Intergenic
1132382556 15:101376760-101376782 TACAAGGGGTAGCAGCAGGCAGG + Intronic
1132949743 16:2554506-2554528 CTCAAGGGGGAGCGTGAGGCTGG - Intronic
1132964605 16:2645661-2645683 CTCAAGGGGGAGCGTGAGGCTGG + Intergenic
1133932079 16:10240810-10240832 CACACTGGGGGGAAGGGGGCAGG + Intergenic
1134032457 16:11003387-11003409 CACTGTGGGGAGCAGAAGTCTGG - Intronic
1134247150 16:12548405-12548427 CACAGTGGGGAGCCAGAGGTAGG - Intronic
1135649779 16:24195969-24195991 CACGGTGGGGATCAGGGGGCTGG - Intronic
1136390726 16:29962437-29962459 CCCACTTGGAAGCAGGAGGCGGG + Intronic
1136519555 16:30786943-30786965 AACAATGGGGCCCGGGAGGCGGG - Intronic
1137398898 16:48137079-48137101 CACAATGGATTGCAGGAGGGAGG + Intronic
1138431971 16:56974891-56974913 CACAGTGGGGAGCAGAAGCCAGG + Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139530211 16:67538929-67538951 CACCCTGGGCAGCATGAGGCTGG + Intronic
1139822627 16:69732392-69732414 TACAATAGAGAGGAGGAGGCCGG - Intergenic
1139956658 16:70696600-70696622 CACACTGGGGAGAAGCAGGCTGG - Intronic
1140020184 16:71230916-71230938 AACACTGGGAGGCAGGAGGCAGG - Intergenic
1141775801 16:86121890-86121912 GACAAGGAGGAGGAGGAGGCAGG - Intergenic
1142135602 16:88450628-88450650 CACAATGGGCAGCAGGTGGGGGG + Intergenic
1142246546 16:88972799-88972821 CAAAAGGGGGGACAGGAGGCGGG + Intronic
1142878117 17:2864592-2864614 CGGTGTGGGGAGCAGGAGGCTGG + Intronic
1143253254 17:5537908-5537930 CTCAGTGGGGAGCAGCAGGCTGG + Intronic
1143684656 17:8504218-8504240 CACAAGGGTGAGAAGAAGGCTGG - Intronic
1143890873 17:10101490-10101512 CACAAGAGTGACCAGGAGGCAGG + Intronic
1143901767 17:10179802-10179824 CAAAATGGTGACCAGGAGGTTGG + Intronic
1144876242 17:18398939-18398961 CACCAAGGGCAGCAGGAGCCTGG - Intergenic
1145155986 17:20545481-20545503 CACCAAGGGCAGCAGGAGCCTGG + Intergenic
1145737826 17:27245458-27245480 CCCAAGGGAAAGCAGGAGGCAGG - Intergenic
1145773159 17:27508046-27508068 CAGGTTGGGGAGCAGGAGACTGG - Intronic
1146121875 17:30202862-30202884 CCCAGTGGCAAGCAGGAGGCAGG + Intronic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147353190 17:39868248-39868270 CACAGTGCGGAGCAGAACGCCGG - Exonic
1147381331 17:40057976-40057998 CACTATGGGCAGCAGGTGGATGG + Intronic
1147382286 17:40062974-40062996 CACACCCGGGCGCAGGAGGCGGG + Exonic
1147765622 17:42833729-42833751 CGCCATGGGGAGTAGGAAGCCGG - Intronic
1147952426 17:44114547-44114569 CACACTGGGGAGAAGGATCCTGG + Intronic
1148052440 17:44775817-44775839 GCCAATGGGGAGCAAGGGGCGGG + Intronic
1148102219 17:45099241-45099263 CACTGTGGGGAGGGGGAGGCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148742082 17:49898611-49898633 TCTAATGGGGAGCAGGAGCCAGG - Intergenic
1148757136 17:49979198-49979220 CACAATGGGGTGCAGGGAGTGGG + Intergenic
1148760322 17:49996612-49996634 CAAAATGGGGTGTGGGAGGCAGG - Intergenic
1150176492 17:63062647-63062669 CAAAATGGGGAGGAGGGGGCTGG - Intronic
1150603243 17:66668804-66668826 TATAATAGGGTGCAGGAGGCTGG + Intronic
1150891347 17:69153792-69153814 CACAATTTGTAGCAGGAGGAAGG - Intronic
1151424502 17:74022038-74022060 TACAATGGGCAACGGGAGGCTGG + Intergenic
1152322456 17:79615587-79615609 CACAGAGGGGAGCAGGGGCCAGG - Intergenic
1152425860 17:80218362-80218384 CACACTGGGCAGCAGGAAACAGG + Intronic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1153912213 18:9714246-9714268 CACAGATGGGAGCAGGAGGCGGG + Intronic
1154484987 18:14866234-14866256 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1155412569 18:25562673-25562695 CACAATCGGGAGGCCGAGGCAGG - Intergenic
1156202862 18:34854137-34854159 GACAATGGGGAGTAGGAGAATGG + Intronic
1157565848 18:48678725-48678747 CTCCATGCGGAGCAGAAGGCAGG + Intronic
1157914858 18:51654950-51654972 CACAATGGGGAGGCGGAGTGGGG - Intergenic
1160662336 19:306887-306909 CACAAATGGGAGCAGGTGCCAGG - Intronic
1161512080 19:4677466-4677488 AACAGTGGGGACCAGGAGCCTGG - Intronic
1161806032 19:6443522-6443544 TATAAAGGGGAGAAGGAGGCCGG - Intronic
1162854861 19:13460418-13460440 CCCAAGTGGGAGCAGAAGGCTGG - Intronic
1163435540 19:17292973-17292995 CTCAAGGGGGAGCTGGAGGATGG + Intronic
1163560188 19:18014395-18014417 GAGAGTGGGGAGCAGGGGGCTGG + Intergenic
1163826936 19:19529148-19529170 CACGGTGGGGAACCGGAGGCAGG + Intronic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1164627329 19:29738148-29738170 CACAGTGGGTAGCAGGAGCCAGG - Intergenic
1164684055 19:30155677-30155699 CAGGACGGGGAGCAGGTGGCTGG - Intergenic
1164697109 19:30253584-30253606 CAAAATGTGGGGCTGGAGGCAGG + Intronic
1164821033 19:31251432-31251454 GTCACTAGGGAGCAGGAGGCAGG - Intergenic
1165158786 19:33803880-33803902 CACAAGGGGGAGCATCAGGATGG - Intronic
1165306465 19:35005703-35005725 CACAATGCGGGACAGGATGCAGG - Intronic
1165549699 19:36573566-36573588 CAGAATGGGGAACAGGAAGCTGG + Intronic
1165899198 19:39160921-39160943 ACCACTGGGGAACAGGAGGCTGG + Intronic
1167151561 19:47713313-47713335 CACAAGGGGGCGCCAGAGGCCGG + Intergenic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1167648254 19:50717212-50717234 CAAAGTGGGGCGCAGGGGGCGGG - Intronic
1168096103 19:54115812-54115834 GACCACGGGGAGCGGGAGGCTGG + Intronic
1168359312 19:55725528-55725550 CACAGAGGGGAACAGCAGGCTGG + Intronic
925066059 2:929525-929547 CCCAATGGGCACCAGGAAGCCGG + Intergenic
925082992 2:1084464-1084486 CATGTTGGGGAGCAGGAGGGCGG - Intronic
925472354 2:4175890-4175912 CCCATTGGGCAGCTGGAGGCTGG + Intergenic
926611736 2:14954399-14954421 CACAGTGGCGACCAGCAGGCAGG + Intergenic
927130137 2:20051723-20051745 GCCAATGGGGAGCGGAAGGCTGG + Exonic
927420804 2:22928476-22928498 CACACTGGTGAGCAGGAAGGAGG - Intergenic
927949615 2:27158841-27158863 CACAGTGGGGAGCAGAGGGTGGG + Intergenic
928049955 2:27981507-27981529 GACAATGGGGAACAGGAGAATGG - Intronic
928124891 2:28608415-28608437 CGCAGTGGGGGGCGGGAGGCAGG + Intronic
928986979 2:37191463-37191485 CACAATGGAAAGCAGCAGCCAGG - Intronic
929534724 2:42773884-42773906 TACAATGGGGGGCAGGTAGCCGG - Intronic
929759920 2:44798340-44798362 CCCCATGGGGAGGAGGAGGATGG - Intergenic
932095007 2:68839611-68839633 CACACTGGGGCTCAAGAGGCAGG - Intergenic
933698851 2:85239832-85239854 CCCACTGGGGAGGATGAGGCAGG + Intronic
935061445 2:99611638-99611660 CACACTGGGGAGGCCGAGGCTGG + Intronic
937695100 2:124800118-124800140 CACAGTGGGGACCAGAATGCAGG + Intronic
937908771 2:127065293-127065315 CAGAATGGGGAGCGGGGGGTGGG + Intronic
937971536 2:127552747-127552769 AACAATGGGCAGCCAGAGGCAGG + Intronic
938279066 2:130051870-130051892 GAGAATGGGGAGCACAAGGCTGG + Intergenic
938330050 2:130442746-130442768 GAGAATGGGGAGCACAAGGCTGG + Intergenic
938359895 2:130678757-130678779 GAGAATGGGGAGCACAAGGCTGG - Intergenic
938364134 2:130720591-130720613 CACTAGGAGGAGCAGGAGGCAGG + Intergenic
938436304 2:131285478-131285500 GAGAATGGGGAGCACAAGGCTGG - Intronic
940191669 2:151047121-151047143 CACACTGTGGAGCAGCAGGTGGG - Intronic
940259425 2:151764999-151765021 GAGGATGGGGAGCAGGAGGGAGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
944191894 2:197012025-197012047 CACTATGAGGAGCAAGAGCCAGG - Intronic
944861561 2:203819979-203820001 CACAATGGGGTGGAGAAGGCGGG + Intergenic
946146565 2:217735492-217735514 GAGAATGGCGGGCAGGAGGCTGG - Intronic
946945754 2:224820359-224820381 CAAAGTGTGGAGCAGGAGGAAGG + Intronic
947066954 2:226237807-226237829 AAAAAGGGGGAGCAGGAGGAAGG + Intergenic
947353030 2:229266253-229266275 AAAAATGGGGAGAAGGAGGGAGG - Intronic
947445191 2:230157642-230157664 CCCAATGGGGACCAGGAGTCGGG + Intergenic
948002503 2:234579920-234579942 CAGAATGGGGAACAGGGGACAGG + Intergenic
948258158 2:236583620-236583642 CAAAATGGGGAGGGGGAGGAGGG + Intergenic
948350459 2:237335954-237335976 CAGGATGGGGAGTGGGAGGCTGG + Intronic
948495542 2:238346323-238346345 CACAGTGGTTAGCAGGGGGCTGG - Intronic
948782268 2:240329221-240329243 GAGCATGGGGAGGAGGAGGCTGG + Intergenic
948935136 2:241158979-241159001 CCCAAAGGGAGGCAGGAGGCAGG - Intronic
948947617 2:241229055-241229077 GGCAATGGACAGCAGGAGGCAGG - Exonic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
949062218 2:241967979-241968001 CATTATGGGAAGCATGAGGCTGG + Intergenic
1169140453 20:3224609-3224631 CACAAGGAGGCTCAGGAGGCTGG - Intergenic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1170830056 20:19832398-19832420 GACAGTGGGGAGCAAGAGGGAGG - Intergenic
1170929056 20:20752240-20752262 CAGAATGGGGAGGAGGAAACAGG + Intergenic
1171014276 20:21525608-21525630 CACAATGGGGAGCTGAAGATGGG + Intergenic
1171290333 20:23979416-23979438 CCCAATGGGAGGCAGGGGGCAGG + Intergenic
1171361403 20:24588866-24588888 AACATTGGTGAGCAGTAGGCTGG + Intronic
1172010367 20:31842896-31842918 AACAATGGGGAGGAGGAGCAAGG - Intergenic
1172099019 20:32474540-32474562 GACAACTGGGAGCAGGGGGCCGG + Intronic
1172149552 20:32780345-32780367 CTCAATGGAGAGGAGGACGCCGG + Exonic
1172276375 20:33681881-33681903 GGCAATGGGGAGCTGGAGGAAGG - Intronic
1172282748 20:33719732-33719754 CACAATGGGGAACTGGACTCTGG - Intronic
1172304299 20:33870556-33870578 CTTAAGGGGAAGCAGGAGGCTGG + Intergenic
1172699565 20:36844772-36844794 CACTATGGGGAGACCGAGGCGGG + Intronic
1173056284 20:39616490-39616512 GAAAATGGGGGGCAGGAGGATGG - Intergenic
1173336785 20:42118587-42118609 CACACTGGTGAGCAGGAGTGAGG + Intronic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174533777 20:51235636-51235658 TACAAAGGGGACAAGGAGGCTGG + Intergenic
1175114547 20:56672992-56673014 CACACTGGAAAGCAGGAGGGAGG - Intergenic
1175215063 20:57388003-57388025 CTCACTGGGGAGCGGGAGGGAGG - Intergenic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175752355 20:61508288-61508310 CACAGTGGGGGACAGGAGCCTGG + Intronic
1175915666 20:62424628-62424650 CTCCATGGGGAGCCTGAGGCTGG + Intronic
1175978467 20:62725383-62725405 CACAGTGGGAAGCGGGAGGCGGG + Intronic
1176377360 21:6093123-6093145 CTCAGTGGGGAGCAGGAGATGGG + Intergenic
1176796342 21:13373241-13373263 GAGAAGGGGGAGCTGGAGGCTGG - Intergenic
1177333013 21:19685123-19685145 GACAAGGAGGAGGAGGAGGCAGG - Intergenic
1179471896 21:41616287-41616309 CTCATTGGGGAGCAGGATGCTGG - Intergenic
1179746114 21:43445121-43445143 CTCAGTGGGGAGCAGGAGATGGG - Intergenic
1180304902 22:11066363-11066385 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1180684125 22:17651626-17651648 CACTTTGGGGAGCCTGAGGCAGG - Intronic
1180702300 22:17788219-17788241 CACAGTCGGGAGCAGAAGGCTGG + Exonic
1181401655 22:22653455-22653477 CCCAATGGGAGGCAGGGGGCAGG - Intergenic
1181596321 22:23917287-23917309 CCCAGAGGGGACCAGGAGGCTGG - Intergenic
1181703613 22:24634552-24634574 CCCAATGGGAGGCAGGGGGCAGG - Intergenic
1181935275 22:26433809-26433831 CACGAAGAGGACCAGGAGGCAGG - Exonic
1182567695 22:31212372-31212394 GGAAATGGGGAGGAGGAGGCGGG - Intronic
1182645023 22:31801388-31801410 CACACTGGGGAGCAGGAGAAGGG - Intronic
1184090381 22:42290123-42290145 GACAAGGGCCAGCAGGAGGCAGG + Intronic
1184099390 22:42334074-42334096 CACCATGGGCAGCTGGAAGCAGG + Intronic
1185045251 22:48525443-48525465 CAGAAGGCGGAGCAGGTGGCAGG - Intronic
951671902 3:25192816-25192838 CATAATTGGGAGCAGGTGACTGG + Intronic
953624015 3:44555666-44555688 CACTATGGGAAGCAGGAGAATGG + Intronic
953683733 3:45060025-45060047 CACACCGGGCAGCAGGAGGCTGG + Intergenic
953808340 3:46090967-46090989 AGCAAGGGGGAGCAGGAGCCTGG - Intergenic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954674646 3:52309067-52309089 CACAAGGGGGAACACAAGGCTGG - Intergenic
955044710 3:55348877-55348899 CACCATGGGGAGGGGGAGGCAGG - Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957761841 3:84569033-84569055 CACAGAGGGGAGGAGGAGACAGG - Intergenic
959614490 3:108331843-108331865 TAGAATGGGGAGGGGGAGGCAGG - Intronic
959633070 3:108531092-108531114 CTGAATGGGTAGCAGGATGCAGG + Intergenic
959904313 3:111693801-111693823 CACAAAGGGGTGAAGGAGGTGGG - Intronic
960639098 3:119810032-119810054 GAGAATGGGGAGCAGAAGGGGGG - Intronic
960928756 3:122822958-122822980 CACAGTGGGGAGGTGGAGGGCGG - Intronic
961320304 3:126068386-126068408 TAAATTGGGGTGCAGGAGGCTGG - Intronic
961325170 3:126105288-126105310 GCCAAGGGGGAGCAGGAGGGAGG - Intronic
961390642 3:126550596-126550618 AACAATGGGGAGCAGGCAGAAGG - Intronic
961550632 3:127668795-127668817 AAGGATGGGGAACAGGAGGCAGG + Intronic
961647611 3:128400848-128400870 CACAATGGGCTGCAGGCTGCCGG - Intronic
962629800 3:137264238-137264260 AACCACGGGGAGCAGGAGGCTGG - Intergenic
963173098 3:142271075-142271097 TACAATAGGGAGCAGACGGCCGG + Intergenic
963686620 3:148443036-148443058 GAAATTTGGGAGCAGGAGGCAGG + Intergenic
968045305 3:195620638-195620660 CACACAGAGGAGCAGCAGGCAGG + Intergenic
968047145 3:195630861-195630883 CACCAAGGGAGGCAGGAGGCCGG + Intergenic
968047426 3:195631972-195631994 CACCAAGGGAGGCAGGAGGCCGG - Intergenic
968061160 3:195726981-195727003 CACACAGAGGAGCAGCAGGCAGG + Intronic
968307187 3:197657952-197657974 CACCAAGGGAGGCAGGAGGCCGG + Intergenic
968307502 3:197659183-197659205 CACCAAGGGAGGCAGGAGGCCGG - Intergenic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969621309 4:8280268-8280290 CACACAGGGGAGCAGCAGACCGG + Intronic
971377553 4:26067412-26067434 CACAGTTGGGAGAAGAAGGCCGG + Intergenic
975370913 4:73586486-73586508 CAGAAAGGGGGGCAGAAGGCAGG - Intronic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
978243894 4:106549209-106549231 CACTTTGAGGAGGAGGAGGCAGG - Intergenic
980985303 4:139689362-139689384 CACAATAGGGAGGTGGCGGCTGG - Intronic
982233454 4:153230426-153230448 CACTTTGGGGAGGTGGAGGCAGG - Intronic
982322948 4:154099272-154099294 CACAATGGAGAACAGGATGGAGG - Intergenic
982379843 4:154738654-154738676 CACAGGGGTGAGCAGGAAGCAGG - Intronic
982485454 4:155959770-155959792 GATAATAGTGAGCAGGAGGCTGG - Intergenic
982668175 4:158291598-158291620 CTCAGTGGGGAGGAGCAGGCAGG - Intergenic
983514755 4:168644332-168644354 CACATTGGGTGGCTGGAGGCAGG - Intronic
983907742 4:173202449-173202471 CGAAATGGGGAGGAGGAGGAGGG + Intronic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
985355606 4:189116131-189116153 GAAAATGGTGAGAAGGAGGCAGG + Intergenic
985515726 5:343751-343773 CACGAGGAGGAGCAGGAGGTGGG + Intronic
985920114 5:2964276-2964298 CTCAAGGTGGCGCAGGAGGCAGG + Intergenic
989627785 5:43448224-43448246 CAAAATGTGGAGGAGAAGGCAGG - Intronic
990499022 5:56376535-56376557 CAGAATGGGGAGCTGGAGAGGGG + Intergenic
991560604 5:67947602-67947624 CAGAATGGGGAGCAGGGGCCAGG - Intergenic
992416613 5:76558227-76558249 GACAATTGGGAGCAAGGGGCAGG - Intronic
993852077 5:93023180-93023202 CCCAATGGAGAGCAGCAGGAAGG - Intergenic
995001949 5:107143878-107143900 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995002079 5:107145408-107145430 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
996217457 5:120887086-120887108 CACAATGGGAAGCAGCAGTGGGG - Intergenic
996478246 5:123945590-123945612 TACAATTGGAAGCAAGAGGCAGG - Intergenic
998391343 5:141788884-141788906 AGCCTTGGGGAGCAGGAGGCAGG - Intergenic
998477199 5:142431998-142432020 CAGCATGGTGAGCAGGAGGCGGG + Intergenic
1000091481 5:157933062-157933084 TAGAGTGGGCAGCAGGAGGCTGG + Intergenic
1001710373 5:173773580-173773602 TACAGTGGGGGGCATGAGGCCGG + Intergenic
1002533613 5:179864015-179864037 TCCGATGCGGAGCAGGAGGCTGG + Exonic
1002723686 5:181281461-181281483 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1002763620 6:220071-220093 CAGAATGGGGAACTGGAGCCGGG + Intergenic
1004565473 6:16791998-16792020 CCCAATGGGGAGAGGGAGGGAGG - Intergenic
1006095543 6:31653998-31654020 CACACTTGGGAGGATGAGGCGGG + Intronic
1006437172 6:34031745-34031767 CACTCTGGTGAGCAGGCGGCTGG - Intronic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1007390066 6:41545862-41545884 CGCAGTGGGGAGCAGGAGGGAGG + Intergenic
1007424398 6:41737257-41737279 CCAAATTGGGAGCAGGAGGGAGG - Intronic
1007598328 6:43065729-43065751 GAAAAGGGGCAGCAGGAGGCTGG + Intronic
1007744904 6:44037807-44037829 CACACTGGGGAGCAGCCTGCAGG + Intergenic
1012402080 6:98849018-98849040 CACAATGTGAGGCAGGAAGCAGG + Intergenic
1013179599 6:107706953-107706975 CACTCTGGGGATCAGGAGCCTGG - Intronic
1013320793 6:108986647-108986669 TAAAGTGGGGACCAGGAGGCAGG + Exonic
1014591291 6:123274759-123274781 CATAATTGGGAGGATGAGGCAGG + Intronic
1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG + Intergenic
1015536319 6:134270872-134270894 CTCAATGGGGAGGATGAGGAGGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017129287 6:151094164-151094186 GTCAGTGGGGAGAAGGAGGCGGG - Intronic
1017915279 6:158826720-158826742 CACAATGGGGAAGCTGAGGCAGG - Intergenic
1018926436 6:168209932-168209954 CTCTGTGGGGAGCAGGAGGCCGG - Intergenic
1019533215 7:1513953-1513975 CATCACGGGGAGCGGGAGGCGGG + Intergenic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023149145 7:37183407-37183429 GACAATGAGGAGGAAGAGGCAGG + Intronic
1023654473 7:42406045-42406067 GGCAATGGGGAGCTGGAGGATGG + Intergenic
1023860993 7:44217699-44217721 CAGAATGGGGAACAGGACACAGG - Exonic
1024568216 7:50702040-50702062 CTCAGTGGGGAGGGGGAGGCAGG - Intronic
1024972711 7:55085384-55085406 CAGCATGGGGAGCAGGATGCTGG + Intronic
1025781512 7:64605951-64605973 CACTATGTGAAGCAGGAAGCAGG + Intergenic
1026850732 7:73721680-73721702 CACACTGGGCAGCAGGGGGCTGG - Intergenic
1026865609 7:73822390-73822412 TCCCCTGGGGAGCAGGAGGCAGG - Intronic
1026887078 7:73956967-73956989 AAAGATGGGGAGCAGGGGGCGGG - Intergenic
1028732820 7:94171793-94171815 AACCTTGGGGAGCAGGAGGAGGG + Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029159394 7:98540988-98541010 CAAAGTGGGAACCAGGAGGCGGG - Intergenic
1029819028 7:103127533-103127555 CACAAGGGAGCCCAGGAGGCTGG + Intronic
1030672774 7:112355060-112355082 CACTATGGGGAGCAGTATGGAGG - Intergenic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1031118647 7:117695544-117695566 AACAATTGGGAGCAGCATGCTGG + Intronic
1033343129 7:140507257-140507279 CAGATGGGGGAACAGGAGGCCGG + Intergenic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034963047 7:155374253-155374275 CACCTTGGGGAGCCGGAGGCTGG - Intergenic
1035011838 7:155725408-155725430 CACAACTGGGCGCAGGAGGGAGG + Intronic
1035165132 7:156985095-156985117 CACAGTGGGGAGCATGGGACTGG - Intergenic
1035192066 7:157178841-157178863 CACAATGGTAAGTAGTAGGCAGG + Exonic
1035304661 7:157924079-157924101 CACGCTGGGGAGCTGGAGGAGGG + Intronic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037710390 8:21350903-21350925 CACAGTGGGAAGGAGGAGGGAGG + Intergenic
1038481034 8:27901942-27901964 GAAAATGGGGAGATGGAGGCTGG + Intronic
1038609734 8:29049305-29049327 CGCAATGGGGAGGAGGAGGAGGG + Intronic
1038780350 8:30564612-30564634 CACAATGGGCAGGAGCAGGTTGG - Intronic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039363994 8:36911199-36911221 AATTATGGGGAGCAGGAGGGTGG + Intronic
1039517223 8:38144247-38144269 CACAGTTGGGAACAGCAGGCTGG + Exonic
1039803060 8:40976297-40976319 CCCCGAGGGGAGCAGGAGGCTGG - Intergenic
1040466808 8:47702922-47702944 CTCAAGGGAGGGCAGGAGGCTGG + Intronic
1040801509 8:51346743-51346765 GGCAAAAGGGAGCAGGAGGCAGG - Intronic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1042010477 8:64239924-64239946 CAATATGGGGAGCAGGAGAAAGG - Intergenic
1042914318 8:73860129-73860151 TACTATGGGGGGCAGGGGGCGGG + Intronic
1044826140 8:96199203-96199225 CACAGTAGGAAGCAGGAAGCTGG - Intergenic
1046680576 8:117164956-117164978 CAGAATGGGGGAGAGGAGGCAGG - Intronic
1046711173 8:117513203-117513225 CAGAATGGTGAGGAGGAGGAGGG - Intergenic
1046839117 8:118837991-118838013 CACAATGAGGTGCTGGAGGGTGG - Intergenic
1048106221 8:131413198-131413220 AAGAAAGGGAAGCAGGAGGCAGG + Intergenic
1048745796 8:137613771-137613793 CAGAAAGGGGAACAGGAAGCAGG - Intergenic
1049252632 8:141597359-141597381 CCTAAAGGGGAGCAGAAGGCCGG - Intergenic
1049398538 8:142413098-142413120 CTCAATGGAGAGATGGAGGCTGG - Intergenic
1049426424 8:142539897-142539919 GACAACGGGGAGCAAGAGGAAGG + Intronic
1053885901 9:42645087-42645109 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1054224919 9:62452536-62452558 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1055455206 9:76465649-76465671 CACCCTGGGGAGGAGGAGGGTGG + Intronic
1056413344 9:86354032-86354054 CACCGTGGGGACCAGGAAGCAGG + Intronic
1056965576 9:91160921-91160943 CCCAGAGGGGAGCAGCAGGCAGG + Intergenic
1057168640 9:92947582-92947604 CACAGTGGGCAGCAGGAGGCTGG - Exonic
1057745634 9:97748732-97748754 GACAAAGTGGAGCAGAAGGCAGG + Intergenic
1058734022 9:107877633-107877655 CACAATGGGGACTAGAAGGAAGG + Intergenic
1059094503 9:111398562-111398584 TACAAGAGGGAGCAGGCGGCAGG + Intronic
1059423458 9:114206651-114206673 CTCATTTGGGAGCAGGAGGGAGG - Intronic
1059754667 9:117281626-117281648 GAAAATGTGGAACAGGAGGCTGG + Intronic
1060497798 9:124130750-124130772 CACATTGGGGAGCTGCAGGGCGG + Intergenic
1060855079 9:126908639-126908661 CACTATGGGAAGCAGGAAGGAGG - Intergenic
1060933404 9:127502954-127502976 CACAAGGCTGAGCAGGAGCCCGG - Exonic
1062028003 9:134349390-134349412 CTCCACGGGGAGCAGGAGGGAGG + Intronic
1062212186 9:135371153-135371175 CAGCAGGGGGAGCTGGAGGCAGG - Intergenic
1062479457 9:136744679-136744701 CACCAAGTGGAGCAGGAGCCTGG - Exonic
1062668793 9:137694153-137694175 CACACAGGGGCGCAGGACGCTGG + Intronic
1062711222 9:137976150-137976172 GACAGTGAGGAGCAGGGGGCTGG + Intronic
1202629276 M:3317-3339 TACAATGAGGAGTAGGAGGTTGG - Intergenic
1203624626 Un_KI270750v1:1967-1989 CACAATTGGTAGCAGAAGGTAGG - Intergenic
1186698127 X:12059611-12059633 TACTATGGGGGGCAGGAGGAAGG - Intergenic
1187255170 X:17635631-17635653 GACAAAGGGGAGGGGGAGGCTGG + Intronic
1187929257 X:24279085-24279107 CACTTTGGGAAGCAGGGGGCAGG - Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1189848818 X:45159128-45159150 ATCATTGGGGAGCAGGGGGCGGG + Intronic
1190253027 X:48741896-48741918 CACATTGAGAAGCGGGAGGCTGG + Intergenic
1190411750 X:50143511-50143533 AACAATGGGGATCAGCAGGTGGG - Intergenic
1191580832 X:62758996-62759018 CACACTGGTGAGGAGGAGGAAGG - Intergenic
1192213184 X:69140521-69140543 CACAATGGGGCACAGCAGGTGGG + Intergenic
1192316560 X:70056289-70056311 CAGAATGGGGAACAGGAGTTGGG + Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1195692476 X:107638673-107638695 CACTTTGGGGAGCAGGGGGCAGG - Intronic
1196178742 X:112667935-112667957 CAAACTGGGGAGCAAGAGTCAGG + Intronic
1199083492 X:143604100-143604122 CAAAATGGTGAGGAGGAGCCTGG - Intergenic
1200093471 X:153646761-153646783 CACGGAGGGGAGGAGGAGGCAGG - Intronic
1200243760 X:154511810-154511832 CACAAAGGGGAGGAGCAGGGAGG + Intronic