ID: 916081557

View in Genome Browser
Species Human (GRCh38)
Location 1:161236426-161236448
Sequence GAGGGCTATTTCCATTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916081547_916081557 19 Left 916081547 1:161236384-161236406 CCAGCGAGGGTGTAAAGGCTGAC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 916081557 1:161236426-161236448 GAGGGCTATTTCCATTGGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916081557 Original CRISPR GAGGGCTATTTCCATTGGGG AGG Intronic
906728514 1:48061573-48061595 TAGTGCCATTTCCATTTGGGGGG + Intergenic
908092258 1:60698657-60698679 CAGGGCTACTTTTATTGGGGAGG + Intergenic
912260313 1:108105065-108105087 GAGCCCAATTTCCATTGGTGAGG - Intergenic
913200486 1:116492262-116492284 GAGTGCTGTGCCCATTGGGGTGG + Intergenic
913248631 1:116892639-116892661 GAGGGCTATTATCAGTGGGGAGG - Intergenic
914228539 1:145743224-145743246 GAGGGCCACTTACATTAGGGAGG - Exonic
914243248 1:145866873-145866895 GGGGACTATCTGCATTGGGGTGG + Intronic
915636839 1:157193384-157193406 GATGGCTATTTTGATTGGTGAGG + Intergenic
916081557 1:161236426-161236448 GAGGGCTATTTCCATTGGGGAGG + Intronic
923956326 1:239025789-239025811 AAGCGCTACTTCCATTAGGGTGG - Intergenic
1063575571 10:7259290-7259312 GTGGGCACTTTCCAGTGGGGAGG - Intronic
1077873640 11:6284299-6284321 GCGGTCTATTTCCTTTGGGTTGG - Intergenic
1081748087 11:45487123-45487145 GAGGCCCATTCGCATTGGGGAGG + Intergenic
1087880609 11:103410991-103411013 GAGGGCATTTTTCACTGGGGTGG + Intronic
1088591997 11:111411470-111411492 GAGTGCTATTTCCAATAGGATGG - Intronic
1089488584 11:118866508-118866530 GAAGTCTATTTCCTTTGGGTTGG - Intergenic
1090528004 11:127558591-127558613 GAGGGCTGTTTTGAATGGGGGGG + Intergenic
1090753809 11:129771030-129771052 AAGGGATATTTCCATTAGGAAGG - Intergenic
1090938843 11:131370148-131370170 GAATGATATTTCCATTGGAGGGG + Intergenic
1091308189 11:134554222-134554244 GAGGGCTGTTTCCATGGGCTTGG + Intergenic
1093940057 12:25043242-25043264 GAGGTTTCTTTCCATTGGCGTGG - Intronic
1096679704 12:53247440-53247462 TAGTGGTATTTCCTTTGGGGTGG - Intergenic
1101291949 12:103379211-103379233 GATGCCTGTTCCCATTGGGGTGG - Intronic
1102749731 12:115281907-115281929 GAGTGCTATTGACATTTGGGTGG - Intergenic
1110264003 13:73518030-73518052 GTGGGGTATTTCCATTGCCGAGG + Intergenic
1115315970 14:32025591-32025613 GAGGGCTGTTCCCACTGGGTGGG + Intergenic
1116531580 14:45979292-45979314 GAGGGCTATTACGATGGGAGAGG - Intergenic
1118880399 14:69820559-69820581 TAAAGCTATTTCCATTGCGGGGG - Intergenic
1121509481 14:94501678-94501700 GTGGGCTGTGTCCCTTGGGGCGG - Intronic
1132077244 15:98832048-98832070 GAAGGCTATTTCCAGTGTTGAGG - Intronic
1134085557 16:11355100-11355122 GAGGGTTTTCTCCATTTGGGGGG - Intergenic
1134304309 16:13018546-13018568 GAAGGCGATTTGCAGTGGGGTGG + Intronic
1134383035 16:13746072-13746094 GAGGTCTCTTTTCATTGGTGTGG - Intergenic
1135517955 16:23150832-23150854 GAGCCCTACTTACATTGGGGAGG - Intergenic
1135771272 16:25220246-25220268 GTGGGCTCTTTACATTAGGGGGG + Intronic
1136061273 16:27728266-27728288 GAGGGCACTTTCCGTTGGGTGGG + Intronic
1139263776 16:65621167-65621189 GAGGGCAAGTTCCATTTGTGAGG - Intergenic
1140036768 16:71377241-71377263 AAGCTATATTTCCATTGGGGTGG - Intronic
1141750901 16:85957245-85957267 GGGGGCTACTTCCATTCGCGGGG + Intergenic
1150343057 17:64384393-64384415 GAGGGCAAGGACCATTGGGGGGG - Intronic
1152944242 17:83190545-83190567 GAGGCCTGTTTCCCTTGGGATGG + Intergenic
1161895675 19:7077970-7077992 AAGTGCTTTTTCCATTTGGGGGG + Intronic
1166956005 19:46465223-46465245 TAGGGCTTTTCCCATTGTGGGGG + Intergenic
1167097160 19:47380607-47380629 GAGGGCAATTTAGATGGGGGTGG + Intronic
926410330 2:12596026-12596048 GAAGGCTATTGGCATTGAGGGGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
932732263 2:74229719-74229741 AAGGGATATTTCCCTTGTGGGGG - Intronic
934557662 2:95296034-95296056 GAGGACTGTTTCCAGAGGGGAGG - Intergenic
939433075 2:142136011-142136033 GAGGGCTAATTCCATGTGAGTGG - Intergenic
943282096 2:185947719-185947741 GAGGCCCACTTACATTGGGGAGG - Intergenic
948489319 2:238302315-238302337 AGTGTCTATTTCCATTGGGGTGG + Intergenic
1170493113 20:16898455-16898477 GAGTGATATTTTCATTGAGGAGG + Intergenic
1173713126 20:45177465-45177487 GAGGTCTATTTCAGTTGAGGGGG + Intergenic
1175182023 20:57155440-57155462 GAGCGGTACTTCCTTTGGGGTGG + Intergenic
1175790890 20:61739208-61739230 GGGGGCTGTTTCCCATGGGGAGG + Intronic
1179463031 21:41550458-41550480 GGGGACTATTTCAATGGGGGAGG + Intergenic
1179463092 21:41550808-41550830 GAGGACTATTTCAATGGAGGAGG + Intergenic
1183256790 22:36767453-36767475 GAGGGCTATCTCCAGTGGAAGGG + Intronic
951438366 3:22691588-22691610 GAGGCCTATTCACATTGGGGAGG + Intergenic
953416116 3:42718808-42718830 GAAGTCTATTTCCTTTGGGTTGG - Intronic
954924697 3:54222479-54222501 GAGGCCTATGTACATTAGGGAGG + Intronic
958798892 3:98733529-98733551 TAGGTCTAGTTCCATTGTGGAGG - Intronic
963078291 3:141368227-141368249 GAGGGTGATGTCCTTTGGGGAGG + Intronic
964164385 3:153684600-153684622 AATGCCTATTCCCATTGGGGAGG - Intergenic
967944187 3:194789363-194789385 GAAAGCTATGTGCATTGGGGAGG - Intergenic
968998935 4:3964763-3964785 GGGGGCAGTGTCCATTGGGGAGG + Intergenic
969507529 4:7597478-7597500 GGGGGCTATTGCAATAGGGGAGG + Intronic
970002507 4:11378495-11378517 TAGGGCTATTTGCATTGAGAGGG + Intergenic
974338463 4:60582690-60582712 GATGGCTATATCCATTTTGGTGG + Intergenic
984829738 4:183961258-183961280 GAGGGGTAAATACATTGGGGTGG - Intronic
989615679 5:43334932-43334954 GAGGGGTATTTAGATTGGGAGGG + Intergenic
992027447 5:72684640-72684662 GAGGGCTATTGCCCTGTGGGGGG - Intergenic
1001028598 5:168245209-168245231 CAGCACTATTACCATTGGGGTGG + Intronic
1001566174 5:172700799-172700821 GAGGCCTCTTTCCATTGAGTAGG - Intergenic
1006316649 6:33295588-33295610 GGGGGCTACTTCCACTGGAGAGG - Exonic
1009173313 6:60427850-60427872 GAGAGGTACTTCCATTTGGGTGG - Intergenic
1016519319 6:144929076-144929098 GGGGGCTATTTCAGTTGGTGTGG + Intergenic
1019524611 7:1475189-1475211 GAGGGCTATTTTCATTGCCCAGG - Intronic
1022668103 7:32429883-32429905 GAGGCCTATCCACATTGGGGAGG + Intergenic
1030478764 7:110075057-110075079 GAGGGCTATTTCAAATTGGGTGG + Intergenic
1031299505 7:120046828-120046850 CAAGGCTATTTCAATAGGGGAGG - Intergenic
1032015045 7:128374090-128374112 GATGGCTATTCCCATTGGTGAGG + Intergenic
1032729244 7:134621660-134621682 GAAGGATATTTCCCTTGTGGAGG - Intergenic
1032945837 7:136851556-136851578 AAGGGCTATTTCAAGTGGAGTGG + Intergenic
1041555382 8:59148828-59148850 GGGGGCTATTGCCATCGAGGTGG - Intergenic
1044145620 8:88710202-88710224 AAAGGCTTTTTCCATTAGGGTGG - Intergenic
1045487606 8:102644309-102644331 GAGGCCAATCCCCATTGGGGAGG - Intergenic
1046796971 8:118384041-118384063 GAGGGCTATTGTAGTTGGGGTGG + Intronic
1049425561 8:142536499-142536521 GAGTGCTGTTCCCAGTGGGGTGG + Intronic
1052029210 9:23609506-23609528 GAGGGTTATCTCCATTGTTGAGG - Intergenic
1055250680 9:74301293-74301315 GAGTCCTATTTCCAATGGGAAGG + Intergenic
1056880269 9:90384834-90384856 GAGGGGGATTTCCATGGGGCTGG - Intergenic
1059356858 9:113706550-113706572 GAGGCCTACTCACATTGGGGAGG - Intergenic
1062083441 9:134636538-134636560 GAGGGCAATTTGCTGTGGGGAGG + Intergenic
1187253985 X:17624465-17624487 GAGAGTGATTTCCTTTGGGGAGG - Intronic
1190065140 X:47235108-47235130 GAGGGGAATTTCCATCTGGGAGG - Intronic
1195205916 X:102600103-102600125 GAGGGCTACTTCCACAGGCGAGG + Exonic
1199052657 X:143255086-143255108 GAGGCCTATCCACATTGGGGAGG - Intergenic
1199479483 X:148282420-148282442 GGGGGATATTTCCTTTGGGTGGG + Intergenic
1200148483 X:153939803-153939825 GGGGGCTCTTTCCTATGGGGTGG - Intronic