ID: 916079589

View in Genome Browser
Species Human (GRCh38)
Location 1:161224102-161224124
Sequence GGGACAGGGTTGAGGGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916079589 Original CRISPR GGGACAGGGTTGAGGGCTAT GGG Intergenic
900286982 1:1906526-1906548 GGCACAGGGTCGAGGGCAGTGGG + Intergenic
900375558 1:2352978-2353000 GGGAGAGGGCTGGGGGCCATGGG - Intronic
900376151 1:2355781-2355803 GAGACAGGGCTGAGGGCTGAGGG - Intronic
902075387 1:13780704-13780726 GGGACAGGGTGGAGGGGAAGAGG - Exonic
903237031 1:21956826-21956848 CGGGCAGGGTGGAGGGCTCTTGG - Intergenic
903419280 1:23206829-23206851 GGGCCAGGCGTCAGGGCTATAGG - Intergenic
903833774 1:26189940-26189962 GGGACTGGGGTGAGTGCTCTTGG + Intergenic
904683032 1:32241861-32241883 GGCACAGGGTTAAGGACTTTAGG - Intergenic
905182503 1:36175865-36175887 GGGACATGGCAGAGGGCAATTGG + Intronic
905927353 1:41760899-41760921 GGGACATGTTTGAGGGTCATGGG - Intronic
906380992 1:45332093-45332115 GGCACAGGGTTGAGTGTCATAGG + Intronic
906921158 1:50065819-50065841 GTGTCGGGGTTGAGGGCTATAGG + Intronic
908986498 1:70030097-70030119 AGGACAGAGTTGAGGGCTTGAGG - Intronic
912945523 1:114081048-114081070 GGGAGAGGGTGGAGGGCTGGAGG + Intergenic
912953371 1:114135793-114135815 GGGAGAGGGGTGAGGGCCAGGGG - Intronic
913039836 1:115011513-115011535 TGGACAGGGGTGGGGGTTATAGG + Intergenic
915562012 1:156693040-156693062 GGGACAGGGCTGTGGGCTGTGGG - Intergenic
916079589 1:161224102-161224124 GGGACAGGGTTGAGGGCTATGGG + Intergenic
920503773 1:206501966-206501988 TGGCCAGGGTTGAGGGCTGGTGG - Intergenic
920611063 1:207438390-207438412 GGGGCAGGCTAGAGTGCTATGGG + Intergenic
920856641 1:209668119-209668141 GAGTGAGGGTTGAGGGATATGGG + Intergenic
921604181 1:217136563-217136585 GGGACAGGGGTGAGGGCGTGCGG - Intronic
921907534 1:220511101-220511123 GGGATAGGGTTGAGGTGTATAGG - Intergenic
922785276 1:228279491-228279513 AGGACAAGGTTCAGGGCTGTTGG + Intronic
923676693 1:236086635-236086657 GGGAGAGGGTTGGGTGCTTTTGG + Intergenic
1063775528 10:9259440-9259462 GAGACAGAATTGAGGGTTATTGG - Intergenic
1066787556 10:39022256-39022278 GGGAGAGCATTGAGGGCTATGGG - Intergenic
1067319669 10:45205764-45205786 GGCACTGGGTTGAGGGGTCTGGG + Intergenic
1067979896 10:51073727-51073749 GGGAAAGGGTTGTGGGGTAGGGG - Intronic
1068936044 10:62636706-62636728 GGGAGAGGGTTGAGAGTTAAAGG - Intronic
1070289784 10:75106620-75106642 GGGCCAGTGTGGAGGGCTCTGGG - Intronic
1072168091 10:92833087-92833109 GGCTGAGGGTTGGGGGCTATTGG + Intergenic
1072225041 10:93361097-93361119 TGGACAGGGTTGTGGGGTAGAGG + Intronic
1073672062 10:105602367-105602389 GAGAGAGGGTTAAGGCCTATAGG + Intergenic
1074672313 10:115805675-115805697 GGGTTAGGGTTGGGGGTTATGGG + Intronic
1074687726 10:115975320-115975342 GGGGCAGGGATTAGGGCTACAGG + Intergenic
1074777118 10:116774820-116774842 GGGCCAGGGTGGAGGGCTCCAGG - Intergenic
1075120812 10:119663244-119663266 GGCACAGGGTTGGGGGTTAGAGG + Intronic
1077093394 11:789456-789478 AGGACAGGGTTCTGGGCTGTGGG + Intronic
1077247753 11:1547572-1547594 GGGGCAGGATTGAGGGCAGTAGG - Intergenic
1078942217 11:16020237-16020259 GAGAGAGGGTTGAGGGCAAGAGG - Intronic
1080903768 11:36520785-36520807 GGGACAAAGTTGATAGCTATTGG + Intronic
1083898789 11:65633700-65633722 GGGACAGGGTTCAGGGCAGGTGG + Intronic
1085040813 11:73325257-73325279 GGGACAGGACTCAGGGCTAGGGG - Intronic
1089099942 11:115954186-115954208 GGTAGAGGTCTGAGGGCTATGGG - Intergenic
1089581628 11:119485062-119485084 GGGACAGGGGTAAGGGGTGTGGG + Intergenic
1091600333 12:1914081-1914103 GGGACAGGCCTGGGGGCTGTGGG + Intronic
1094499314 12:31008376-31008398 AGGACAGGGAAGAGGGCTCTGGG - Intergenic
1095392084 12:41719567-41719589 GGGACGGGGTTGAGGCATAGAGG - Intergenic
1096008707 12:48194421-48194443 GGGAAAGGGTTGCTGGTTATGGG + Intergenic
1096537252 12:52283066-52283088 GGGACAGGATTAGGGGCTAGAGG - Intronic
1096984247 12:55745739-55745761 GGTCCAGGGTTGAGGGCTGGGGG - Intronic
1097039194 12:56144371-56144393 AGGACAGGGTTGAGGACAGTGGG - Intronic
1097066810 12:56326677-56326699 GGGACAGGGATGAGGGAAAGAGG + Exonic
1097237511 12:57550137-57550159 GGGACAGAGTTGAGGGCGCCCGG - Exonic
1097286308 12:57879908-57879930 GGGATATGGATGTGGGCTATAGG + Intergenic
1102053415 12:109879586-109879608 AGGACAGGGGTGAGGGTTGTCGG - Intronic
1102693431 12:114779576-114779598 GGGACAGGGCTGAGGACAAGGGG + Intergenic
1102779690 12:115553395-115553417 GGTGCAGGGGTGAGGGCTTTGGG - Intergenic
1103702441 12:122854978-122855000 GGGACAGGATTGAGGCCGGTGGG + Intronic
1103933004 12:124460473-124460495 AGCACAGGGTTGAGGGCAGTGGG + Intronic
1104190972 12:126481442-126481464 GGCACTGGGTTGAGGGCACTGGG - Intergenic
1104970206 12:132527596-132527618 GGGGCAGGGTTGAGGGCTGCGGG + Intronic
1104970216 12:132527624-132527646 GGGGCAGGGTTGAGGGCTGCGGG + Intronic
1104970226 12:132527652-132527674 GGGGCAGGGTTGTGGGCTGCGGG + Intronic
1104970236 12:132527680-132527702 GGGGCAGGGTTGTGGGCTGCGGG + Intronic
1104970246 12:132527708-132527730 GGGGCAGGGTTGTGGGCTGCGGG + Intronic
1104970253 12:132527728-132527750 GGGGCAGGGTTGAGGGCTGTGGG + Intronic
1104970263 12:132527756-132527778 GGGGCAGGGTTGTGGGCTGCGGG + Intronic
1104970273 12:132527784-132527806 CGGGCAGGGTTGAGGGCTTCGGG + Intronic
1109300770 13:60587618-60587640 GGAACCGGGATGAGGGCTTTTGG - Intergenic
1109620384 13:64896752-64896774 TTGACAGGGTTGAGGATTATTGG - Intergenic
1112624967 13:101093654-101093676 TGGACTAGGTTGAGTGCTATAGG + Intronic
1114527528 14:23376008-23376030 GGGACAGGATGGGGGGCTTTGGG + Exonic
1116920664 14:50569798-50569820 GGGACAGGGCTGCTGGATATAGG + Intronic
1121684294 14:95821624-95821646 GGGACATGGTGGGAGGCTATTGG + Intergenic
1122124549 14:99572059-99572081 GGGTTAGGGTTGGGGGCTCTGGG - Intronic
1122211373 14:100176111-100176133 GGGACATGTTTGAGGTCTTTGGG - Intergenic
1122416398 14:101551678-101551700 GGGACAGGGTGGGAGGCTAGAGG - Intergenic
1122924653 14:104894067-104894089 GGGCCCGGGATGAGGGCTAGGGG - Intronic
1126527208 15:49669293-49669315 GGGACAGGGATGTGGGCTGCAGG + Intergenic
1127010210 15:54617362-54617384 GGGGCAGGGAGGAGGGATATGGG + Intronic
1128328553 15:66741068-66741090 GGCAGAGGGATGAGGGCCATTGG - Intronic
1129150701 15:73685864-73685886 AGGGCAGGATGGAGGGCTATGGG + Intronic
1129702166 15:77774316-77774338 GGCAGAGGGCTGAGGGCTGTTGG - Intronic
1132196799 15:99919629-99919651 GGGGCAGGTTTGAGGGCCATTGG - Intergenic
1132757756 16:1494139-1494161 GGACCAGGGTTGAGGGGTGTGGG + Intronic
1134805626 16:17121741-17121763 GGGCAAGGGTTGGGGGATATAGG - Intronic
1136497815 16:30654780-30654802 GGGACGGGGGTGGGGGCTGTGGG - Exonic
1136536629 16:30903367-30903389 GGGACAGGGCTGAGGCCCAAAGG - Exonic
1137394990 16:48110658-48110680 GGGAGAGGGTAGAGGGCTTGAGG - Intronic
1139255423 16:65536602-65536624 GGGAGAGGGATGAGGGATAAGGG - Intergenic
1139422062 16:66854947-66854969 GGGACAGGGTGGAGGGAGGTGGG + Intronic
1139512205 16:67433918-67433940 GGGGCGGGGTTGAGGGCCAGGGG + Intronic
1139690489 16:68638576-68638598 GGGTCAGAGGTCAGGGCTATCGG - Intronic
1141627112 16:85267127-85267149 AGGTCAGGGCTGAAGGCTATCGG + Intergenic
1145304526 17:21666105-21666127 GGGACAGGCCAGAGGGCTACAGG - Intergenic
1147600132 17:41740184-41740206 GGGGCTGGGCTGAGGGCTCTAGG - Intergenic
1147904923 17:43816476-43816498 GGGACAGGGTTCAAGGCCTTAGG - Intronic
1148656261 17:49285990-49286012 GGGACACAGCTGAGAGCTATTGG + Intergenic
1149490516 17:57081741-57081763 GGTACTGGGTTGAGGTCTAATGG + Intergenic
1150639050 17:66937365-66937387 GGGTCAGGACTGAGGGCTTTTGG + Intergenic
1151953695 17:77369978-77370000 GGGACAGGGAAGAGAGCCATAGG - Intronic
1152477143 17:80525885-80525907 GGGGCAGGGTGGGGGGCTTTGGG - Intergenic
1157899836 18:51504322-51504344 GGGGCAGGGTAGAGGGATGTAGG + Intergenic
1159997342 18:74978932-74978954 GGGAGAGGCGTGAGGGCTGTGGG + Intronic
1160243667 18:77140510-77140532 GGGCCAGTGTTGGGGGCTTTTGG - Intergenic
1160505207 18:79423007-79423029 GGGACAGTGTTGGGGGCTGCTGG + Intronic
1160861866 19:1240566-1240588 GGGACAGGGTGGAAGGCTGCAGG - Intergenic
1161960251 19:7519381-7519403 GGGACAGTGTTGAGGTCTTCAGG - Exonic
1162220009 19:9168288-9168310 GGGAGAGGGTAGAAGGCTGTTGG - Intergenic
1162576503 19:11502276-11502298 GAGACAGGGTTTTGGCCTATTGG + Intronic
1163466432 19:17470738-17470760 GGGGCGGGGCTGAGGGCTCTGGG + Intronic
1163934775 19:20432960-20432982 AGGACAGGGCTGATGGCTACGGG + Intergenic
1164460349 19:28442237-28442259 GGGGTAGAGTTGAGGGCCATTGG + Intergenic
1166321645 19:42022590-42022612 GGGACACAGTTGAGGCCTAGGGG - Intronic
1167114379 19:47480249-47480271 GGGGTGGGGTTGAGGGCTAGAGG - Intronic
927034254 2:19156813-19156835 GGACCAAGGTTGAGGACTATAGG + Intergenic
928168831 2:28990454-28990476 GGGAGCGGGATGAGGGCCATCGG - Intronic
931445401 2:62323116-62323138 GGGCCAAGGTTGAGGGCAACTGG - Intergenic
935216287 2:100977640-100977662 GGGACAGGGATGTGGTCTCTTGG - Intronic
938126770 2:128679861-128679883 CTGCCAGGGTTGAGGGATATTGG + Intergenic
941941224 2:171040418-171040440 GGGACAGGGGTTAGGTATATAGG + Intronic
944218116 2:197275689-197275711 GGAACCGGGTTGGGGGCTTTTGG + Intronic
944372941 2:199007863-199007885 GTTGCAGGGTTGAGGGCTAGGGG - Intergenic
945026773 2:205627065-205627087 GGCACAGGGTTGAGGCACATTGG - Intergenic
947352989 2:229265818-229265840 GGGTCAGTGTGGAGGGGTATTGG + Intronic
947702262 2:232244290-232244312 GGGACAGGGGTGAGGAGTGTGGG + Intronic
947720716 2:232367886-232367908 GGGCCAGGGCTGAGGGCCAAGGG + Intergenic
948463716 2:238142399-238142421 GGGCCAGGGTGGATGGCTGTGGG + Intronic
1168837699 20:888675-888697 GGGACAGGGTTGACAGCTCCTGG - Intronic
1170445343 20:16421033-16421055 GGGTCATGGGTGAGGGCTAGGGG + Intronic
1172407933 20:34703250-34703272 GGGTCAGGGCTGGGAGCTATGGG + Intronic
1173125934 20:40336166-40336188 AGGACAGGGCTGAGGGCTCTGGG - Intergenic
1173501906 20:43559913-43559935 GGGACAGGCTTGAGGACTCATGG + Intronic
1174333041 20:49836079-49836101 GGGACAGGGAGGAGAGCTAAAGG - Intronic
1175510460 20:59520874-59520896 GGGGCAGGGTTGAGGGCAATGGG + Intergenic
1175787394 20:61720515-61720537 GGTACAGAGTGGAGGGGTATGGG + Intronic
1175844582 20:62051752-62051774 GGGGCAGCGTTGAGGGCCACAGG - Intronic
1176157305 20:63628029-63628051 GGGATCGGGGTGCGGGCTATAGG - Intergenic
1176171894 20:63699873-63699895 GGGACAGGGCTGAGGCCTGCGGG - Exonic
1176262336 20:64188633-64188655 GTGACAGGGATGTGGGGTATAGG - Intronic
1178812306 21:35895402-35895424 GGGAGGGGGTTGAGGGATAAAGG + Intronic
1180042420 21:45287388-45287410 GGGGCAGGGATCAGGGCGATGGG - Intronic
1180598235 22:16993893-16993915 GTGACAAGGTCCAGGGCTATAGG - Intronic
1182319172 22:29467214-29467236 AGGACAGGGTTGAGTGGCATAGG - Intergenic
1183282020 22:36937217-36937239 GGGACAGGGTTGAGGGAGCAGGG - Intronic
1183951333 22:41354729-41354751 GGGACAGGGTTGGGGGCCAGAGG - Intronic
951511861 3:23511226-23511248 GGGACAGGGGAGATTGCTATTGG - Intronic
952918577 3:38267954-38267976 GGGTCAGGGTGGAGGGGTAGGGG + Intronic
953224766 3:41008575-41008597 AGGACAGACTTGAGGGGTATAGG + Intergenic
953540205 3:43811310-43811332 GGGACAGGATAGAAGGGTATGGG + Intergenic
954297011 3:49679858-49679880 GGAACAGAGTTGAGTGCTAAAGG - Intronic
954878422 3:53818306-53818328 GGGACAAAGTTCAGGGCCATGGG + Intronic
955228705 3:57080658-57080680 GGGAAAAGGTTGAGGACTAGGGG - Intergenic
958878021 3:99637976-99637998 GGGACGGGGCTGAGGGCTGGGGG + Intergenic
958986170 3:100782069-100782091 GAGACAGAGTAGAGGGCTCTGGG - Intronic
960156646 3:114303250-114303272 GGGAGAGGGCTGAGGGATAAAGG - Intronic
963047038 3:141110144-141110166 GGGACAGGGCTGAGGCCTCTGGG - Intronic
963559719 3:146848319-146848341 GGGACAGGATAGATGGCTGTGGG - Intergenic
966890193 3:184401690-184401712 GGTACAGCGGTGAGGGCTGTAGG + Intronic
971005526 4:22370313-22370335 GGGGCTGGGGTGAGGGCTTTTGG - Intronic
973219672 4:47711126-47711148 GGGTCAGGTTTGAGGGGTACTGG - Intronic
973748156 4:53984824-53984846 AAGACAGGGTTGGGGGATATGGG - Intronic
975024485 4:69531876-69531898 GTGACAGGGGTGGGGCCTATGGG - Intergenic
977134925 4:93292269-93292291 GACACAGGGCTGAGGACTATGGG - Intronic
984651734 4:182277951-182277973 GTAACAGGGTTGAGGGCGGTAGG - Intronic
987106725 5:14646994-14647016 GGTCCAGGGTTGAGGGGTAGAGG + Intergenic
991585226 5:68195223-68195245 GGGACAGGGATAAGGGATAATGG - Intronic
992223587 5:74596932-74596954 GGGACTGTGTTCAGGGCTTTGGG - Intergenic
992852573 5:80825203-80825225 TGGATAGGGTAGAGGGCAATGGG - Intronic
994816263 5:104591759-104591781 GGGGCAGGGTTTGGGGCTAAAGG - Intergenic
995086143 5:108112076-108112098 GAGACAGAGTTTAGGGCTCTAGG + Intronic
995552383 5:113294230-113294252 GGGATAGGGTGTAGGGCTGTGGG + Intronic
996383554 5:122886066-122886088 GGGACAGGGTTCAGAGCAAGTGG + Intronic
997360525 5:133291881-133291903 GGGAGAGGGCTGTGGGCCATAGG + Intronic
998377544 5:141701384-141701406 GAGCCAGGGTGGAGGGGTATGGG - Intergenic
999247974 5:150165535-150165557 GGGACAAGGCTGAGGGATTTGGG - Intergenic
1000098725 5:157994247-157994269 GGCACATTGTTGAGGGCTGTGGG - Intergenic
1001271803 5:170318262-170318284 GGGACAGTGTTGTTGGCTGTAGG - Intergenic
1001566242 5:172701250-172701272 GGGGCAGGGGTGAGGTCTGTCGG - Intergenic
1003107584 6:3227851-3227873 GGGAGAGGGGTGGGGGCTACCGG + Intronic
1006420557 6:33931273-33931295 GGGACCGGCTTGAGGGCTGGAGG + Intergenic
1006515728 6:34544590-34544612 GGGACAGAGTTGGGGGCTTCCGG + Intronic
1006808099 6:36801792-36801814 GGGGCAGGGTGGAGGGGTATAGG + Intronic
1007239363 6:40413951-40413973 GGGACAGGGTTGAAGGAAATGGG + Intronic
1007331645 6:41115281-41115303 AGGACAGGATTAAGGGCTCTTGG - Intergenic
1007737592 6:43991167-43991189 GGGGCAGGGCTGAGGGCCAAGGG - Intergenic
1011662833 6:89609022-89609044 GGGCCAGGTTGGAGGTCTATAGG - Intronic
1012536958 6:100310361-100310383 GGAAAAGGGTTGAGAGCTTTTGG + Intergenic
1013178060 6:107694064-107694086 AGGACAGGGTAGAGGCCTCTGGG + Intergenic
1015863116 6:137701181-137701203 GGGACAGGGATGATGGTGATTGG + Intergenic
1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG + Exonic
1017919357 6:158857764-158857786 AGGAGAGGGTAGAGGGCTCTGGG - Intergenic
1018031493 6:159845238-159845260 GGGACAGGATGGAGGGCTCAAGG - Intergenic
1019594307 7:1851290-1851312 GGCACAGGGTTGGGGGCTGATGG + Intronic
1020834465 7:13131799-13131821 GGGACAGGGCAAAGGGATATGGG + Intergenic
1023551647 7:41376316-41376338 GTGACAGGGAAGAGGGCCATGGG - Intergenic
1024322439 7:48084626-48084648 GGGGCAGGGTTCAAGGCTATAGG - Intergenic
1026929218 7:74213902-74213924 GGGACAGAGTTGAGGGTGGTGGG - Intronic
1029706548 7:102279587-102279609 GGGACAGGGCTGGGGGCTGCTGG - Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1034174012 7:149086439-149086461 GGGACAGGGTTTAGCCATATTGG - Intronic
1035865976 8:3082385-3082407 GGGACATGGTGGAGGACGATGGG - Intronic
1039473317 8:37826879-37826901 GGGTCAGGGTTGGGGGCTGAGGG - Intronic
1040136419 8:43859574-43859596 GGGAGAGCTTTGAGGCCTATGGG + Intergenic
1040287469 8:46107803-46107825 GGGACAGGCTTAAGGGCTTTTGG + Intergenic
1040299164 8:46179089-46179111 GGGACAGCCTTGAGGGCTTCTGG + Intergenic
1040303134 8:46198402-46198424 GGGACAGCCTTGAGGGCTGCTGG - Intergenic
1040307734 8:46220917-46220939 GGGACAGGCCTGAGGGCTTCTGG - Intergenic
1040324147 8:46333145-46333167 GGGACAGCGTTGTGGGCTGCTGG - Intergenic
1041707878 8:60865598-60865620 AGGAAAGGGTTGAAGGCTAGCGG - Exonic
1043509031 8:80931702-80931724 GGGAAAGGGTGGAGGGATAGAGG - Intergenic
1044565156 8:93654688-93654710 GGGAGAGGGCAGAAGGCTATTGG - Intergenic
1044911480 8:97064265-97064287 GGGAAAGGGTTTAGGGTTGTGGG + Intronic
1045649082 8:104326266-104326288 GAGACAGGTTTGTGAGCTATTGG - Intergenic
1047808162 8:128380334-128380356 GGGACACAATTGAGGGCCATTGG + Intergenic
1049292626 8:141812755-141812777 GGGTCAGGGGTGAGGGTTCTGGG - Intergenic
1049509158 8:143018976-143018998 GGGACAGCCTTGAGGACTAGGGG + Exonic
1049632365 8:143665598-143665620 GGGACAGGGATAAGGGGGATGGG + Intergenic
1050353333 9:4760933-4760955 GGGACAGGGTTGGGGGCAGTGGG - Intergenic
1055138432 9:72850232-72850254 GGGAGGGGGTTGAGGGATAAAGG + Intergenic
1055934735 9:81594045-81594067 GGGAGAGGGATGGGGGATATGGG + Intronic
1056828363 9:89892127-89892149 GGGACAGGGTTGGGGGCTTGGGG - Intergenic
1058566560 9:106291671-106291693 GCCACAGGGTTGATGGCTATGGG + Intergenic
1059647264 9:116279779-116279801 GGGAGAGGGTAGAGGCCTCTAGG + Intronic
1059750795 9:117245429-117245451 GGGACAGGGCTCAGGGCTGCTGG + Intronic
1060255085 9:122020322-122020344 TGGACAGGGCTGAGGGCAAATGG - Intronic
1060971683 9:127741995-127742017 GGGACAGGGGTGAGGGGTGCGGG + Intronic
1061382025 9:130264554-130264576 GAGACATGGCTGAGGGCTCTAGG - Intergenic
1061826386 9:133260854-133260876 GGGACAGGGCTGATGGGGATGGG + Intronic
1062204415 9:135328068-135328090 GGGACAGGGGTCAGGGGAATAGG + Intergenic
1062368347 9:136222858-136222880 GGGACAGGGGTGAGGGGTCTGGG + Intronic
1062504290 9:136865549-136865571 GGGATAGGGCTGGGGGCCATTGG - Intronic
1185800968 X:3010355-3010377 GCGACAGGGTTTAGGCCTCTTGG + Intronic
1186482624 X:9907545-9907567 GGTAAAGGGTTGAGGGGTCTAGG + Intronic
1186501409 X:10053611-10053633 TGGACATGGTTGAGGGCTAGAGG + Intronic
1187383525 X:18827014-18827036 GGGACGGGGTTGTGGACTATGGG - Intronic
1188963721 X:36525012-36525034 GGGAGAAGGTTGAGGGGCATTGG + Intergenic
1189774820 X:44461267-44461289 GGGAGAGGGTTGAGGGTTGGAGG + Intergenic
1192118272 X:68432159-68432181 GGGATAGGGTTGGGGGCTGCTGG - Intronic
1192203566 X:69082099-69082121 GGGACAGAGGTGAGGCCGATGGG + Intergenic
1195903510 X:109822229-109822251 GGGCAGGGGGTGAGGGCTATGGG + Intergenic
1196068060 X:111487722-111487744 GGGAAAGGATTGAGGACTGTGGG - Intergenic
1196593545 X:117517043-117517065 GTGACTGGGTTCAGGGCTTTTGG + Intergenic
1197339509 X:125248876-125248898 AGGGCAGGATTGAGGGCTATTGG + Intergenic
1200119834 X:153785002-153785024 GGGTAAGGGGTGAGGGCTCTGGG + Exonic
1200182624 X:154159963-154159985 GGGACGGGGGTGGGCGCTATGGG + Intergenic
1200188278 X:154197077-154197099 GGGACGGGGGTGGGCGCTATGGG + Intergenic
1200193928 X:154234217-154234239 GGGACGGGGGTGGGCGCTATGGG + Intergenic
1200199683 X:154272021-154272043 GGGACGGGGGTGGGCGCTATGGG + Intronic