ID: 916076067

View in Genome Browser
Species Human (GRCh38)
Location 1:161200630-161200652
Sequence AGGTGGGTCTGGCAGTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 271}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916076067_916076072 4 Left 916076067 1:161200630-161200652 CCTTGTGACTGCCAGACCCACCT 0: 1
1: 0
2: 1
3: 28
4: 271
Right 916076072 1:161200657-161200679 ACCCACCACTTGCCTGACCCTGG 0: 1
1: 0
2: 1
3: 19
4: 230
916076067_916076077 18 Left 916076067 1:161200630-161200652 CCTTGTGACTGCCAGACCCACCT 0: 1
1: 0
2: 1
3: 28
4: 271
Right 916076077 1:161200671-161200693 TGACCCTGGTTCTAAGCCAACGG 0: 1
1: 0
2: 0
3: 9
4: 113
916076067_916076078 19 Left 916076067 1:161200630-161200652 CCTTGTGACTGCCAGACCCACCT 0: 1
1: 0
2: 1
3: 28
4: 271
Right 916076078 1:161200672-161200694 GACCCTGGTTCTAAGCCAACGGG 0: 1
1: 0
2: 0
3: 7
4: 74
916076067_916076079 20 Left 916076067 1:161200630-161200652 CCTTGTGACTGCCAGACCCACCT 0: 1
1: 0
2: 1
3: 28
4: 271
Right 916076079 1:161200673-161200695 ACCCTGGTTCTAAGCCAACGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
916076067_916076082 24 Left 916076067 1:161200630-161200652 CCTTGTGACTGCCAGACCCACCT 0: 1
1: 0
2: 1
3: 28
4: 271
Right 916076082 1:161200677-161200699 TGGTTCTAAGCCAACGGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69
916076067_916076083 25 Left 916076067 1:161200630-161200652 CCTTGTGACTGCCAGACCCACCT 0: 1
1: 0
2: 1
3: 28
4: 271
Right 916076083 1:161200678-161200700 GGTTCTAAGCCAACGGGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916076067 Original CRISPR AGGTGGGTCTGGCAGTCACA AGG (reversed) Intronic
901775390 1:11557113-11557135 GGGTGGGTCTGGCAGGCAAAAGG - Intergenic
902438851 1:16416110-16416132 GGATGGGTGTGACAGTCACAGGG - Intronic
902498118 1:16889162-16889184 AGCAGGGTCTGGCACTCACCAGG - Intronic
902745052 1:18468352-18468374 AGGTGGGGCTGTTTGTCACATGG - Intergenic
904067953 1:27769629-27769651 ATTTGGGTGTGGCAGTTACATGG + Intergenic
904475429 1:30761948-30761970 AGGTGGGGCTTGCAGCCAGAAGG - Intergenic
905305020 1:37011842-37011864 TGATGGGTCTTGCAGGCACAAGG + Intronic
905761835 1:40565069-40565091 AGATGGGTCTGGCTGTAAAAAGG + Intergenic
905890410 1:41515353-41515375 AGCTGGGGCTGGCAGGCAAAAGG + Intronic
906157482 1:43622224-43622246 AGGTGGGTCTGGTGGACAGAAGG - Exonic
906483900 1:46220051-46220073 AGGTGGATGTGGCAGCCACCAGG + Exonic
907344501 1:53763552-53763574 AAGTGGTTCTGGAAGTCCCATGG - Intergenic
909235109 1:73143121-73143143 AGGTGGGGTTGGGGGTCACAAGG + Intergenic
910480719 1:87655531-87655553 CTTTGGGTCTGGCAGTCACTCGG - Intergenic
913366677 1:118047452-118047474 AGGTGGGCCTGGCAGTGAGGTGG - Intronic
913644675 1:120844837-120844859 AGCAGGGTCTGGCACTCACCAGG + Intergenic
913655123 1:120952817-120952839 AGCAGGGTCTGGCACTCACAAGG + Intergenic
914082058 1:144418746-144418768 AGCAGGGTCTGGCACTCACCAGG - Intergenic
914099047 1:144568085-144568107 AGCAGGGTCTGGCACTCACCAGG + Intergenic
914176961 1:145287246-145287268 AGCAGGGTCTGGCACTCACCAGG - Intergenic
914199988 1:145475952-145475974 AGCAGGGTCTGGCACTCACCAGG + Intergenic
914299938 1:146369581-146369603 AGCAGGGTCTGGCACTCACCAGG - Intergenic
914479107 1:148049087-148049109 AGCAGGGTCTGGCACTCACCAGG + Intergenic
914531691 1:148528738-148528760 AGCAGGGTCTGGCACTCACCAGG - Intergenic
914636701 1:149558991-149559013 AGCAGGGTCTGGCACTCACCAGG + Intergenic
914645308 1:149646977-149646999 AGCAGGGTCTGGCACTCACAAGG + Intergenic
914826081 1:151138676-151138698 AGGAGCGTCTGGGAGTCCCAGGG + Exonic
916076067 1:161200630-161200652 AGGTGGGTCTGGCAGTCACAAGG - Intronic
916729836 1:167556049-167556071 AGCTGGCTCTGGCAGACACCTGG + Intergenic
918703351 1:187632313-187632335 AGGTGGGTCTGGCATGCAGATGG + Intergenic
918950133 1:191126100-191126122 AGGAGGGGCTGGCAGTCAGGAGG - Intergenic
919823691 1:201489031-201489053 AGGTGGGGCTGGCACTGAGAGGG + Intronic
922960664 1:229643149-229643171 GGGTTGGTCTTGCAGTCTCAGGG + Intronic
1063085225 10:2811305-2811327 AGGTTGGTCTTGCTGTCTCAGGG + Intergenic
1064910168 10:20392556-20392578 AGGTGGTTCTGGCTGTCAGATGG + Intergenic
1070156407 10:73838268-73838290 AGGAGAGTCTGGGAGGCACAGGG + Intronic
1071861966 10:89683474-89683496 AGGTTGGTCTTGCTGTCCCAGGG - Intergenic
1072033884 10:91546645-91546667 TGGTGAGGCTGTCAGTCACAGGG + Intergenic
1072733265 10:97862629-97862651 AGGTGGATCTTGCTGTCTCAGGG + Intronic
1073249064 10:102110784-102110806 AAGTGGGTCTGGGAGTGCCAGGG - Intronic
1073947478 10:108767671-108767693 GGATGGGCCTGTCAGTCACAGGG - Intergenic
1075528313 10:123204273-123204295 AGCTGGGTGTGGCATGCACAGGG + Intergenic
1076661816 10:132060320-132060342 TGGTGGGCGGGGCAGTCACAGGG + Intergenic
1077221693 11:1420793-1420815 AGGTGGGGCTGGCAGTCCTGGGG + Intronic
1077287443 11:1773864-1773886 GGGAGGGCCTGGCAGGCACATGG + Intergenic
1077445347 11:2588104-2588126 AAGGGGGTCTGGAGGTCACAGGG + Intronic
1079308318 11:19344098-19344120 AGGTGGGTCCAGCATTCTCAGGG - Intergenic
1079323473 11:19471803-19471825 TGGTGGCTCTGGCAGCCACGCGG - Intronic
1080121744 11:28685757-28685779 GGGTGGGTCTTGCTGTCTCAGGG + Intergenic
1081681547 11:45009151-45009173 AGGTGGTTCTGGGAGTCCCATGG + Intergenic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083863811 11:65442483-65442505 AGCTGGGGCTGGCAGGGACAGGG + Intergenic
1084058455 11:66653258-66653280 GGGTTGGTCTGGCTGTCTCAGGG - Intronic
1084096041 11:66912306-66912328 AGGGGGGTCTGTGAGTCAAAAGG - Intronic
1084576674 11:69993105-69993127 GGGTGGGGCTGGCATTCCCAGGG - Intergenic
1084755826 11:71237984-71238006 AGGTGAGTCTGTGTGTCACAGGG - Intronic
1087161551 11:94953079-94953101 AGGTTGGTCTTGCTGTCTCAGGG + Intergenic
1089657109 11:119956739-119956761 GGGTGGGTCTTGCTGTCTCAAGG + Intergenic
1096473065 12:51890867-51890889 GGCTGGTTGTGGCAGTCACAAGG - Exonic
1098894324 12:76040405-76040427 AGGGGGGTCTTGCTGTCACAGGG - Exonic
1100821524 12:98436129-98436151 AGGTTGGTCTTGCTGTCTCAGGG - Intergenic
1102200958 12:111057430-111057452 AAGTGGGCCTGCCAGTGACAGGG + Intronic
1102719308 12:115002530-115002552 AGCTGGGTCTGCCAGTCCGAAGG + Intergenic
1104691481 12:130829596-130829618 AGGCGGGGCTGGCACGCACAGGG - Intronic
1106725161 13:32476869-32476891 AGGTGGGTGTGGCAGGACCATGG + Intronic
1107233682 13:38142584-38142606 AGGTTGGTCTTGCTGTCTCAGGG - Intergenic
1108847702 13:54696515-54696537 AGGTGATTCTGGAAGTCAAAGGG - Intergenic
1108908697 13:55514548-55514570 GGGTTGGTCTGGCTGTCCCAGGG + Intergenic
1111201553 13:84944701-84944723 AGTTGGGGCTGGCAGTGACAAGG + Intergenic
1112258564 13:97857028-97857050 AGGTGGCTCTGACATTGACACGG + Intergenic
1113012497 13:105785987-105786009 GGGTGGGTCTTGCTGTCTCAGGG + Intergenic
1113676767 13:112213175-112213197 AGGTGAGTCGTGCAGCCACAGGG - Intergenic
1113801705 13:113089994-113090016 AGGCGGGTCCGGCTGTCGCAGGG - Intronic
1114626425 14:24132893-24132915 AAGAGGGTCTGGTAGTCACTAGG + Intergenic
1115807515 14:37068205-37068227 AGGTCATTCTGGCAGCCACATGG + Intronic
1118906356 14:70026437-70026459 AGCTGGGACTGGCAGACACCTGG - Intronic
1119005707 14:70925874-70925896 AGGTGGCTATGGCGGTCAAAAGG - Intronic
1119410545 14:74427303-74427325 AGCTGGGGCTGGAAGACACAAGG + Intergenic
1122067411 14:99183507-99183529 AAGTGGGTCTGGAAGGAACATGG - Intronic
1122419611 14:101567180-101567202 AGGTGGGGCAGGCAGTCAGATGG + Intergenic
1122600128 14:102917254-102917276 AGGTGGGTCCAGCAGTCAGAGGG - Intergenic
1202854558 14_GL000225v1_random:42593-42615 AGGTGGGGCGGGCTGTCCCAGGG + Intergenic
1202921774 14_KI270723v1_random:34458-34480 GGGTGGGGCGGGCAGTCCCAGGG + Intergenic
1123776745 15:23588177-23588199 AGGTAGGTCTGACTGTCACCAGG + Intronic
1124178709 15:27452697-27452719 GGGTTGGTCTGGCTGTCTCAGGG + Intronic
1125610036 15:40963712-40963734 ATGTGGGGCTGGAAGCCACATGG + Intergenic
1126330821 15:47529259-47529281 AGGTTGGTCTTGCTGTCTCATGG + Intronic
1127842734 15:62845030-62845052 AGGAGGGCCTGGCAGTCTCCGGG - Intergenic
1128376524 15:67080418-67080440 AGGTGGGGGTGGCAGTGGCAGGG + Intronic
1129303433 15:74640494-74640516 AGGTGTGTGTGCCAGTCAGATGG - Exonic
1130251978 15:82305678-82305700 AGGTGGGCCTGGCACTCGCTAGG + Intergenic
1131152888 15:90058017-90058039 AGGTGGGTCTGACTGCCACAGGG - Intronic
1136674430 16:31889682-31889704 AGGTAGAACAGGCAGTCACATGG + Intronic
1137252344 16:46749321-46749343 AGGTGGCCCAGGCAGGCACACGG + Intronic
1137794838 16:51207277-51207299 AGGTTTGACAGGCAGTCACATGG - Intergenic
1138190387 16:55009446-55009468 CTGGGGGTGTGGCAGTCACAGGG + Intergenic
1140256408 16:73340320-73340342 AGGTGGCACTGGCAGTCACTGGG + Intergenic
1141157789 16:81609385-81609407 AGATGGGGCGGGCAATCACAGGG + Intronic
1141205688 16:81931679-81931701 AGGTGGGCCTGGCATTCTGAGGG + Intronic
1141504106 16:84463364-84463386 GGGTGGGTCTGGCAGGCAGCTGG - Intronic
1143575905 17:7792900-7792922 AGGAGGGTCAGGCAGGCACTTGG - Intronic
1146541255 17:33697363-33697385 AGGTTGGTCTTGCTGTCTCAGGG + Intronic
1146954392 17:36928672-36928694 AGGTGTGTCAGGAAGACACAAGG + Intergenic
1147243518 17:39106015-39106037 AGATGGGTCTGGAGCTCACAGGG - Intronic
1147455755 17:40537108-40537130 AGGTGGGTCTTGCACTCAGAGGG - Intergenic
1148143110 17:45342285-45342307 AGACGGGTGTGGAAGTCACACGG + Intergenic
1148743026 17:49903515-49903537 AGGAGGGTCTGGGAGACAGATGG - Intergenic
1148945945 17:51261353-51261375 TGGTGGGTCTCATAGTCACATGG - Intronic
1149796638 17:59527037-59527059 AGGTGGGTCTGTCAGATACATGG - Intergenic
1150472763 17:65451145-65451167 AGGAGGGTCTGGGTGTCAAAAGG + Intergenic
1150814244 17:68380029-68380051 AGGTTGGTCTTGCTGTCTCAGGG - Intronic
1151703554 17:75755458-75755480 GGGTGGGGCTGGCAGACTCACGG + Intronic
1152086732 17:78224451-78224473 AGGTTGGGCTGACAGACACACGG - Exonic
1156545583 18:37960827-37960849 AGGGGGAACAGGCAGTCACATGG + Intergenic
1156786425 18:40921017-40921039 AGGTTGCTCTGGCTGTCAGAGGG - Intergenic
1158200921 18:54939605-54939627 AGGTGGCTGAGGCAGACACATGG + Intronic
1159962690 18:74567728-74567750 AGGCAGGTATGGCAGCCACAGGG + Intronic
1160733436 19:651366-651388 ACGTGGGCCTGGCAGGCACACGG + Intronic
1160765956 19:808206-808228 AGCTGCGTCTCGCAGCCACAGGG - Intronic
1160907790 19:1459957-1459979 AGGCGGGGGTGGCAGTCACAGGG + Intronic
1161163406 19:2772968-2772990 AGGTGGGTGACGCAGCCACACGG + Intronic
1163479933 19:17549235-17549257 AGGTGGGACTGGCAGTGTCCAGG + Intronic
1163645713 19:18487966-18487988 AGGTGGGGCCGGCAGGCACAGGG - Intronic
1163697158 19:18769704-18769726 GGGTGGTTCTTGGAGTCACAGGG + Intronic
1164980964 19:32614094-32614116 AGGTGGGTGTGGCTGTAAGAGGG + Intronic
1165088672 19:33370417-33370439 ACGTGGGTGCAGCAGTCACAGGG - Intergenic
1165356450 19:35307290-35307312 TGGTGGACCTGGGAGTCACACGG - Intronic
1166484143 19:43198577-43198599 AGGTGGGTCAGGCAGGCAGTTGG - Intronic
1166787022 19:45373862-45373884 AGGTGAGTGTGTCAGCCACATGG - Intergenic
1168669281 19:58228945-58228967 AGGTGAGTCTGGCGGCCTCAAGG + Intronic
925298890 2:2795926-2795948 AGGCGGGTCTGGCAGTGCCCTGG + Intergenic
926042487 2:9684899-9684921 AGGAGGGTCTGCCAGAGACAGGG - Intergenic
926827097 2:16916347-16916369 CCGTGGGAATGGCAGTCACATGG - Intergenic
927064381 2:19456603-19456625 AGCAGTCTCTGGCAGTCACATGG - Intergenic
927370930 2:22354518-22354540 GGGTTGGTCTTGCAGTCTCAGGG - Intergenic
928724217 2:34152143-34152165 GGGTGGGTCTTGTAGTCTCAGGG - Intergenic
930007238 2:46907789-46907811 AGGTAGGTCTGGCAGTGGCTTGG - Exonic
932000109 2:67877379-67877401 AGGTGGATCTGGCTGCCTCAAGG + Intergenic
932417756 2:71584059-71584081 GGCTGGGGCTGGCAGCCACACGG - Intronic
935962811 2:108444086-108444108 AGTTGGGGCTGGCAGTATCAGGG + Intergenic
936374871 2:111931891-111931913 AAGTAGAGCTGGCAGTCACATGG - Intronic
937290607 2:120779510-120779532 GGGTGGGTCTGCCGGTAACATGG + Intronic
937315243 2:120928004-120928026 AGGTGGGTATGACAGGGACAGGG - Intronic
937812821 2:126217773-126217795 AGGAGGGCTTGGCAGTCACTAGG - Intergenic
939448425 2:142340004-142340026 AGCTGGGTCTGGTAGCCTCATGG - Intergenic
944627452 2:201585980-201586002 AGGTTGGTCTTGCTGTCTCAAGG - Intronic
946021627 2:216644219-216644241 ATGTGGGGCTGGCAGCCAGAAGG - Intronic
946309650 2:218876287-218876309 AGGGGGGTGGGGCAGGCACAGGG + Intergenic
946420771 2:219563322-219563344 AGGTGGGCCTCGGAGGCACAGGG - Intronic
947818861 2:233057147-233057169 AGGGTGGTCTGGCAGGCACCTGG - Intergenic
948238478 2:236408571-236408593 ATGTGGGTGTGGCAGTGACATGG + Intronic
1169818046 20:9679039-9679061 AGGTTGGTCTTGCTGTCTCAGGG - Intronic
1170447066 20:16439312-16439334 AGGTGGCTCTGGCTGCCATATGG - Intronic
1170879183 20:20279575-20279597 GGGTGGGTCTTGCTGTCTCAGGG + Intronic
1171228228 20:23459116-23459138 AGGTGGGCCAGGCAATCAGAAGG - Intergenic
1173251091 20:41364640-41364662 AGGGGGGCCTGGCAGGCCCAGGG - Intronic
1173711725 20:45163271-45163293 GGGTGGGTCTGGTATTTACAAGG + Intergenic
1174090534 20:48043655-48043677 AGGGGAGTCTGGGTGTCACATGG + Intergenic
1175184078 20:57168025-57168047 GGGAGGGTCTGGAAATCACAAGG + Intergenic
1176227562 20:64010317-64010339 AGGTGAGTCTGGCGGGCTCAGGG + Exonic
1176299135 21:5090358-5090380 AGGTGGGCTTGGGGGTCACAGGG + Intergenic
1177382022 21:20356660-20356682 AGGTGGATCTGGCTGCCACCTGG + Intergenic
1178291730 21:31374128-31374150 AGTTGGGTCTGGAACTTACATGG - Intronic
1179019381 21:37624665-37624687 ATGTGGGTGTGGCAGTTACAGGG - Exonic
1179063912 21:38006010-38006032 AGGTGGGTGTGGCTGTCTGAGGG + Intronic
1179857891 21:44171590-44171612 AGGTGGGCTTGGGGGTCACAGGG - Intergenic
1180069077 21:45427199-45427221 AGGTGGATATGGCACCCACACGG - Intronic
1180072484 21:45443282-45443304 GGGTAGGTCTGGCAGCCCCATGG + Intronic
1180869601 22:19138712-19138734 TGGTGACTGTGGCAGTCACAGGG - Intronic
1181463316 22:23097831-23097853 TGGTGGGTCTGCCAGTCACACGG + Intronic
1182466706 22:30521335-30521357 AGGTGGAGCTGGCAGCCAGATGG + Intergenic
1182842677 22:33404474-33404496 AAGTGGCTCTGGCAGCCATAAGG + Intronic
1183483323 22:38076486-38076508 AGGAGGGGCTGGCTGTCACCAGG + Intergenic
1184292460 22:43505421-43505443 AGGGGGGTGTGGCAGTCATAGGG - Intronic
1184457151 22:44617080-44617102 GGGTGGATGTGGCAGTCTCAGGG - Intergenic
1184962924 22:47944647-47944669 TGGTGGGTATAGAAGTCACAGGG - Intergenic
949906715 3:8864133-8864155 TGGGGAGTCTGGCAGTTACAGGG - Intronic
950259758 3:11535446-11535468 AGGTTTGTATGGCAATCACAGGG + Intronic
950842343 3:15979613-15979635 AGGTGGCCCAGGCAGCCACATGG - Intergenic
951569715 3:24049132-24049154 AGTTGGTGCTGGCAGTCAGATGG - Intergenic
951580651 3:24159295-24159317 AGGTGTATCCTGCAGTCACATGG + Intronic
952822416 3:37496593-37496615 AGGTGGTTCTGGCTGCTACATGG - Intronic
953124287 3:40076709-40076731 AAGGGGGACTGGCAGCCACATGG + Intronic
953250437 3:41241574-41241596 AGGTGGCTCTGGAAGTACCAAGG + Intronic
953379599 3:42458367-42458389 AGGTTGGTCTTGCTGTCTCAGGG + Intergenic
953586725 3:44207723-44207745 AGGTGGGTCTTGCATTTCCAAGG + Intergenic
954297185 3:49680772-49680794 ATGAGGGTTTGGCACTCACAGGG + Intronic
954375265 3:50191284-50191306 AGGTGGGGCTGGCAGTGAGAGGG - Intergenic
954622157 3:52002480-52002502 AGGTGTGTCTGGCAGAAGCAGGG - Intergenic
956557620 3:70540375-70540397 AGGTGATTCTGGAAGTCAAAGGG - Intergenic
957390338 3:79558243-79558265 AGGTTGGTCTTGCTGTCTCAGGG - Intronic
957979928 3:87495630-87495652 AGGTTGGTCTTGCTGTCTCAGGG + Intergenic
961457181 3:127030063-127030085 AGGTGGGCCTGGCTGGCAGATGG + Exonic
961891959 3:130137815-130137837 AGGTAGGTGTGGGGGTCACAAGG + Intergenic
962204504 3:133423844-133423866 AGGTGGCTTTGGCAGTCAGGAGG - Intronic
963530598 3:146469563-146469585 AGGTGTGCCTGGCAGTCACGGGG - Intronic
963744695 3:149114641-149114663 ACTTGGGGCTGGCAGCCACAAGG + Intergenic
963778880 3:149466735-149466757 AGGTGATTCTGGCAGTCGGAGGG - Intergenic
966699759 3:182835099-182835121 AGGTTGGTCTTGCTGTCTCAGGG + Intronic
967225953 3:187291535-187291557 AGGTGAGTCTGTCAGTGACAAGG + Intronic
967313315 3:188127127-188127149 AGGTGGGGCTGGAGGTGACAGGG - Intergenic
969055949 4:4402826-4402848 AGGTGGGCCAGGCAGTCTCTAGG - Intronic
969324438 4:6432874-6432896 GGGTTGGTCTTGCAGTCTCAGGG - Intronic
969616939 4:8258823-8258845 AGGTGGGTCTGGCCACCACAGGG - Intergenic
975273731 4:72469683-72469705 GGGTTGGTCTTGCTGTCACAGGG - Intronic
976321197 4:83717944-83717966 AGGTTGGTCTTGCTGTCTCAGGG - Intergenic
979959857 4:127005134-127005156 AGAGGGGTGTGGGAGTCACAAGG + Intergenic
980970678 4:139564416-139564438 AGGGGGAGCAGGCAGTCACATGG + Intronic
981440850 4:144780133-144780155 AGGTGGCTTTGGCAGTGACGGGG - Intergenic
982085726 4:151834358-151834380 AGGTGAGTCTGGCATTTACTCGG + Intergenic
986793747 5:11189412-11189434 AGGTTGGTCTTGCTGTCTCAGGG - Intronic
987072641 5:14352292-14352314 AAGCAGGTCTGGCAGCCACAGGG - Intronic
989259161 5:39399995-39400017 AGGTAGGCTTGGGAGTCACAGGG - Intronic
990511019 5:56489011-56489033 AGGTGGCCCAGACAGTCACAGGG - Intergenic
992374442 5:76174517-76174539 AGGTGGGAGTGGCAGTGCCATGG - Intronic
993638565 5:90374792-90374814 AGGTTGGTCTTACAGTCTCAGGG + Intergenic
994442509 5:99827956-99827978 AGGTTGGTCTTGCTGTCTCAGGG - Intergenic
995512564 5:112923059-112923081 AGGAGTGTCTGGAAGTCATATGG - Intergenic
996471967 5:123871517-123871539 AGGCAGTGCTGGCAGTCACAAGG + Intergenic
997522011 5:134528970-134528992 AGGTGGGACTGCCAGTCCCCAGG + Intronic
997702282 5:135911159-135911181 AGCTGGGTCAGGCAGAGACAGGG + Intergenic
997862777 5:137433541-137433563 AGGTGGTTTTGGCAGCCAAATGG - Intronic
998771573 5:145551863-145551885 AGGTGTGTCTGGCAGGAGCAGGG + Intronic
1000240503 5:159404211-159404233 AGGTGGGGAAGGCTGTCACATGG + Intergenic
1000326608 5:160177123-160177145 AGGAGGGTTTGGGAGGCACAGGG + Intergenic
1001058851 5:168471232-168471254 AGGGGGGCCTGGAAGCCACAGGG - Intronic
1001114952 5:168931643-168931665 GGGTGGGTCAGGCAATCTCACGG + Intronic
1001420290 5:171581229-171581251 AGGTGAGCCAGGCAGCCACAGGG + Intergenic
1001720282 5:173851558-173851580 AGGAGGGTCTGACTGTCACTTGG + Intergenic
1001869717 5:175140773-175140795 AAGTGGCTCTGGCAGAGACAGGG + Intergenic
1001975899 5:175998119-175998141 TGGTGTGCCGGGCAGTCACAGGG - Intronic
1002241527 5:177845653-177845675 TGGTGTGCCGGGCAGTCACAGGG + Intergenic
1002390979 5:178911446-178911468 AGGTTGGTCTTGCTGTCTCAGGG - Intronic
1005936883 6:30529795-30529817 AGGTGGGTATGGGACACACAGGG + Intergenic
1006262929 6:32891960-32891982 AGGTTGGTCTCGCTGTCTCAAGG + Intergenic
1006393387 6:33771945-33771967 AGGAGGGTCGGGCAGCCCCAGGG - Exonic
1006399665 6:33809836-33809858 AGCTGTGGGTGGCAGTCACATGG + Intergenic
1008619559 6:53258444-53258466 GGGTGGGTCTTGCAGCCACAGGG - Intergenic
1010320784 6:74506608-74506630 AGGTTGGTCTTGCTGTCTCAGGG + Intergenic
1010781417 6:79949373-79949395 AGCTGGGAATGGCGGTCACACGG + Intergenic
1011026734 6:82877699-82877721 AGTTGGGGCTGTGAGTCACATGG + Intergenic
1014342775 6:120229649-120229671 GGCTGTGGCTGGCAGTCACAGGG - Intergenic
1017182208 6:151564495-151564517 AGGTGGGTCTTTCAGTCCCTGGG + Intronic
1018445151 6:163851158-163851180 AGGTTGGTCTTGCTGTCTCAGGG - Intergenic
1019549134 7:1593604-1593626 AGGTGGGTCTGGCTGCCCCGAGG - Intergenic
1020944849 7:14590532-14590554 AAGCTGGTCTGACAGTCACATGG - Intronic
1022109597 7:27220374-27220396 AGATGGGGCTGGCAGTGGCACGG - Intergenic
1022518870 7:30993006-30993028 AGGTGGGGCTGTCTGACACAGGG + Intronic
1023619077 7:42051212-42051234 AGGTGCATCAGGCAGTCATAAGG + Intronic
1024536648 7:50440391-50440413 AGGTGTTTCTGGAGGTCACAAGG - Intergenic
1024696228 7:51859323-51859345 ATGTGCGTCTGGGAATCACAGGG + Intergenic
1033580790 7:142733333-142733355 AGGTGGGTCGGGGAGACAGATGG - Intergenic
1034047909 7:147949339-147949361 AGGTTGGTCTTGCTGTCCCAGGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034688891 7:152998271-152998293 AGGAGGGGCTGGAAGTCAGATGG + Intergenic
1035549944 8:514623-514645 ATGTGGATCCGGCAGTCACAGGG - Intronic
1036216695 8:6885676-6885698 AGGTTGGTCTTGCTGTCTCAGGG - Intergenic
1037559404 8:20059216-20059238 AGGTGGGTTTGTGATTCACAAGG - Intergenic
1037837726 8:22224111-22224133 AGGAGGGACTGGCAGCCACGAGG + Intronic
1038143852 8:24875625-24875647 AGGTGGGTGTCACTGTCACATGG - Intergenic
1039772690 8:40703655-40703677 CTGTAGATCTGGCAGTCACACGG + Intronic
1041763353 8:61391424-61391446 AGGTGGGTAAGCCAGACACAGGG + Intronic
1043097525 8:75994475-75994497 AGTTGGGGCTGGCAGTGGCAGGG + Intergenic
1043761611 8:84075744-84075766 GGGAGGGGCTGGCAGTCAAATGG + Intergenic
1044208209 8:89517299-89517321 GGGTTGGTCTGGCTGTCTCAGGG - Intergenic
1044210627 8:89545819-89545841 AGGAGGGTCTTGCTGTCTCAGGG + Intergenic
1045365233 8:101469943-101469965 AGGTGGCTGAGGCAGACACATGG + Intergenic
1045981782 8:108198048-108198070 GGGTTGGTCTTGCAGTCTCATGG - Intergenic
1048361566 8:133701506-133701528 AGGTAGGTCTGCCCTTCACAGGG - Intergenic
1049341520 8:142115033-142115055 AGGTGGGTGTGGCAGCTTCAGGG + Intergenic
1051782698 9:20707702-20707724 AGGTTGGTCTTGCTGTCTCAGGG + Intronic
1053305228 9:36980198-36980220 AGGTGGCTCTTGGAGGCACAAGG + Intronic
1053463293 9:38287409-38287431 AGGTGAGGCTGGCAGTGGCAAGG - Intergenic
1054745831 9:68853107-68853129 TGATGAGTCTGGCAGTCACATGG + Intronic
1055413762 9:76060478-76060500 GGGTTGGTCTTGCAGTCTCAGGG + Intronic
1055468969 9:76592639-76592661 TGGTGGGGCTGGCAGTCAAGAGG + Intergenic
1056464686 9:86842231-86842253 GGGTTGGTCTTGCTGTCACAAGG - Intergenic
1057554997 9:96080899-96080921 AAGAGTGTCTGGCAGGCACATGG + Intergenic
1057851379 9:98569237-98569259 GGAAGGGTGTGGCAGTCACATGG + Intronic
1059759013 9:117320787-117320809 AGGTGGGGGTGGCAGTTACGGGG - Intronic
1060402672 9:123357422-123357444 AGGTGGGACTGGGAGACACTTGG - Intronic
1060573689 9:124668308-124668330 GGGTTGGTCTTGCTGTCACAAGG + Intronic
1060658302 9:125387944-125387966 AGGTGTGTCTGGCTGCCAGAAGG + Intergenic
1061392790 9:130327157-130327179 AGGTGGATATGGCTGTCAGAAGG - Intronic
1062734172 9:138126246-138126268 AGGTGGCTGTGGCAGCAACAGGG + Intergenic
1185717784 X:2356647-2356669 AGGTTGGTCTGGCTTTCTCAGGG - Intronic
1186089935 X:6035720-6035742 AGGTTGGTCTTGCAGTCTCAGGG - Intronic
1186729994 X:12399749-12399771 GGGTTGGTCTGGCTGTCTCAGGG + Intronic
1186812613 X:13205139-13205161 CGGTGGGTCTTGCTGTCTCAGGG + Intergenic
1188159726 X:26784591-26784613 AAGTGGGTCTTCCAGTCCCATGG + Intergenic
1189116002 X:38343234-38343256 GGGAGTGTCTGGTAGTCACAGGG + Intronic
1189422137 X:40865538-40865560 AGGTTGGTCTTGCTGTCTCAAGG - Intergenic
1190414408 X:50167075-50167097 GGGAGGGTCTGGCACTGACAGGG - Intergenic
1190942699 X:55057587-55057609 ACGTGGCTCTGTCAGTTACAGGG + Intergenic
1195135842 X:101906678-101906700 ATGTGGGTCTTGGAGCCACAGGG - Intronic
1195313996 X:103659985-103660007 AGGTGGGCTTGGCTGCCACATGG + Intergenic
1195388323 X:104334643-104334665 AAGTGGATATGGAAGTCACACGG + Intergenic
1198408179 X:136337482-136337504 AGATAGGTCTGCCAGTGACAAGG + Intronic
1198761051 X:140032994-140033016 AGGTGGGTCTGGCAATTTTATGG + Intergenic
1199976622 X:152898186-152898208 TGGAGGGTCGGGCAGTCGCAGGG - Intergenic
1201179500 Y:11332120-11332142 GGGTGGGGCTGGCTGTCCCAGGG + Intergenic