ID: 916085771

View in Genome Browser
Species Human (GRCh38)
Location 1:161268001-161268023
Sequence ATAGTATTGTCGGCCAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 916
Summary {0: 1, 1: 0, 2: 4, 3: 101, 4: 810}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916085771_916085776 -9 Left 916085771 1:161268001-161268023 CCGCACCTGGCCGACAATACTAT 0: 1
1: 0
2: 4
3: 101
4: 810
Right 916085776 1:161268015-161268037 CAATACTATCTGGTGAGGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 121
916085771_916085777 29 Left 916085771 1:161268001-161268023 CCGCACCTGGCCGACAATACTAT 0: 1
1: 0
2: 4
3: 101
4: 810
Right 916085777 1:161268053-161268075 TCATTTTCATGACACAAAAGTGG 0: 1
1: 1
2: 3
3: 26
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916085771 Original CRISPR ATAGTATTGTCGGCCAGGTG CGG (reversed) Intronic
900211332 1:1457302-1457324 ACAGCATTTTTGGCCAGGTGTGG + Intronic
901544826 1:9948282-9948304 ATGGAGTTGTCGGCCAGGTGAGG + Intronic
901698963 1:11033036-11033058 AAAATATTGTCGGCCGGGCGCGG + Intronic
902426344 1:16325914-16325936 ATGAAATTTTCGGCCAGGTGTGG - Intronic
902950145 1:19876071-19876093 ATAATTTTGTTGGCCAGGTGTGG + Intergenic
903547008 1:24130993-24131015 AAATCATTGTTGGCCAGGTGAGG - Intronic
904216226 1:28922256-28922278 ATAATTTTATAGGCCAGGTGCGG - Intronic
904520257 1:31089750-31089772 GTAGGTTTGGCGGCCAGGTGCGG - Intergenic
905032447 1:34896294-34896316 ATCAGAATGTCGGCCAGGTGTGG + Intronic
905083776 1:35350575-35350597 ATAGTAATTTCAGCCGGGTGTGG - Intronic
905132924 1:35774990-35775012 AAAATAATTTCGGCCAGGTGAGG + Intergenic
905187284 1:36205560-36205582 ATAGTAAACTGGGCCAGGTGTGG + Intergenic
905612230 1:39363900-39363922 TGAGTCTTGTTGGCCAGGTGTGG - Intronic
906552810 1:46679882-46679904 TTTGTATTCTAGGCCAGGTGTGG - Intronic
907171223 1:52466955-52466977 ATATTTTTTTTGGCCAGGTGCGG - Intronic
907362069 1:53925808-53925830 AAAGTATTTTAGGCCAGGTGTGG + Intronic
907531283 1:55100204-55100226 ATAGTATTCTTGGCCGGATGTGG + Intronic
907540132 1:55208335-55208357 ACAATAATGTTGGCCAGGTGCGG + Intronic
908542326 1:65133363-65133385 TTAATATTTTCGGCCAGGCGCGG + Intergenic
909108961 1:71450277-71450299 ATAACATTCTAGGCCAGGTGTGG - Intronic
909923053 1:81405375-81405397 ATACTATTTCAGGCCAGGTGTGG + Intronic
910677661 1:89831194-89831216 AGTGTATTGTGGGCCAGGCGTGG - Intronic
910811332 1:91239822-91239844 ATAGCTTTATTGGCCAGGTGCGG - Intergenic
911382527 1:97133705-97133727 ATTATATTGTAGGCCTGGTGCGG + Intronic
911669861 1:100595659-100595681 AAAGTATTGCTGGTCAGGTGTGG + Intergenic
911770557 1:101735597-101735619 AGAGTAAAGTCGTCCAGGTGAGG + Intergenic
911989207 1:104670964-104670986 ATTTTATGGTAGGCCAGGTGTGG + Intergenic
912047337 1:105475825-105475847 TTTATATTATCGGCCAGGTGTGG + Intergenic
912343992 1:108946871-108946893 ATAGAAATTTTGGCCAGGTGCGG + Intronic
912579653 1:110708599-110708621 AAAGTGTTTTGGGCCAGGTGTGG - Intergenic
912814168 1:112815834-112815856 ATGGTATTATAGGCCAGGCGCGG + Intergenic
913247331 1:116881602-116881624 TTAGAAGTCTCGGCCAGGTGCGG - Intergenic
913320653 1:117586150-117586172 ATAGCAATATCAGCCAGGTGTGG - Intergenic
913488232 1:119353590-119353612 ATACTACTATCAGCCAGGTGTGG - Intergenic
914213366 1:145602444-145602466 ATAGTATTATAGGCCAGGCATGG - Intergenic
914516944 1:148382409-148382431 AGAGTATTTTAGGCCAGGTATGG - Intergenic
914809895 1:151019789-151019811 ATAGAGTTGCAGGCCAGGTGTGG - Intronic
914822112 1:151112629-151112651 CCAGCATAGTCGGCCAGGTGCGG - Intronic
914891115 1:151624254-151624276 TTAGAATTTTAGGCCAGGTGAGG - Intronic
915114542 1:153588105-153588127 AAAATATTCTCGGCCAGGCGTGG + Intergenic
915404543 1:155649539-155649561 ATAGTATATAGGGCCAGGTGCGG - Intergenic
916085771 1:161268001-161268023 ATAGTATTGTCGGCCAGGTGCGG - Intronic
916717823 1:167460109-167460131 ATAAGATTATGGGCCAGGTGTGG + Intronic
916728973 1:167549671-167549693 AAAATATTGCAGGCCAGGTGCGG - Intronic
916867727 1:168878374-168878396 ATAAAAGTGTTGGCCAGGTGTGG - Intergenic
917328308 1:173855949-173855971 AATGTATTCTAGGCCAGGTGTGG - Intronic
917757549 1:178117872-178117894 ATAATATTCTTGGCCAGGCGTGG + Intronic
917866468 1:179200335-179200357 AAAGCATTGTGGGCCAGGCGCGG - Intronic
918402180 1:184174384-184174406 ATTGGATTGTCAGCCAGGCGTGG - Intergenic
918570303 1:185982729-185982751 TTAGGAATGTGGGCCAGGTGTGG - Intronic
919676742 1:200390858-200390880 AAAATTTTGTTGGCCAGGTGTGG - Intergenic
920083398 1:203394786-203394808 AAAGTCCTGTCGGCCAGGTGTGG + Intergenic
920168824 1:204056803-204056825 ATAGAGTTATCGGCCAGGCGAGG + Intergenic
920797474 1:209154533-209154555 ATAGAACTCTTGGCCAGGTGCGG + Intergenic
921125702 1:212175950-212175972 ATAATACTGCTGGCCAGGTGCGG - Intergenic
921170878 1:212548600-212548622 AAAATATTATTGGCCAGGTGCGG - Intergenic
921173644 1:212572000-212572022 AAAGTATTGGCGGCCGGGCGCGG - Intronic
921653980 1:217712414-217712436 AACATATTGTAGGCCAGGTGCGG - Intronic
921866450 1:220092129-220092151 TAGGTACTGTCGGCCAGGTGCGG - Intergenic
921980235 1:221248885-221248907 ATAGTAATAATGGCCAGGTGCGG - Intergenic
922075938 1:222244635-222244657 ATAGTAGGGTGGGCCGGGTGCGG + Intergenic
922113436 1:222585600-222585622 AACGTGTTGTTGGCCAGGTGTGG - Intronic
922303581 1:224324968-224324990 AAGGTATTCTTGGCCAGGTGCGG + Intronic
922432957 1:225574308-225574330 ATAAGATTGTGGGCCAGGCGCGG + Intronic
922480770 1:225939159-225939181 ATTGTATTGTTGGCCAGGCGTGG - Intronic
922486507 1:225977257-225977279 ATAAAACTGTCGGCCAGGCGCGG + Intergenic
922494998 1:226049705-226049727 ATTGTAATGTTGGCCAGGTGTGG - Intergenic
922521815 1:226259248-226259270 TAAGTATTGTTGGCCGGGTGTGG - Intronic
923156870 1:231286853-231286875 AAAGTAGTATTGGCCAGGTGCGG + Intergenic
923406790 1:233668893-233668915 AAAATATTCTTGGCCAGGTGGGG - Intronic
923587096 1:235283064-235283086 GAAGTAGTATCGGCCAGGTGCGG - Intronic
924200636 1:241655092-241655114 ATAGTCTTCTTGGCCAGGCGCGG + Intronic
924224532 1:241910016-241910038 TTAGTGCTGTGGGCCAGGTGTGG + Intergenic
924263828 1:242260056-242260078 AGAGAATTGTTGGCCAGGTGGGG + Intronic
924534949 1:244927594-244927616 AAAGCACTGTGGGCCAGGTGCGG - Intergenic
1062864735 10:842484-842506 ATTATGTTGTGGGCCAGGTGTGG - Intronic
1063669927 10:8091955-8091977 AAACTATTCTCGGCCAGGGGTGG - Intergenic
1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG + Intergenic
1064681281 10:17812859-17812881 AGCCTATTGTTGGCCAGGTGTGG - Intronic
1064735733 10:18379975-18379997 GTAGAATAGTGGGCCAGGTGTGG - Intronic
1064773404 10:18749042-18749064 AAAGAATTTTGGGCCAGGTGTGG - Intergenic
1064939229 10:20714155-20714177 AAAGTTTTTTAGGCCAGGTGTGG - Intergenic
1065031473 10:21590627-21590649 ATACTACTGGCGGCCGGGTGTGG - Intronic
1065066592 10:21973810-21973832 ATATGATTTTTGGCCAGGTGCGG + Intronic
1065366559 10:24942936-24942958 ATTGTATGATAGGCCAGGTGTGG - Intronic
1065440426 10:25748157-25748179 AGAGTATTCTAGGCCGGGTGTGG - Intergenic
1065523868 10:26597835-26597857 ATAGAAGTGGAGGCCAGGTGCGG + Intergenic
1065828083 10:29589876-29589898 ATAATGTTGTTGGCCAGGCGTGG + Intronic
1065911711 10:30312288-30312310 ACAGTATTCTCGGCCAGGCATGG + Exonic
1066396639 10:35030671-35030693 AAAGTAGTGTTGGCCAGGTGTGG - Intronic
1066602266 10:37122288-37122310 ATTGTATTATTGGCCAGGCGCGG - Intergenic
1066720970 10:38338416-38338438 AGAGAATTGTTGGCCAGGTGGGG - Intergenic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1069458754 10:68575091-68575113 GAAGTATTGTAGGCCTGGTGTGG + Intronic
1069492896 10:68876444-68876466 ATTTTTTTGTTGGCCAGGTGTGG - Intronic
1069517998 10:69095015-69095037 AAAGTACTTTCGGCCGGGTGTGG + Intronic
1069644541 10:69983744-69983766 ATAATACAATCGGCCAGGTGCGG + Intergenic
1069746461 10:70717838-70717860 TATGTATTGTCAGCCAGGTGGGG - Intronic
1070026178 10:72634571-72634593 AACATATTGTAGGCCAGGTGTGG - Intergenic
1070029354 10:72662114-72662136 AGAGCAGTGTAGGCCAGGTGCGG - Intergenic
1070036060 10:72725596-72725618 ATATTAATGTAGGCCGGGTGCGG + Intronic
1070131701 10:73660359-73660381 TTAATATTCTGGGCCAGGTGCGG + Intronic
1070903951 10:80055269-80055291 ACAGTATGGTGGGCCAGGCGTGG + Intergenic
1071034129 10:81222900-81222922 ATAGCATTGCCGGCCGGGCGTGG + Intergenic
1071297944 10:84236004-84236026 AACGTATTGCCGGCCGGGTGCGG + Intronic
1071736796 10:88309921-88309943 ATACTGTTTGCGGCCAGGTGTGG + Intronic
1072179734 10:92969982-92970004 ATACAATAGTCGACCAGGTGCGG - Intronic
1072490147 10:95897387-95897409 GTAGTATTATAGGCCGGGTGCGG + Intronic
1073034547 10:100554344-100554366 ATATAAGTGTTGGCCAGGTGTGG + Exonic
1073059908 10:100727420-100727442 ATAGAATTGTTGGCCGGGCGTGG - Intergenic
1073154481 10:101335631-101335653 AAAGAATTTTGGGCCAGGTGTGG + Intergenic
1073157763 10:101361394-101361416 AAAATATTGCTGGCCAGGTGCGG - Intronic
1073172895 10:101527460-101527482 AGAATATTGTTGGCCGGGTGGGG + Intronic
1073279602 10:102343525-102343547 ATAATATTGTGGGCCAGGCACGG + Intronic
1073357302 10:102867289-102867311 TAAGGATTGTTGGCCAGGTGTGG + Intronic
1073420456 10:103420086-103420108 AAAGTATCCTTGGCCAGGTGCGG - Intronic
1073537185 10:104288178-104288200 AAAGTGTTTTCGGCCGGGTGAGG - Intronic
1073858804 10:107711788-107711810 ATAGTAAAATCGGCCAGGCGTGG + Intergenic
1074002165 10:109384138-109384160 AAAGGATTGTGGACCAGGTGTGG - Intergenic
1074739153 10:116467833-116467855 AAAGTAATGTCGGCCGGGCGCGG + Intronic
1075149442 10:119913780-119913802 AAAGTTTTGTGGGCCGGGTGTGG - Intronic
1075176750 10:120171341-120171363 ATATTAGTGTTGGCCAGGTGTGG + Intergenic
1075690665 10:124391900-124391922 AAATTAGTATCGGCCAGGTGTGG - Intergenic
1076110958 10:127859215-127859237 AAAGTAATGGCGGCCAGGTGTGG + Intergenic
1076400316 10:130179126-130179148 AAGGTATTCTTGGCCAGGTGTGG - Intronic
1078002714 11:7510792-7510814 ATAGTATTTTAAGCCAGGTGTGG - Exonic
1078202583 11:9197012-9197034 ATAGTACATTAGGCCAGGTGTGG + Intronic
1079747522 11:24152145-24152167 ATTGTCTTATCAGCCAGGTGCGG - Intergenic
1080474786 11:32580034-32580056 ATAGTATATGTGGCCAGGTGCGG - Intergenic
1080533604 11:33200282-33200304 AGCTTATTGTCGGCCAGGTGTGG + Intergenic
1080754819 11:35186980-35187002 ATAGAATATTAGGCCAGGTGTGG + Intronic
1080812696 11:35721192-35721214 AAAGAATTATAGGCCAGGTGTGG - Intronic
1081108323 11:39100405-39100427 ATGGTTTTGTGGGCCAGGTCTGG - Intergenic
1081465998 11:43317964-43317986 ATTGTAATGATGGCCAGGTGTGG - Intronic
1081816499 11:45946663-45946685 ATAATAAATTCGGCCAGGTGCGG - Intronic
1081965385 11:47166150-47166172 AGAGCATTTTCGGCCGGGTGTGG - Intronic
1082008212 11:47432740-47432762 CCAGTATCGTTGGCCAGGTGCGG + Intergenic
1083030973 11:59591909-59591931 AGAGTACTGGGGGCCAGGTGTGG - Intronic
1083223864 11:61271433-61271455 TGTGTATTGTTGGCCAGGTGCGG - Intronic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1084620425 11:70266753-70266775 ATATGACTGTGGGCCAGGTGCGG + Intergenic
1085638329 11:78175030-78175052 ATAGTTGTATCAGCCAGGTGCGG + Intronic
1086102175 11:83112492-83112514 ACAGCATTGGTGGCCAGGTGTGG + Intergenic
1086618982 11:88861771-88861793 TTAGAACTGTGGGCCAGGTGTGG - Intronic
1087015724 11:93552760-93552782 GTAATAATGTGGGCCAGGTGCGG - Intergenic
1087348603 11:97002996-97003018 AAAATAATATCGGCCAGGTGTGG - Intergenic
1087391115 11:97536675-97536697 AAAGAATTTTTGGCCAGGTGTGG - Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1087689524 11:101303636-101303658 AAAATATTCTGGGCCAGGTGCGG + Intergenic
1088084849 11:105965095-105965117 ATAGTGTCATGGGCCAGGTGCGG - Intronic
1088168257 11:106964687-106964709 AAAATATTTTTGGCCAGGTGAGG + Intronic
1088254754 11:107892791-107892813 ATTGAATTCTGGGCCAGGTGCGG + Intronic
1088488392 11:110363461-110363483 ATTGTATTGTTGACCAAGTGAGG + Intergenic
1088501461 11:110487431-110487453 TTAATATTTTGGGCCAGGTGCGG + Intergenic
1088635690 11:111818067-111818089 ATAGAAGTGAGGGCCAGGTGTGG - Intronic
1089227885 11:116941294-116941316 AAGGTATTTTCGGCCAGGCGCGG - Intronic
1089447747 11:118566940-118566962 AAAATATTGGAGGCCAGGTGCGG + Intronic
1089506254 11:118964401-118964423 TTATTATTGTTGGCCAGGTGTGG + Intergenic
1089851653 11:121502424-121502446 ATAGAATTGTCGGCCGGGCATGG - Intronic
1089979134 11:122757994-122758016 AAGGTCTTGTCGGCCTGGTGCGG - Intronic
1089992573 11:122875481-122875503 ACAGTAATATTGGCCAGGTGCGG + Intergenic
1090317437 11:125806329-125806351 ATTATATTCTCGGCCAGGTGCGG + Intergenic
1092775922 12:11945156-11945178 AAATTATTCTCGGCCATGTGAGG - Intergenic
1092832789 12:12461460-12461482 ATAGGAATGCTGGCCAGGTGCGG - Intronic
1092865200 12:12754351-12754373 AAGTTATTGTTGGCCAGGTGTGG - Intronic
1093000690 12:13992966-13992988 ATAGTATTCCAGGCCAGGGGCGG + Intergenic
1093166865 12:15814199-15814221 ATTGCATTGTTAGCCAGGTGTGG - Intronic
1093465934 12:19448968-19448990 AAAGTAATGATGGCCAGGTGTGG - Intronic
1093704522 12:22259754-22259776 ATAGTATTTTTGGCCGGGCGCGG - Intronic
1093871384 12:24295851-24295873 ACAGTATTCAAGGCCAGGTGCGG - Intergenic
1094315208 12:29132171-29132193 ATAGCACTGGGGGCCAGGTGTGG + Intergenic
1094466389 12:30757695-30757717 ATAGTACTTTTGGCCGGGTGTGG + Intergenic
1094620906 12:32079387-32079409 AAAATATTCACGGCCAGGTGCGG + Intergenic
1094693855 12:32797147-32797169 ATAATATTATTGGCCAGGTTCGG + Intronic
1095569986 12:43674094-43674116 ATTTTATTTTTGGCCAGGTGCGG - Intergenic
1095974909 12:47933321-47933343 AAACTATTTTCAGCCAGGTGTGG - Intronic
1096185291 12:49576270-49576292 ATAAAATTATCAGCCAGGTGTGG + Intronic
1096653279 12:53072888-53072910 AAAGTGTTGTGGGGCAGGTGTGG - Intronic
1097019838 12:56012561-56012583 AAAGTAATTTAGGCCAGGTGTGG - Intronic
1097081617 12:56435531-56435553 AAATTTTTGTAGGCCAGGTGCGG + Intronic
1097123330 12:56752981-56753003 ATACTGGTGTCGGCCAGGCGTGG - Intronic
1097831843 12:64233188-64233210 ATTGTGTTGTGAGCCAGGTGTGG - Intergenic
1097832371 12:64239365-64239387 ATGGTATTTCTGGCCAGGTGCGG + Intergenic
1097929250 12:65166634-65166656 ATTGAATTGTCTGCCAGGTAGGG + Intergenic
1098321229 12:69245793-69245815 ATGGAAGTGTAGGCCAGGTGCGG + Intronic
1098321486 12:69248954-69248976 ATCTTATTCTCGGCCGGGTGTGG + Intronic
1098336379 12:69409324-69409346 ATGTTATTTTTGGCCAGGTGTGG + Intergenic
1098635296 12:72776484-72776506 AAAATATTCTCGGCCAGGCGCGG - Intergenic
1098784080 12:74727536-74727558 AAAGTATGGTAGGCCAGGCGTGG + Intergenic
1098870428 12:75811534-75811556 ATATATTTGTAGGCCAGGTGCGG + Intergenic
1099080854 12:78178449-78178471 ACAGTATTTTGGGCCAGGTGGGG - Intronic
1099208675 12:79758768-79758790 ATATTATTTTGGGCCAGGAGTGG + Intergenic
1099832034 12:87856433-87856455 ATATCATTGTCGGCCGGGCGCGG - Intergenic
1100940432 12:99718188-99718210 AGAGTATTGTCGGCTGGGCGCGG - Intronic
1101164252 12:102011511-102011533 AGTTTATTATCGGCCAGGTGAGG - Intronic
1101381841 12:104220431-104220453 AGTGTATTTTAGGCCAGGTGCGG + Intronic
1101793652 12:107953320-107953342 AGACCATTGTCGGCCGGGTGTGG - Intergenic
1101873669 12:108584463-108584485 ATTTTATAGTCGGGCAGGTGAGG - Intergenic
1102087453 12:110154338-110154360 AAAGTATTTTTGGCCGGGTGCGG + Intronic
1102150001 12:110682487-110682509 ATGGGATTTTAGGCCAGGTGTGG - Intronic
1102321910 12:111943212-111943234 ATAGTATGCTAGGCCGGGTGTGG - Intronic
1102742078 12:115216836-115216858 ATAGTGTCCTCGGCCAGGCGCGG + Intergenic
1103598572 12:122039561-122039583 ATTTTATTTTGGGCCAGGTGTGG + Intronic
1103729380 12:123016753-123016775 ATAGTTTAGTAGGCCAGGTGCGG + Intronic
1103782253 12:123406734-123406756 ATAGCTTTGTGGGCCAGGCGTGG + Intronic
1103828212 12:123757148-123757170 ATTGTATTTTGGGCCGGGTGCGG + Intronic
1104118888 12:125778877-125778899 ATTGTGTTCTCGGCCGGGTGCGG + Intergenic
1104569791 12:129915191-129915213 AAAGTGGTATCGGCCAGGTGCGG - Intergenic
1104667729 12:130659279-130659301 TTATTAATGTCGGCCGGGTGCGG + Intronic
1105350582 13:19611530-19611552 ATAAAATTCTTGGCCAGGTGCGG - Intergenic
1105976416 13:25477644-25477666 ATACAGTTTTCGGCCAGGTGTGG + Intronic
1106007555 13:25785048-25785070 ATAGAAATGTAGGCCACGTGTGG - Intronic
1106189280 13:27437039-27437061 ATACAATTGTAGGCCAGGCGCGG - Intronic
1106527045 13:30550005-30550027 ATAGTGTTTGTGGCCAGGTGTGG - Intronic
1106726532 13:32491918-32491940 ATACTTTTTTCGGCCGGGTGCGG - Intronic
1107160583 13:37222691-37222713 AAAATATTTTTGGCCAGGTGCGG + Intergenic
1108382465 13:49867616-49867638 ATAGAATTACCGGCCAGGTGTGG - Intergenic
1108406700 13:50110760-50110782 AAAATATTGTTGGCCAGGTGCGG + Intronic
1108422375 13:50264418-50264440 ATAATATTTTCAGCCAGGCGCGG - Intronic
1108518572 13:51224176-51224198 AAAGAATTCTTGGCCAGGTGCGG + Intronic
1108621033 13:52183916-52183938 ATATAAATGTCGGCCGGGTGCGG - Intergenic
1109305681 13:60638217-60638239 GTAGAGTTTTCGGCCAGGTGCGG + Intergenic
1109431784 13:62246113-62246135 ATAATATTTGCGGCCAGGAGCGG + Intergenic
1109994186 13:70101717-70101739 ATAGGGCTGTTGGCCAGGTGTGG - Intronic
1110002879 13:70228197-70228219 ATATGATTTTTGGCCAGGTGTGG - Intergenic
1110292858 13:73827069-73827091 ATCATATTGTTGGCCAGTTGCGG - Intronic
1111770989 13:92595476-92595498 ATAGTATTTACGGCCGGGCGCGG + Intronic
1112552614 13:100435751-100435773 AAAGTATAGGCGGCCAGGTGTGG + Intronic
1112628417 13:101133877-101133899 TTCTTATTGTAGGCCAGGTGCGG + Intronic
1113001448 13:105642464-105642486 AAACTATTGTCGGCCAGGCGTGG - Intergenic
1113003469 13:105671529-105671551 ATTGTAATCTTGGCCAGGTGTGG - Intergenic
1113222185 13:108118065-108118087 ATATTTTTCTAGGCCAGGTGCGG + Intergenic
1113494703 13:110717534-110717556 GTAGTATTGTTGGCCAGGCACGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114227696 14:20753876-20753898 ATAGTATTGTCGGCTGGGCACGG + Intergenic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1114440715 14:22744971-22744993 ATGGTATTGTAGGCCGGGCGCGG - Intergenic
1115014111 14:28588891-28588913 AAAGTTTTGTTGGCCAGGTGTGG - Intergenic
1115259797 14:31440333-31440355 AATGTATTGCTGGCCAGGTGTGG - Intronic
1115312833 14:31996389-31996411 ATAGGAATATCGGCCAGGCGTGG - Intergenic
1115565187 14:34619061-34619083 ATAGTTTTGTAGCCCAGTTGTGG - Intronic
1115693793 14:35874783-35874805 ATATGATTTTGGGCCAGGTGTGG - Intronic
1115696125 14:35900526-35900548 ATAGTTTTGTCGGCCGGGCGTGG - Intronic
1116115273 14:40640700-40640722 CTTTTATTGTGGGCCAGGTGCGG - Intergenic
1116453737 14:45093512-45093534 ATAGTATACTCGGCCAGGCACGG - Intronic
1116563187 14:46410211-46410233 ATAGAAATTTCGGCCAGGCGTGG + Intergenic
1116834749 14:49759226-49759248 TTAAAATTGTTGGCCAGGTGCGG + Intergenic
1117146783 14:52843916-52843938 AATGTATTCTTGGCCAGGTGCGG + Intergenic
1117345289 14:54826015-54826037 ATACTATTTTAGGCTAGGTGTGG - Intergenic
1117482215 14:56158643-56158665 AAAATAATCTCGGCCAGGTGTGG - Intronic
1117732500 14:58737301-58737323 ATAGTAGTGCCCGCCGGGTGCGG - Intergenic
1118217874 14:63826588-63826610 AAACTATTGTTGGCCAGGCGCGG - Intergenic
1118271688 14:64348963-64348985 ATATCTTTGTGGGCCAGGTGCGG - Intergenic
1118805600 14:69234055-69234077 AAAGTACTGTGGGCCAGGTATGG - Intronic
1118868512 14:69722190-69722212 ATAGTATTTTCAGCCAGGTGCGG + Intergenic
1118977881 14:70693077-70693099 AATGTCTTGTTGGCCAGGTGTGG - Intergenic
1119256390 14:73201374-73201396 ATGATATTCTCGGCCAGGCGCGG - Intronic
1119333170 14:73810584-73810606 ATAGTAGTCAGGGCCAGGTGTGG + Intergenic
1119512804 14:75224976-75224998 AAGGTATTTTTGGCCAGGTGCGG + Intergenic
1120324075 14:83003273-83003295 ATAATATTTTCGGCCGGGCGCGG - Intergenic
1120374062 14:83677996-83678018 ATACCAATGTCAGCCAGGTGCGG + Intergenic
1120603935 14:86548396-86548418 AAAGTAATATAGGCCAGGTGCGG - Intergenic
1120798550 14:88663823-88663845 ATAGAAATGTTGGCCAGGTATGG - Intronic
1121041210 14:90749693-90749715 TTATTATTATTGGCCAGGTGCGG - Intronic
1121100344 14:91245793-91245815 AAACTATTTCCGGCCAGGTGCGG + Intronic
1121186288 14:91973312-91973334 CTAGTATTTTAGGCCAGGTGTGG - Intronic
1121768389 14:96507563-96507585 AAACTATTTTCGGCCAGGCGCGG - Intronic
1121994537 14:98592117-98592139 ATAGCATTGCTGGCCAGGTGTGG - Intergenic
1123914288 15:25006344-25006366 ATAGAGGTGTGGGCCAGGTGTGG - Intergenic
1123957796 15:25357634-25357656 ATTGTTTTTTAGGCCAGGTGTGG - Intronic
1124472377 15:29999966-29999988 ATAGTCCTTTTGGCCAGGTGTGG + Intergenic
1124474908 15:30024871-30024893 ATAGACTTATTGGCCAGGTGCGG + Intergenic
1124596277 15:31093890-31093912 ATTGCTTTGTCGGCCATGTGCGG - Intronic
1124701740 15:31919637-31919659 ATGGTATTGACGGCCAGGTGTGG - Intergenic
1125637797 15:41203953-41203975 ATATTACTCTAGGCCAGGTGCGG + Intronic
1125843931 15:42833580-42833602 TAAAAATTGTCGGCCAGGTGTGG + Intronic
1126120043 15:45243269-45243291 ATAGAACTCTGGGCCAGGTGTGG + Intergenic
1127226965 15:56941074-56941096 TTATTATTTTAGGCCAGGTGTGG + Intronic
1127379987 15:58422473-58422495 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1127425446 15:58851262-58851284 ATATTTTTGGAGGCCAGGTGCGG - Intronic
1127426354 15:58862766-58862788 ATAGGATTTCTGGCCAGGTGCGG + Intergenic
1127780054 15:62304857-62304879 AAAGAACTGTTGGCCAGGTGCGG + Intergenic
1127851715 15:62919070-62919092 GTAGTCTTTTGGGCCAGGTGCGG - Intergenic
1127919534 15:63482319-63482341 GTAGGATAGTTGGCCAGGTGCGG - Intergenic
1127942811 15:63717561-63717583 TAAGTAGTTTCGGCCAGGTGAGG + Intronic
1129417000 15:75389646-75389668 AGAGCATTGTCAGACAGGTGAGG - Exonic
1130308941 15:82735864-82735886 ATACCAATGTAGGCCAGGTGTGG + Intergenic
1130560861 15:84957555-84957577 ATAGTGTTGTCGGCCAGGCATGG - Intergenic
1131474558 15:92726612-92726634 ATAATGTTTTAGGCCAGGTGCGG - Intronic
1131501191 15:92968229-92968251 TTAATATTTTCAGCCAGGTGTGG + Intronic
1131949662 15:97667893-97667915 ATCATATTGTTGGCCAGATGTGG + Intergenic
1132202008 15:99961488-99961510 AGAGTATGTTTGGCCAGGTGCGG + Intergenic
1132353078 15:101152482-101152504 GTAGTAGTGTAGGCCAGGTGCGG - Intergenic
1132373350 15:101312538-101312560 AAAATATTTTAGGCCAGGTGTGG + Intronic
1132762132 16:1514076-1514098 AGATTTTTGTTGGCCAGGTGCGG + Intronic
1132820727 16:1868563-1868585 AAAATATTATTGGCCAGGTGCGG + Intronic
1133287983 16:4699367-4699389 ACACTATGGTCGGCCACGTGGGG + Intronic
1133456210 16:5944662-5944684 AAGCTATTCTCGGCCAGGTGTGG + Intergenic
1133583324 16:7167274-7167296 ATCCTATTTTCAGCCAGGTGTGG - Intronic
1133664226 16:7950079-7950101 ATAGAATTGTTGGCCGGGAGTGG + Intergenic
1133684444 16:8152802-8152824 ATGGTTTTGTCAGCCAGGTGCGG + Intergenic
1133749241 16:8711947-8711969 TTACTATTTTTGGCCAGGTGCGG + Intronic
1133908636 16:10044320-10044342 AAAATATTGCAGGCCAGGTGTGG - Intronic
1134494036 16:14718104-14718126 ATATTATTTCAGGCCAGGTGTGG + Intronic
1134499416 16:14757228-14757250 ATATTATTTCAGGCCAGGTGTGG + Intronic
1134525967 16:14943856-14943878 ATATTATTTCAGGCCAGGTGTGG + Intronic
1134546440 16:15112507-15112529 ATATTATTTCAGGCCAGGTGTGG - Intronic
1134571176 16:15292461-15292483 ATATTATTGTGGGCCAGGCGTGG - Intergenic
1134581156 16:15371791-15371813 ATATTATTTCAGGCCAGGTGTGG - Intronic
1134713546 16:16342343-16342365 ATATTATTTCAGGCCAGGTGTGG + Intergenic
1134721416 16:16385701-16385723 ATATTATTTCAGGCCAGGTGTGG + Intronic
1134731205 16:16463575-16463597 ATATTATTGTGGGCCAGGCGTGG + Intergenic
1134936224 16:18248293-18248315 ATATTATTGTGGGCCAGTCGTGG - Intergenic
1134946010 16:18326183-18326205 ATATTATTTCAGGCCAGGTGTGG - Intronic
1134953273 16:18366327-18366349 ATATTATTTCAGGCCAGGTGTGG - Intergenic
1135105030 16:19641917-19641939 AAAGAATTCTGGGCCAGGTGCGG + Intronic
1135112603 16:19702270-19702292 ATACTTCTGTGGGCCAGGTGCGG - Exonic
1135312059 16:21413016-21413038 ATATTATTTCAGGCCAGGTGTGG - Intronic
1135365008 16:21845472-21845494 ATATTATTTCAGGCCAGGTGTGG - Intronic
1135446832 16:22525867-22525889 ATATTATTTCAGGCCAGGTGTGG + Intronic
1135594209 16:23729036-23729058 AAAATATTTTCGGCCGGGTGCGG - Intergenic
1136124311 16:28166447-28166469 AATGTATTGGGGGCCAGGTGTGG - Intronic
1136151232 16:28350941-28350963 ATATTATTTCAGGCCAGGTGTGG - Intronic
1136167464 16:28464780-28464802 ATATTATTTCAGGCCAGGTGTGG - Intronic
1136195513 16:28650237-28650259 ATATTATTTCAGGCCAGGTGTGG + Intronic
1136211851 16:28764353-28764375 ATATTATTTCAGGCCAGGTGTGG + Intronic
1136256571 16:29044298-29044320 ATATTATTTCAGGCCAGGTGTGG + Intronic
1136322179 16:29493538-29493560 ATATTATTTCAGGCCAGGTGTGG - Intronic
1136436858 16:30233510-30233532 ATATTATTTCAGGCCAGGTGTGG - Intronic
1137034146 16:35554495-35554517 ATACTATTGCAGGCCAGGCGTGG - Intergenic
1137523705 16:49215222-49215244 AAAGTGTTGAAGGCCAGGTGCGG - Intergenic
1139059982 16:63238503-63238525 ATAGTATTTTGGGCCAGGCACGG + Intergenic
1139735560 16:68984810-68984832 ATATTTTTCTGGGCCAGGTGTGG - Intronic
1139856467 16:69984443-69984465 ATATTATTTCAGGCCAGGTGTGG - Intergenic
1140071861 16:71657366-71657388 ATATTATTGTTGGCCGGGCGTGG - Intronic
1140366262 16:74383623-74383645 ATATTATTTCAGGCCAGGTGTGG + Intronic
1142171679 16:88625707-88625729 AAAGCTTTGTGGGCCAGGTGCGG + Intronic
1142739037 17:1919818-1919840 ATATAATTGTTGGCCAGGCGTGG + Intergenic
1142844438 17:2661803-2661825 ATACTATTATTGGCCAGGCGTGG + Intronic
1143160944 17:4870532-4870554 AAAATATTTTAGGCCAGGTGTGG + Intronic
1143641100 17:8198058-8198080 ATACTATTTTAGGCCAGGCGTGG + Intergenic
1143808212 17:9447886-9447908 AGAATATGGTTGGCCAGGTGCGG + Intronic
1144066625 17:11630142-11630164 ACTGTATTGCAGGCCAGGTGCGG + Intronic
1144109301 17:12016904-12016926 ATAGTAATATTGGCCAGGTGCGG + Intergenic
1144125278 17:12197235-12197257 ATAGGACTGCAGGCCAGGTGCGG + Intergenic
1144176051 17:12708679-12708701 ATAGTATTGCTGGCCAGGCGCGG - Intronic
1144450396 17:15372730-15372752 AAAATATTCTTGGCCAGGTGTGG + Intergenic
1144507093 17:15841330-15841352 AGTGAAATGTCGGCCAGGTGCGG - Intergenic
1144866647 17:18339848-18339870 AAAGGATTCCCGGCCAGGTGAGG - Intronic
1145036686 17:19545778-19545800 TAAGAATTGTTGGCCAGGTGTGG - Intronic
1145171219 17:20658927-20658949 AGTGAAATGTCGGCCAGGTGCGG - Intergenic
1145718500 17:27046411-27046433 ATTTTATTGTCGGCCAGGCATGG + Intergenic
1145796430 17:27658100-27658122 ATAGTATTGCCTGCCTTGTGGGG + Intergenic
1145947022 17:28784091-28784113 AAAATAATCTCGGCCAGGTGTGG - Intronic
1146218671 17:30999402-30999424 GTGGTATTCTTGGCCAGGTGTGG - Exonic
1146321151 17:31847590-31847612 ATAGTAAATTAGGCCAGGTGTGG + Intergenic
1146441606 17:32900915-32900937 ATTTTAATCTCGGCCAGGTGTGG + Intergenic
1147036028 17:37681684-37681706 TTAGTGTTGTTGGCCAGGTGTGG - Intergenic
1147061115 17:37879306-37879328 ATACTATTGACAGCCGGGTGCGG + Intergenic
1147173247 17:38634160-38634182 TTAGAATGGTCGGCCAGGCGTGG + Intergenic
1147275052 17:39308853-39308875 TTTTTATTGTAGGCCAGGTGCGG - Intronic
1147696357 17:42357386-42357408 AAAATACTGTAGGCCAGGTGTGG + Intronic
1147784319 17:42967861-42967883 ATATTTTTGTAGGCTAGGTGCGG - Intronic
1148164796 17:45475855-45475877 ATAGTGTTTTAGGCCAGATGTGG + Intronic
1148243706 17:46016479-46016501 TTAGTGCTGTCGGCCAGGCGCGG + Intronic
1148410398 17:47461741-47461763 ATACCATTGACGGCCAGGTGCGG + Intergenic
1149208535 17:54277316-54277338 AAAGTTTTGCAGGCCAGGTGCGG - Intergenic
1149510026 17:57232920-57232942 AAATTATTGTGGGCTAGGTGTGG + Intergenic
1149587030 17:57797445-57797467 ATAGAATTTTGGGCCAGGAGTGG + Intergenic
1149786072 17:59436170-59436192 ATAGAATGGTGGGCCAGGCGCGG - Intergenic
1149839592 17:59947786-59947808 ATACTGTGGTCGGCAAGGTGAGG + Exonic
1149923835 17:60682810-60682832 ATACTATTTTAGGCCAGGCGTGG - Intronic
1150011586 17:61509634-61509656 ATGGTATCATAGGCCAGGTGTGG - Intergenic
1150129721 17:62661955-62661977 AGATTATTCTAGGCCAGGTGCGG + Intronic
1150158236 17:62871916-62871938 AAAGTATGGCAGGCCAGGTGCGG + Intergenic
1150235270 17:63587828-63587850 AAAGTAATATAGGCCAGGTGCGG + Intronic
1150334068 17:64317610-64317632 ATTGTATTTGCGGCCAGGCGTGG + Intergenic
1150396014 17:64822522-64822544 ATAGTGTTTTAGGCCAGATGTGG + Intergenic
1150426443 17:65080916-65080938 ATAGTTTTATTGGCCGGGTGCGG - Intergenic
1150549347 17:66194720-66194742 ATTCTCTTGTCGGCCAGGCGTGG + Intergenic
1150985996 17:70197684-70197706 TGAGTTTTGTCGGCTAGGTGGGG + Intergenic
1151525233 17:74661084-74661106 ATATTTTTGTTGCCCAGGTGTGG - Intergenic
1151722712 17:75866839-75866861 ATTGTCTTGTTGGCCATGTGCGG + Intergenic
1151888669 17:76939207-76939229 ATAATAATTTTGGCCAGGTGCGG + Intronic
1152370494 17:79885339-79885361 ATTGTATTCTAGGCCAGGCGCGG - Intergenic
1153576303 18:6525085-6525107 AAATGATTGTTGGCCAGGTGTGG + Intronic
1154117943 18:11627703-11627725 ATATTATTTCAGGCCAGGTGTGG - Intergenic
1154204038 18:12322008-12322030 ATTGAGTTGTTGGCCAGGTGCGG + Intronic
1154241242 18:12656187-12656209 ACAGCAATGTCTGCCAGGTGCGG - Intronic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1157063135 18:44316432-44316454 ATGGTATTGTTGGCCAGGAGCGG - Intergenic
1157093299 18:44661662-44661684 AAAGCATTTTTGGCCAGGTGTGG - Intergenic
1157987432 18:52454613-52454635 AAAGTATTTTCGACAAGGTGAGG - Intronic
1158483139 18:57840299-57840321 ATAACTTTTTCGGCCAGGTGCGG + Intergenic
1158977801 18:62727994-62728016 ATAATTTTTTAGGCCAGGTGCGG + Intronic
1159222431 18:65482110-65482132 ATACAGTTTTCGGCCAGGTGCGG + Intergenic
1159510370 18:69390716-69390738 ATGTTATTGTAGGCCGGGTGTGG - Intergenic
1159641498 18:70867926-70867948 ATAATATTGTCGGCAAAGAGAGG + Intergenic
1161784575 19:6315803-6315825 ATAGTATTCCAGGCCAGGTGTGG - Intronic
1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG + Intergenic
1161892274 19:7049003-7049025 ATGGAATTGTCGGCCGGGTGCGG - Intergenic
1161968906 19:7564898-7564920 AACGTATTGTCGGCTGGGTGAGG - Intergenic
1162244361 19:9387171-9387193 ATAGAATTGCAGGCCAGGCGTGG + Intergenic
1162354345 19:10172123-10172145 AAAGTATTTTAGGCCGGGTGTGG + Intronic
1162463528 19:10827579-10827601 AAAGTTGTGACGGCCAGGTGTGG + Intronic
1162648837 19:12069662-12069684 TTTGTATTTTAGGCCAGGTGCGG + Intronic
1162711918 19:12601700-12601722 ATAATATTCTAGGCCAGGTGCGG + Intronic
1163386548 19:17003489-17003511 AAAGTATTGTAGGCCAGGCATGG - Intronic
1163535713 19:17875077-17875099 ATAGTAATGGCGGCCGGGCGCGG + Intronic
1163855112 19:19695505-19695527 AAAGAATAGCCGGCCAGGTGCGG - Intergenic
1164184184 19:22847808-22847830 AAATTATTTTCGGCCAGGCGTGG + Intergenic
1164211084 19:23097846-23097868 GAGGTATTGTGGGCCAGGTGTGG + Intronic
1165201767 19:34150566-34150588 TTAGAATTCTAGGCCAGGTGCGG - Intergenic
1165594658 19:37002474-37002496 AAAGTAAAGTCGGCCGGGTGCGG + Intergenic
1165668252 19:37652825-37652847 AGAAAATTGTGGGCCAGGTGCGG + Intronic
1166548861 19:43651724-43651746 AAATTATTTTTGGCCAGGTGTGG - Intronic
1166603615 19:44119926-44119948 ATACTATTCTAGGCCAGGCGCGG + Intronic
1166861098 19:45811724-45811746 ATACAAATGTTGGCCAGGTGCGG - Intronic
1167154973 19:47732791-47732813 ATAAGATTGTGGACCAGGTGTGG + Intronic
1167408625 19:49331470-49331492 ACATTATTATGGGCCAGGTGAGG - Intergenic
1167511668 19:49898346-49898368 ATAGTAATGAGGGCCGGGTGCGG + Intronic
1168032013 19:53687853-53687875 ATACAAATGTAGGCCAGGTGTGG - Intergenic
1168083452 19:54027547-54027569 ATAGTTCTGGAGGCCAGGTGTGG + Intergenic
1168383411 19:55943190-55943212 ACTGTGCTGTCGGCCAGGTGCGG + Intergenic
925320441 2:2962370-2962392 ATATAATTGTAGGCCAGGCGTGG + Intergenic
925415759 2:3669181-3669203 ACAGTAATTCCGGCCAGGTGTGG + Intronic
926193661 2:10746976-10746998 AAAGAATTCTCAGCCAGGTGCGG + Intronic
926570787 2:14527678-14527700 AATGTATTGTGGGCCAGGTGTGG - Intergenic
926736156 2:16074637-16074659 ATAATATTGACGGCCGGGCGCGG + Intergenic
927379825 2:22466517-22466539 AAAATACTGTTGGCCAGGTGCGG - Intergenic
927421520 2:22937288-22937310 TTATTACTTTCGGCCAGGTGTGG - Intergenic
927660723 2:24990809-24990831 ATGGTTTTGTGGGCCAGGTCTGG + Intergenic
927780735 2:25937758-25937780 AAATTATTATTGGCCAGGTGTGG + Intronic
928056537 2:28061966-28061988 CCAGGATTGTTGGCCAGGTGCGG + Intronic
928497371 2:31847691-31847713 ATTGTTTTGACAGCCAGGTGTGG + Intergenic
928554156 2:32405514-32405536 ATAACATCGTAGGCCAGGTGCGG + Intronic
928563862 2:32521768-32521790 GTAATATTGTCGGCCTGATGTGG - Intronic
928843005 2:35633619-35633641 ATATTAGTGTCGGCCGGGCGTGG + Intergenic
929863133 2:45696244-45696266 AAAGTTATTTCGGCCAGGTGTGG - Intronic
930777156 2:55184393-55184415 ACAGGAATGTTGGCCAGGTGTGG - Intronic
930815238 2:55590035-55590057 ATAAATTTGTGGGCCAGGTGTGG + Intronic
931342848 2:61418368-61418390 ATAGTATGGTAGGCCAAGCGTGG - Intronic
931548637 2:63416810-63416832 AAAGTATTTTGGGCCAGGTGTGG - Intronic
931678762 2:64725166-64725188 AGATTATTGCCGGCCGGGTGCGG + Intronic
932209146 2:69913662-69913684 AGAGTATTCTTGGCCGGGTGCGG + Intronic
932313331 2:70761957-70761979 ATAGTTGTGTTGGCCAGGCGCGG - Intronic
932663229 2:73675165-73675187 AGAATATTTTAGGCCAGGTGCGG + Intergenic
932787948 2:74623959-74623981 AGTATATTGTAGGCCAGGTGTGG - Intronic
933600152 2:84320701-84320723 TTAATATTTTAGGCCAGGTGTGG + Intergenic
935294997 2:101641194-101641216 ACTTTATTGTGGGCCAGGTGTGG + Intergenic
935300649 2:101691252-101691274 ATACTATTCTGGGCCAGGCGCGG + Intergenic
935465036 2:103386632-103386654 ATAGCATTTTTAGCCAGGTGCGG + Intergenic
935890818 2:107675942-107675964 AAAGTAATGCAGGCCAGGTGTGG + Intergenic
935953933 2:108355674-108355696 AAAACATTGTTGGCCAGGTGCGG - Intergenic
935977968 2:108597980-108598002 ATAGCATTTCTGGCCAGGTGTGG - Intronic
936135584 2:109890574-109890596 ATAGCATTTCTGGCCAGGTGTGG - Intergenic
936209113 2:110480911-110480933 ATAGCATTTCTGGCCAGGTGTGG + Intergenic
936367454 2:111871458-111871480 ATTGAATTTTTGGCCAGGTGCGG + Intronic
936395375 2:112123899-112123921 ATACTAAAGTAGGCCAGGTGCGG + Intergenic
936395428 2:112124547-112124569 AAGGTATTATTGGCCAGGTGCGG + Intergenic
937479937 2:122247398-122247420 ATAATAATTTCAGCCAGGTGTGG + Intergenic
937702414 2:124878971-124878993 AAAGTATTATTGGCCAGGTGTGG - Intronic
937768405 2:125689129-125689151 TTGGTATTGTAGGCCAGGCGTGG + Intergenic
937937241 2:127256109-127256131 AAAGTAATGGTGGCCAGGTGTGG + Intergenic
938153760 2:128909988-128910010 ATTGTTTTGTCAGCCGGGTGCGG + Intergenic
939335367 2:140820268-140820290 AAATTAATGTAGGCCAGGTGTGG - Intronic
939824277 2:146996040-146996062 AAAGAGTTGTTGGCCAGGTGCGG + Intergenic
940154315 2:150637788-150637810 AGATTATTCTGGGCCAGGTGTGG - Intergenic
940797520 2:158096306-158096328 ATAAAATAGTGGGCCAGGTGTGG + Intronic
940816836 2:158306230-158306252 ATAGTGATTTTGGCCAGGTGCGG + Intronic
940939632 2:159543822-159543844 AAAGAATTGTTGGCCAGGCGCGG - Intronic
941096305 2:161242600-161242622 TTAAAGTTGTCGGCCAGGTGAGG + Intergenic
941101478 2:161300754-161300776 ATAATATACTGGGCCAGGTGCGG + Intergenic
941544283 2:166828122-166828144 AAAATAAAGTCGGCCAGGTGCGG + Intergenic
941711633 2:168720218-168720240 ATAGTATTTTGGGCCAGGCACGG - Intronic
941800133 2:169650806-169650828 AAAATATTTTAGGCCAGGTGTGG + Intronic
942295174 2:174509770-174509792 ATTGTGATGTTGGCCAGGTGTGG - Intergenic
942480791 2:176386204-176386226 ATAGTAATGTTGGCCAGATATGG + Intergenic
942608131 2:177713297-177713319 ATAAAATTGTCAGCCAGGCGTGG - Intronic
942884048 2:180900422-180900444 GTAGCATTCTGGGCCAGGTGCGG - Intergenic
943702011 2:190996846-190996868 ATATTAGTGTGGTCCAGGTGAGG - Intronic
944121236 2:196242981-196243003 GAAGTTTTGTAGGCCAGGTGCGG - Intronic
944409858 2:199429617-199429639 ATAAAATTGTCGGCCAGGCACGG + Intronic
944599308 2:201286907-201286929 ATAGTACCATCGGCCAGGCGCGG - Exonic
944795120 2:203176432-203176454 ACAGTAAAGTAGGCCAGGTGTGG + Intronic
944832517 2:203547066-203547088 ATAGTATACTTGGCCAGGTGTGG - Intergenic
945050452 2:205819118-205819140 AAAATATCTTCGGCCAGGTGCGG - Intergenic
945148534 2:206764006-206764028 ATATTCTTCTGGGCCAGGTGTGG + Intronic
945243075 2:207694274-207694296 AAAGTACTTACGGCCAGGTGGGG + Intergenic
945590191 2:211719563-211719585 AAAGTGTTTTTGGCCAGGTGCGG + Intronic
945892600 2:215445490-215445512 AATTTATTGTCTGCCAGGTGTGG - Intergenic
946237974 2:218336769-218336791 AAAGAATTGAAGGCCAGGTGTGG - Intronic
946250575 2:218409007-218409029 AAAATATTTTTGGCCAGGTGCGG - Intergenic
946277296 2:218641227-218641249 AAAAAATTATCGGCCAGGTGAGG - Intronic
946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG + Intergenic
946733192 2:222728873-222728895 ATAGTATTTAGGCCCAGGTGTGG - Intergenic
947222478 2:227806782-227806804 ATCATGTTCTCGGCCAGGTGTGG + Intergenic
947809121 2:232989155-232989177 AAAGCTATGTCGGCCAGGTGCGG + Intronic
948165226 2:235856200-235856222 AAAATATTCTCGGCCGGGTGCGG - Intronic
948795531 2:240400419-240400441 AGAGGATTGGGGGCCAGGTGGGG + Intergenic
1169157407 20:3343435-3343457 ACACTGTTGTCAGCCAGGTGCGG - Intronic
1169280603 20:4263775-4263797 AAAGCAATGTTGGCCAGGTGTGG - Intergenic
1169603945 20:7293991-7294013 AATGTATTGTCGGCCGGGCGCGG - Intergenic
1170979136 20:21194697-21194719 AAAATACTGTCAGCCAGGTGTGG + Intronic
1172078432 20:32317929-32317951 ACAGTATTGTGGGCTGGGTGTGG - Intronic
1172269809 20:33648336-33648358 ACATTATGGTCGGCCAAGTGAGG + Exonic
1172769784 20:37374863-37374885 GTATTATTATTGGCCAGGTGTGG - Intronic
1172855870 20:38002005-38002027 ATACAACTGTCGGCCAGGCGCGG - Intronic
1172905792 20:38368307-38368329 AAAGCATTGCTGGCCAGGTGCGG + Intronic
1174579295 20:51559799-51559821 ATAGTATTGTCTGACAGTTGAGG - Intronic
1174628510 20:51935851-51935873 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1174695350 20:52551373-52551395 AAAGTATTCTAGGCCAGGCGTGG - Intergenic
1175187955 20:57191405-57191427 AAAGAAATGTAGGCCAGGTGTGG + Intronic
1175438723 20:58974890-58974912 ATAGAAACCTCGGCCAGGTGCGG + Intergenic
1175869139 20:62199353-62199375 GTAGCATTGTTGGCCAGGCGTGG + Intronic
1177376932 21:20282254-20282276 TTTGTATTATTGGCCAGGTGCGG - Intergenic
1177537316 21:22444752-22444774 TTATTATTGTTGGCCAGATGTGG - Intergenic
1177830710 21:26135841-26135863 ATAGTTTTGTCAGCCAGGCACGG + Intronic
1177958792 21:27635618-27635640 ATATTATTGTTGGCCAGGCGCGG - Intergenic
1178211431 21:30537953-30537975 ATTGTGTTCTTGGCCAGGTGTGG + Intergenic
1178866705 21:36334075-36334097 ATATTTTTGTAGGCCGGGTGCGG - Intronic
1179218113 21:39384548-39384570 AAAAAATTGTCGGCCAGGTGTGG - Intronic
1179341190 21:40511699-40511721 AAAGTATTCTCGGCCGGGCGCGG + Intronic
1179717047 21:43293909-43293931 ATAATAATATAGGCCAGGTGCGG - Intergenic
1179877374 21:44276520-44276542 CTAGGATTCTGGGCCAGGTGTGG - Intergenic
1179930236 21:44565919-44565941 ATGGTATTTCAGGCCAGGTGTGG + Intronic
1180900204 22:19366070-19366092 AAAATTTTGTGGGCCAGGTGTGG + Intronic
1180939589 22:19649694-19649716 ATAGAAGAGTTGGCCAGGTGTGG + Intergenic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181300745 22:21879300-21879322 AAAATTTTGTGGGCCAGGTGTGG - Intergenic
1181732953 22:24860610-24860632 ATATTATTCTGGGCCGGGTGTGG + Intronic
1182191811 22:28468825-28468847 ATAGCATTATGGGCCAGGCGCGG - Intronic
1182229733 22:28828551-28828573 ATTGTAAAGTCGGCCAGGCGCGG - Intergenic
1182374941 22:29839733-29839755 ATATGTTTGTTGGCCAGGTGTGG - Intergenic
1182385089 22:29931701-29931723 ATAGCTTTGGCAGCCAGGTGTGG - Intronic
1182484353 22:30630389-30630411 TTACTATTGTGGGCCAAGTGTGG + Intergenic
1182599110 22:31445997-31446019 ATAAAATTCTGGGCCAGGTGCGG + Intronic
1182610248 22:31541464-31541486 TTAGAATTGTAGGCCAGGCGTGG + Intronic
1182720182 22:32391679-32391701 TTATTATTGTCGGCCGGGCGTGG - Intronic
1182794247 22:32978886-32978908 ATTGTTCTGTAGGCCAGGTGTGG + Intronic
1182926912 22:34133807-34133829 AAAGATTTGTGGGCCAGGTGTGG + Intergenic
1183207445 22:36429230-36429252 ATAAATTTGTAGGCCAGGTGCGG + Intergenic
1183219821 22:36505476-36505498 ATAGAATTGAAGGCCGGGTGCGG + Intronic
1183568496 22:38633926-38633948 ATTGAATTATTGGCCAGGTGTGG + Intronic
1183595808 22:38810170-38810192 ACATTATTTCCGGCCAGGTGTGG + Intergenic
1183926399 22:41209395-41209417 ATAACAATGTGGGCCAGGTGCGG - Intronic
1184006742 22:41715682-41715704 AAATTATTGTTGGCCAGGCGTGG - Intronic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
1184496385 22:44844751-44844773 AAAGAAATGTTGGCCAGGTGCGG - Intronic
1184542428 22:45135709-45135731 TGAATATTGTTGGCCAGGTGTGG - Intergenic
1184958023 22:47905442-47905464 AAAGTATTTTAGGCTAGGTGTGG - Intergenic
1185401954 22:50623606-50623628 CAAATATTGTTGGCCAGGTGTGG + Intronic
949534934 3:4988431-4988453 AAAGTATTGTGGGCCAGGCACGG + Intergenic
949900768 3:8813080-8813102 ATGTTATTGTTGGCCTGGTGAGG + Intronic
950082514 3:10233340-10233362 CATGTATTGTAGGCCAGGTGCGG - Intronic
950396870 3:12740409-12740431 AAAGCATTCTGGGCCAGGTGTGG + Intronic
950696993 3:14708932-14708954 TTAATATTGTTGGCCGGGTGTGG - Intronic
950840227 3:15961246-15961268 ATTGAATTGTCGGCCAGGCACGG - Intergenic
951483056 3:23182207-23182229 AGAGTATTCTGGGCCAGGTGCGG - Intergenic
952459442 3:33508617-33508639 AAATTATTTTTGGCCAGGTGTGG - Intronic
953874987 3:46661512-46661534 ATAATGTTCTGGGCCAGGTGTGG + Intergenic
954047277 3:47943319-47943341 ATAATATTTTAGGCCAGATGCGG + Intronic
954515405 3:51171424-51171446 TTTGTTTTGTGGGCCAGGTGCGG + Intronic
954569529 3:51629004-51629026 ATAGTGTTGTTGGCCAGGTGTGG - Intronic
954655097 3:52189760-52189782 ATACTAGTCTAGGCCAGGTGCGG - Intergenic
954975994 3:54695306-54695328 AAAATATTTTCAGCCAGGTGTGG - Intronic
955305825 3:57830296-57830318 TTACTATTTTAGGCCAGGTGTGG - Intronic
955312356 3:57901739-57901761 AGAGTTATGTCGGCCAGGCGTGG + Intronic
955791883 3:62596486-62596508 ATAGCACTCTGGGCCAGGTGTGG - Intronic
955969312 3:64421373-64421395 ATAGTTATGTTGGCCAGGTGTGG + Intronic
956801061 3:72758855-72758877 ATAGTAGCCTTGGCCAGGTGCGG - Intronic
958100679 3:89005557-89005579 ATAGCATGGTCGGCGAGGGGTGG - Intergenic
958784492 3:98582779-98582801 AAAGTATTGTGGGCCGGGCGTGG - Intronic
958972969 3:100633817-100633839 ATAAGAGTGGCGGCCAGGTGTGG - Intronic
959205803 3:103304675-103304697 AAAGTGTTATTGGCCAGGTGCGG - Intergenic
959569422 3:107867222-107867244 ATAGTATTGGGGCCCAGGTGGGG - Intergenic
959669129 3:108955020-108955042 AGAGAACTGTAGGCCAGGTGTGG - Intergenic
959832794 3:110884459-110884481 ATAATAGTGACGGCCAGCTGCGG + Intergenic
960021785 3:112963882-112963904 ATGGTTTTGTGGGCCAGGTCAGG + Intronic
960026311 3:113014641-113014663 ATCATGTTGTCGGCCAGGCGCGG - Intronic
960346905 3:116544452-116544474 ATAATGAGGTCGGCCAGGTGCGG + Intronic
960377182 3:116917701-116917723 AAAGAAAAGTCGGCCAGGTGTGG + Intronic
960620359 3:119631109-119631131 ATCATATTGTCGGCCGGGCGCGG + Intergenic
961190455 3:124956780-124956802 ATAGTACTGGAGGCCAGGCGCGG - Intergenic
962365699 3:134778385-134778407 AGAGTGATGTGGGCCAGGTGTGG - Intronic
962523682 3:136219567-136219589 ACAGTAATGTGGGTCAGGTGTGG + Intergenic
962936675 3:140087865-140087887 ATAGTAGTGTCTGGAAGGTGTGG + Intronic
963162604 3:142167081-142167103 GTATTAATGTAGGCCAGGTGTGG + Intronic
963186823 3:142428100-142428122 AAATTATTCTTGGCCAGGTGCGG + Intronic
963766823 3:149345573-149345595 ATCTTGTTGTTGGCCAGGTGTGG + Intergenic
963943174 3:151115765-151115787 ATAGTATAATGGGCCAGGTGGGG + Intronic
964120015 3:153173700-153173722 ATAGTGTTGTAGGCCGGGCGTGG - Intergenic
964240493 3:154587083-154587105 AAAGAACTCTCGGCCAGGTGTGG - Intergenic
964358061 3:155868634-155868656 ACAGACTTGTTGGCCAGGTGCGG - Intergenic
964592443 3:158379488-158379510 ATGGTATTTCTGGCCAGGTGTGG - Intronic
965031868 3:163380709-163380731 ATAGGAATGTTGGCCGGGTGTGG + Intergenic
965568834 3:170150920-170150942 ATAATATTTTTGGCCGGGTGAGG + Intronic
966193476 3:177291725-177291747 AATGTCATGTCGGCCAGGTGTGG - Intergenic
966550110 3:181195284-181195306 AAAGAATTTACGGCCAGGTGCGG - Intergenic
966713862 3:182996292-182996314 AAAGAATTGAGGGCCAGGTGCGG - Intergenic
967349127 3:188492402-188492424 AAAGTAATGTCAGCCGGGTGTGG + Intronic
968147203 3:196309553-196309575 ATTGTTTTGTGGACCAGGTGTGG - Intronic
968149784 3:196328009-196328031 GTAATATTGTCGGCCAGGCATGG + Intronic
968409801 4:380361-380383 ATTTTATTTTCGGCCAGGCGTGG + Intronic
968843350 4:3024568-3024590 AAAAAATTGTAGGCCAGGTGTGG + Intronic
969043437 4:4319181-4319203 AAAATACTGTAGGCCAGGTGAGG - Intronic
969421406 4:7099170-7099192 AAAAAATTGTTGGCCAGGTGCGG + Intergenic
969476766 4:7426434-7426456 AAAGTGTTGTAGGCCAGGTGTGG + Intronic
970975570 4:22039455-22039477 AAAGAATTTTCGGCCAGGTGTGG - Intergenic
971663183 4:29446951-29446973 ATTCTATTGTCATCCAGGTGTGG - Intergenic
971778487 4:30999133-30999155 TTAGTATTCACGGCCAGGTAGGG - Intronic
972516001 4:39811185-39811207 ATAGGGGTCTCGGCCAGGTGTGG + Intergenic
972550658 4:40130179-40130201 ATTTTATTTTTGGCCAGGTGTGG - Intronic
973135702 4:46703644-46703666 ATAATACTATAGGCCAGGTGTGG - Intergenic
973259097 4:48142970-48142992 AAAATATTATCGGCCAGGTGTGG - Intronic
973323672 4:48835541-48835563 ATAGTACTGTAGGCCAGGTATGG + Intronic
973752034 4:54030821-54030843 TTAGCATTTTAGGCCAGGTGCGG - Intronic
974052885 4:56957650-56957672 ATAGTAATCTTGGCCTGGTGTGG + Intergenic
974483803 4:62480082-62480104 ATAGTTTTGTAGGTCAGCTGAGG + Intergenic
974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG + Intronic
975119867 4:70716551-70716573 ACAGCATTGAAGGCCAGGTGCGG + Intronic
975338667 4:73211554-73211576 ATCTAATTGTCGGCCAGGTGTGG + Intronic
975461556 4:74659419-74659441 AAAGGATTGTAGGCCGGGTGTGG + Intergenic
975643734 4:76526075-76526097 AAATAAATGTCGGCCAGGTGCGG + Intronic
975651534 4:76598314-76598336 ATAGATTTTTTGGCCAGGTGTGG - Intronic
976021537 4:80634270-80634292 AGAGTTTTCTCGGCCATGTGCGG - Intronic
976296805 4:83480838-83480860 ATAGTATTGTAGGCCAGGCATGG + Intronic
976708838 4:88047264-88047286 AAAAACTTGTCGGCCAGGTGTGG + Intronic
977566341 4:98584229-98584251 AGAGTATTTCAGGCCAGGTGTGG - Intronic
978009966 4:103668555-103668577 ACAGTTGTTTCGGCCAGGTGTGG + Intronic
978148046 4:105400353-105400375 ATAATTTTCTAGGCCAGGTGTGG + Intronic
978786494 4:112615512-112615534 TTAGTTTTGAAGGCCAGGTGTGG - Intronic
979270966 4:118761005-118761027 ATAGAATTACCGGCCAGGTGCGG - Intronic
979870161 4:125809247-125809269 AAAGTAATCCCGGCCAGGTGCGG - Intergenic
980077234 4:128306662-128306684 AGAGTATAATGGGCCAGGTGTGG - Intergenic
981315143 4:143334550-143334572 ATGGTAGTGTTGGCCAGGTGCGG - Intergenic
981475779 4:145185252-145185274 AAAGAATTATGGGCCAGGTGTGG - Intergenic
981716007 4:147752815-147752837 ATAGTAAAGCAGGCCAGGTGCGG - Intronic
982097010 4:151932376-151932398 AAGGTATTATTGGCCAGGTGCGG - Intergenic
982156647 4:152529674-152529696 ATAGCAATGCTGGCCAGGTGTGG + Intronic
982896819 4:160941068-160941090 AAAGAATTGTTGGCCAGTTGCGG + Intergenic
983232548 4:165143724-165143746 ACAGTATTGGTGGCCGGGTGTGG - Intronic
983335478 4:166386115-166386137 AAAGTTTTATAGGCCAGGTGTGG - Intergenic
983378419 4:166959322-166959344 ATTGAATTCTCGGCCAGGCGTGG + Intronic
983577938 4:169278345-169278367 AAAGTTATGTTGGCCAGGTGCGG - Intergenic
983579054 4:169289416-169289438 AAAATATTCTAGGCCAGGTGCGG - Intergenic
984117498 4:175700151-175700173 ATAGAGTTGTGGGCCGGGTGTGG - Intronic
984375910 4:178928579-178928601 ATAAGATTATAGGCCAGGTGTGG - Intergenic
984392711 4:179157318-179157340 ATATTATTGTTGGCCGGGTACGG - Intergenic
984464344 4:180078594-180078616 AAAGTATTCCTGGCCAGGTGCGG + Intergenic
984604731 4:181772087-181772109 ATAATAATTTTGGCCAGGTGTGG + Intergenic
984874679 4:184356660-184356682 AGCGTTTTGTGGGCCAGGTGTGG + Intergenic
985294838 4:188425729-188425751 ATTGTATTCTGGGCCAGGTGCGG + Intergenic
987185986 5:15419540-15419562 AGATTATGGTGGGCCAGGTGTGG - Intergenic
987605634 5:20132177-20132199 ACTTTATTGTTGGCCAGGTGTGG - Intronic
988504863 5:31813158-31813180 TAAGTATTCACGGCCAGGTGCGG + Intronic
989161162 5:38393026-38393048 AAGGCATTGTGGGCCAGGTGCGG - Intronic
989387681 5:40869435-40869457 ATAGAATGGTAGGCCAGGTGTGG - Intergenic
989499948 5:42154200-42154222 AAAATACTGTTGGCCAGGTGTGG + Intergenic
989571049 5:42946502-42946524 TTACCATTGTGGGCCAGGTGGGG + Intergenic
989581302 5:43035912-43035934 TTACCATTGTGGGCCAGGTGGGG + Intergenic
990707315 5:58543779-58543801 AGGGCATTATCGGCCAGGTGTGG + Intronic
991914451 5:71592088-71592110 ATAGGATCCTTGGCCAGGTGCGG + Intronic
992335057 5:75758762-75758784 ATTGTATTCTTGGCCAGGCGCGG + Intergenic
992632162 5:78692107-78692129 ATAGTACATTAGGCCAGGTGTGG + Intronic
992731250 5:79671810-79671832 TTACTATTTTCGGCCGGGTGTGG + Intronic
993005374 5:82423530-82423552 AAAGTGTTCTCGGCCAGGTGCGG - Intergenic
993516914 5:88848860-88848882 ATATTATTGTGAGCCAGGCGTGG + Intronic
993719570 5:91309075-91309097 AAGATATTGTCGGCCAGGGGCGG - Intergenic
993827508 5:92709679-92709701 GTAGTATTTTAGGCCAGTTGTGG - Intergenic
993988648 5:94628119-94628141 AAAGTATTGTTGGCCAGGAGCGG - Intronic
994753575 5:103767659-103767681 ATAGATTAGTAGGCCAGGTGTGG - Intergenic
995660464 5:114476709-114476731 ATGGATCTGTCGGCCAGGTGCGG - Intronic
996087404 5:119319116-119319138 AAAGTATTCTTGGCCAGGTGTGG + Intronic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
997114306 5:131109517-131109539 ATAACATTTACGGCCAGGTGTGG - Intergenic
997138834 5:131356627-131356649 ATTGTACTTTAGGCCAGGTGCGG + Intronic
997313524 5:132912060-132912082 ATAGTAAAATGGGCCAGGTGCGG + Intronic
997315089 5:132926490-132926512 ATGGTATTGTAGGCCAGAGGTGG - Intronic
997859620 5:137404705-137404727 ATGTTATTTTAGGCCAGGTGCGG - Intronic
997987384 5:138513492-138513514 ACAGTATGGTGGGCCGGGTGCGG - Intronic
998066287 5:139161724-139161746 TTAGAATTGCTGGCCAGGTGCGG + Intronic
998313037 5:141154116-141154138 ATAAAATAGTCAGCCAGGTGTGG - Intergenic
998646166 5:144064599-144064621 ATCTTCTGGTCGGCCAGGTGTGG - Intergenic
999258942 5:150226034-150226056 ATTGAATTCTCGGCCGGGTGCGG - Intronic
999294757 5:150452106-150452128 GTACTATTATCGGCCAGGCGCGG - Intergenic
999395615 5:151225122-151225144 TTAGTATTATTGGCCAGGTGTGG - Intronic
1000140510 5:158398810-158398832 TTAAAATTGTCAGCCAGGTGTGG + Intergenic
1000182868 5:158829473-158829495 ATAGTTTTGTGGGCCGGGTGTGG - Intronic
1000329674 5:160196861-160196883 ATAGAATTGGAGGCCAGGCGCGG - Intronic
1000350818 5:160351038-160351060 TTAGCACTGTGGGCCAGGTGTGG - Intronic
1000690002 5:164306099-164306121 ATGTTATTGTGGGCCAGGTGTGG + Intergenic
1001053295 5:168429547-168429569 AAAATATTGAAGGCCAGGTGTGG - Intronic
1001533414 5:172480936-172480958 AAAGTATATTAGGCCAGGTGTGG - Intergenic
1002147228 5:177194065-177194087 ATATTAATATCAGCCAGGTGTGG - Intronic
1002149289 5:177214039-177214061 ACGGTATTTACGGCCAGGTGCGG + Intronic
1002396626 5:178961217-178961239 CTAAGATTGTGGGCCAGGTGTGG - Intronic
1002396645 5:178961523-178961545 ACAGCATTTTTGGCCAGGTGTGG + Intronic
1002511842 5:179725389-179725411 AAAAAATTGTTGGCCAGGTGCGG + Intronic
1002614732 5:180444154-180444176 AGAACACTGTCGGCCAGGTGTGG - Intergenic
1002756918 6:171064-171086 ATAATAATCTAGGCCAGGTGTGG + Intergenic
1003091837 6:3110496-3110518 AGAGTATAGTGGGCCAGGTGCGG - Intronic
1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG + Intronic
1003141324 6:3473885-3473907 ATAATAATGACGGCCAGGTGTGG - Intergenic
1003579570 6:7327431-7327453 ATAGTGTTGGGGGCCAGGTGTGG - Intronic
1003584752 6:7377450-7377472 AAGGTATTATTGGCCAGGTGTGG + Intronic
1003854173 6:10255164-10255186 TTAATATTGTCGGCCGGGTGCGG - Intergenic
1004153327 6:13142392-13142414 ATTGGATTCTCGGCCAGATGCGG - Intronic
1004476720 6:15980034-15980056 ATAGTAATGTCTTCCAGGAGTGG - Intergenic
1004649280 6:17593005-17593027 TTAGAAATGTGGGCCAGGTGTGG - Intergenic
1004666903 6:17756816-17756838 AACGTAGTGTCGGCCAGGCGTGG + Intergenic
1004691528 6:17996373-17996395 AAAGGATGGTCAGCCAGGTGTGG - Intergenic
1005439167 6:25846899-25846921 ATAATATTTCCGGCCAGGTGCGG - Intronic
1005804390 6:29460507-29460529 AAAGTATTATTGGCCGGGTGTGG - Intronic
1006078477 6:31549909-31549931 ATAGTGGTGGAGGCCAGGTGCGG + Intronic
1006079522 6:31557396-31557418 AAAATATTCTCGGCCAGGCGCGG - Intronic
1006330584 6:33387765-33387787 ATGGAATGGTAGGCCAGGTGCGG + Intergenic
1006717409 6:36129463-36129485 AATGTATTGTGGGCCAGGCGCGG + Intronic
1006755888 6:36415150-36415172 AAAGAATTGCCGGCCAGGCGCGG + Intronic
1007575016 6:42919751-42919773 ATAACATTCTGGGCCAGGTGCGG + Intronic
1007612636 6:43160406-43160428 GCAGTATTTTCGGCCAGGTGTGG - Intronic
1009372395 6:62922335-62922357 ATAGAAATGTAGGCCAGGTATGG - Intergenic
1009394486 6:63182550-63182572 TTAGCATTATAGGCCAGGTGCGG - Intergenic
1009418162 6:63438120-63438142 AAACTATTTTTGGCCAGGTGCGG + Intergenic
1009425517 6:63509353-63509375 ATAGTATTTTTGGCCAGGCGTGG - Intergenic
1009519944 6:64668855-64668877 ATGGTACTAGCGGCCAGGTGTGG - Intronic
1009953286 6:70421172-70421194 AAAGTAGTGTGGGCCAGGCGTGG - Intronic
1010423601 6:75701928-75701950 ATTAAACTGTCGGCCAGGTGCGG - Intronic
1010444851 6:75938520-75938542 ATACTATTCTGGGCCAGATGTGG + Intronic
1010826777 6:80485147-80485169 AGAGTGTTGTCGGCCGGGCGCGG + Intergenic
1011440233 6:87379815-87379837 ATATTGTGGTCGGCCGGGTGTGG + Intronic
1011585420 6:88919607-88919629 ATAAAATTGTGGGCCAGGTGTGG - Intronic
1011618595 6:89221008-89221030 ATAGTGTTTTTGGCCAGGCGCGG - Intronic
1011977059 6:93315150-93315172 ATTATATTGTCGGCCAGGCGCGG - Intronic
1012119171 6:95341761-95341783 ATAGTAACGGAGGCCAGGTGCGG - Intergenic
1013062421 6:106648005-106648027 AAAGTATTGTAGGCCGGGCGTGG + Intronic
1013322200 6:109004717-109004739 ATACGATTGTTGGTCAGGTGCGG - Intronic
1013572050 6:111438165-111438187 ATTGTATAATAGGCCAGGTGAGG - Intronic
1013743674 6:113319462-113319484 GAAGTATTATTGGCCAGGTGTGG + Intergenic
1014425655 6:121301918-121301940 ATTGTATTCCCGGCCAGGTGCGG - Intronic
1014474907 6:121860102-121860124 ATATTATTCAGGGCCAGGTGCGG - Intergenic
1014546273 6:122740119-122740141 ATAGTAAAATAGGCCAGGTGTGG - Intergenic
1015089157 6:129333180-129333202 ATAGTATTATAGGCCAGGTTTGG - Intronic
1015410870 6:132892525-132892547 AAAATCTTGTTGGCCAGGTGCGG + Intergenic
1015532172 6:134231747-134231769 ATAGTATGGAAGGCCAGGTGTGG + Intronic
1015604938 6:134944591-134944613 AAAATATTGTGGGCCAGGAGTGG + Intronic
1016129737 6:140452676-140452698 ATATAATTGTTGGTCAGGTGTGG + Intergenic
1016308691 6:142710705-142710727 AGAGTATGGTGGGCCAGGCGCGG + Intergenic
1017179102 6:151533342-151533364 ATGAAATAGTCGGCCAGGTGCGG - Intronic
1017207658 6:151820987-151821009 ATAGTATTGTCATCTAGGAGGGG + Intronic
1017476587 6:154800074-154800096 ATAGCAGTCACGGCCAGGTGCGG - Intronic
1017496095 6:154984822-154984844 ATTGTAGTTTAGGCCAGGTGTGG + Intronic
1018331974 6:162739551-162739573 AAATTTTTGTCGGCCAGGCGTGG + Intronic
1020047358 7:5050859-5050881 AAAGTATTCTAGGCCAGCTGTGG - Intronic
1020216213 7:6192821-6192843 ATTGACTTGTGGGCCAGGTGTGG - Intronic
1020238228 7:6373076-6373098 AATGTGTTGCCGGCCAGGTGTGG - Intergenic
1021500187 7:21324144-21324166 ATAGTAAGGTAGGCCAGGAGTGG - Intergenic
1021578502 7:22127327-22127349 AGACTTTTGCCGGCCAGGTGGGG - Intronic
1022168368 7:27796569-27796591 TTACTATTATCGGCCAGGTGCGG + Intronic
1022481515 7:30746479-30746501 AGAGTGTTGCCGGCCAGGCGCGG + Intronic
1023013342 7:35942452-35942474 TCAGTGTTGTTGGCCAGGTGCGG - Intergenic
1023074604 7:36470631-36470653 AAAGTAATGGCGGCCAGGCGTGG + Intergenic
1023190551 7:37576472-37576494 TAAATATTTTCGGCCAGGTGCGG + Intergenic
1023410884 7:39888071-39888093 ATATCTTTGTAGGCCAGGTGTGG - Intergenic
1023439898 7:40174411-40174433 ATAATATTCTTAGCCAGGTGTGG - Intronic
1023719955 7:43082874-43082896 GATGTATTGTAGGCCAGGTGTGG + Intergenic
1023739313 7:43264553-43264575 TTACTATTGTCAGCCAGGCGCGG + Intronic
1024077789 7:45831380-45831402 TCAGTGTTGTTGGCCAGGTGCGG + Intergenic
1025778766 7:64581073-64581095 ATATAACTGTCGGCCGGGTGCGG + Intergenic
1026222039 7:68407135-68407157 AGAGTATTATGAGCCAGGTGAGG + Intergenic
1026325247 7:69303569-69303591 AGTCTATTGTCAGCCAGGTGTGG - Intergenic
1026667776 7:72358658-72358680 ATAACATTGGCGGCCAGGCGCGG + Intronic
1027024924 7:74844299-74844321 AAAGAATTTTCGGCCAGGCGTGG - Intronic
1027062840 7:75099820-75099842 AAAGAATTTTCGGCCAGGCGTGG + Intronic
1027121208 7:75522849-75522871 AAAGTATTCTAGGCCAGCTGTGG + Intergenic
1027242330 7:76339796-76339818 ATAATATTTTCTGCCAAGTGCGG + Intronic
1027259255 7:76452620-76452642 ATAAGATTTTCGGCCAGGCGTGG - Intergenic
1027283220 7:76624256-76624278 ATAAGATTTTCGGCCAGGCGTGG + Intronic
1027386150 7:77661389-77661411 ATATTTTTGTCAGCCAGGCGTGG + Intergenic
1027893260 7:84005655-84005677 ATAGTAGTGCAGGCCAGGTATGG + Intronic
1028238051 7:88384463-88384485 AAAGTATTGTCACCCAGTTGGGG - Intergenic
1029140482 7:98406338-98406360 ATCTTACTGACGGCCAGGTGTGG - Intergenic
1029280349 7:99431416-99431438 CTATTATTTTTGGCCAGGTGCGG - Intronic
1029288097 7:99480033-99480055 ATAACAGTGTAGGCCAGGTGCGG + Intronic
1029331846 7:99863374-99863396 ATTGTATAGCCGGCCAGGTGTGG + Intronic
1029815969 7:103095382-103095404 TTGGTATTTTTGGCCAGGTGCGG - Intronic
1030185179 7:106754738-106754760 AAATCATTGTAGGCCAGGTGCGG + Intergenic
1030838114 7:114313453-114313475 AAAATATTGTCGGCCGGGCGCGG + Intronic
1031042070 7:116849248-116849270 ATAATTTTTTTGGCCAGGTGCGG + Intronic
1031595965 7:123649523-123649545 ATCCTATAGTAGGCCAGGTGTGG + Intergenic
1032009848 7:128337849-128337871 AAGTTATTGCCGGCCAGGTGCGG - Intronic
1032010631 7:128344897-128344919 ATAGTCTTCCCAGCCAGGTGTGG - Intergenic
1032071998 7:128813688-128813710 AAAGAATTCTAGGCCAGGTGCGG + Intronic
1032102085 7:128988786-128988808 ATAGTATGTTGGGCCAGGCGTGG + Intronic
1032123988 7:129177949-129177971 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1032580967 7:133103280-133103302 AAAGTATCCTAGGCCAGGTGTGG - Intergenic
1032762670 7:134958684-134958706 ACACTATTGGGGGCCAGGTGTGG - Intronic
1032918632 7:136520647-136520669 ATACTACTGTTGGCCGGGTGCGG + Intergenic
1033080023 7:138287380-138287402 ATAGTAATTTCTGCCAGGTGTGG - Intergenic
1033090626 7:138382529-138382551 ATAGTAATTTAGGCCAGGTGTGG + Intergenic
1033481783 7:141749490-141749512 AAATTATTCTGGGCCAGGTGCGG + Intronic
1034110869 7:148536567-148536589 AGTATATTGTAGGCCAGGTGTGG + Intergenic
1034170696 7:149060869-149060891 AAAGTGTTCTCAGCCAGGTGCGG + Intergenic
1034648177 7:152667114-152667136 AAAGTATTATAGGCCAGGTGCGG + Intronic
1035703535 8:1656031-1656053 AGAATATTGGAGGCCAGGTGTGG + Intronic
1035889434 8:3327421-3327443 ATAGTATTGTAGGCCGGACGAGG - Intronic
1035907647 8:3531149-3531171 AAAGTAGTATGGGCCAGGTGTGG - Intronic
1036579852 8:10063671-10063693 CTAGTCTTTTCGGCCATGTGAGG + Intronic
1037091624 8:14926927-14926949 ATCAAAGTGTCGGCCAGGTGTGG - Intronic
1037919454 8:22794573-22794595 ATTGTATGGTCAGCTAGGTGTGG - Intronic
1038026662 8:23596930-23596952 ATAGTATGGCATGCCAGGTGAGG + Intergenic
1038282705 8:26180409-26180431 ATAATCTTCTTGGCCAGGTGCGG - Intergenic
1038555543 8:28511059-28511081 ATAACATTGCCGGCAAGGTGCGG + Intronic
1038616795 8:29102950-29102972 ATGATTTTGTCGGCCAGGTGCGG + Intronic
1038632261 8:29257043-29257065 AAGGAATTGTAGGCCAGGTGTGG - Intronic
1038852662 8:31295303-31295325 AATATATTGTTGGCCAGGTGCGG - Intergenic
1039463665 8:37766751-37766773 ATAGTAAAGTAGGCCAGGCGCGG + Intronic
1040057901 8:43076585-43076607 ATATTAATATCGGCCAGGTACGG + Intronic
1041249715 8:55922378-55922400 ATTGTGATGTCAGCCAGGTGTGG - Intronic
1041496710 8:58493707-58493729 ATCATATTGTTGGCCGGGTGCGG + Intronic
1041675410 8:60533678-60533700 ATACTATTGTGGGCCAGGCATGG + Intronic
1042403303 8:68374203-68374225 AAAGAATTATAGGCCAGGTGTGG - Intronic
1042913357 8:73849219-73849241 AAAATATTGTAGGCCAGGAGCGG + Intronic
1043205289 8:77431197-77431219 ATAGTAATAACTGCCAGGTGTGG + Intergenic
1044374088 8:91448813-91448835 AAAATATAGTCGGCCAGGCGCGG - Intergenic
1045013788 8:97981395-97981417 AGAGTTTTGGAGGCCAGGTGTGG - Intronic
1045113464 8:98955485-98955507 AAAGTATTGGCGGCCGGGCGCGG + Intergenic
1045142105 8:99298196-99298218 ATACTTTTGTCGGCCGGGTGCGG + Intronic
1045362008 8:101441585-101441607 AAAGTGATGTCAGCCAGGTGTGG - Intergenic
1045847087 8:106649984-106650006 AAAATATTTTTGGCCAGGTGCGG - Intronic
1046001280 8:108423469-108423491 ATAATATTTAGGGCCAGGTGTGG - Intronic
1046013498 8:108577917-108577939 AGAATATTGTCGGCCGGGCGTGG - Intergenic
1046173099 8:110538353-110538375 AAAGCACTTTCGGCCAGGTGTGG + Intergenic
1046214126 8:111119682-111119704 AGATGATTGTCGGCCAGGCGCGG + Intergenic
1046296969 8:112232315-112232337 AAAGTATTGTAGTCTAGGTGAGG + Intronic
1046944485 8:119961948-119961970 AAAGTTTTATGGGCCAGGTGTGG + Intronic
1047158112 8:122344905-122344927 AGAGTAAAGTAGGCCAGGTGAGG - Intergenic
1047322781 8:123803591-123803613 ACAGTACTGTCAGCCTGGTGTGG - Intronic
1047396538 8:124505043-124505065 AAAGTATCCTCGGCCAGGCGCGG - Intronic
1047459534 8:125049266-125049288 ATAGTATAGCAGGCCAGATGCGG + Intronic
1047593247 8:126349646-126349668 AAAGAATAGTCGGCCAGGCGCGG + Intergenic
1048088878 8:131217308-131217330 ATAGAAGTGTCTGGCAGGTGGGG + Intergenic
1048168195 8:132082066-132082088 ACAGTAATGGGGGCCAGGTGTGG + Intronic
1048753112 8:137701906-137701928 TTAGTATTAGAGGCCAGGTGCGG - Intergenic
1048867670 8:138772703-138772725 ATAGTTTTATTAGCCAGGTGTGG + Intronic
1049068181 8:140335996-140336018 AAAATATTGTTGGCCAGGTGCGG - Intronic
1049818148 8:144618070-144618092 ATAGAATTTTAGGCCAGGCGTGG - Intergenic
1050183835 9:2950256-2950278 ATAATACTTTTGGCCAGGTGTGG + Intergenic
1051270400 9:15349723-15349745 AATGGATTCTCGGCCAGGTGTGG - Intergenic
1051821366 9:21173086-21173108 AAAGTATTCTAGGCCAGGCGCGG - Intergenic
1052303740 9:26982056-26982078 AGATTATTCTTGGCCAGGTGCGG - Intronic
1052307663 9:27029455-27029477 ACAATATAGTCGGCCGGGTGTGG + Intronic
1052702412 9:31952990-31953012 AAAGTATTCTAGACCAGGTGCGG - Intergenic
1053203017 9:36165523-36165545 AGGGTATTTTTGGCCAGGTGCGG + Intergenic
1053372066 9:37570702-37570724 ATATTATAAACGGCCAGGTGCGG + Intronic
1053597519 9:39577913-39577935 ATAGTAAAGGGGGCCAGGTGAGG + Intergenic
1053853450 9:42313664-42313686 ATAGTTTAGATGGCCAGGTGCGG + Intergenic
1053855534 9:42334884-42334906 ATAGTAAAGGGGGCCAGGTGAGG + Intergenic
1054862608 9:69969110-69969132 ATAATATTATAGGCCAGGTGCGG + Intergenic
1055619907 9:78114077-78114099 ATAGTATTATCTGCTGGGTGTGG + Intergenic
1056364296 9:85888061-85888083 AAAATATTATCAGCCAGGTGCGG + Intergenic
1056406251 9:86278372-86278394 ATATATTTGTAGGCCAGGTGTGG + Intronic
1056991262 9:91413539-91413561 ATAGTATTGTTGGCCGGGCGTGG - Intronic
1057074590 9:92130867-92130889 ACAATAATGACGGCCAGGTGTGG - Intergenic
1057084710 9:92198730-92198752 ATAATAATGACGGCCAGGTGTGG + Intergenic
1057814341 9:98283394-98283416 ATAGGGATGTCAGCCAGGTGCGG - Intergenic
1058389236 9:104475990-104476012 ATTGTATATTAGGCCAGGTGCGG + Intergenic
1058436135 9:104965159-104965181 CAAGTTTTGTCAGCCAGGTGTGG - Intergenic
1058457346 9:105149665-105149687 AGAGAATTACCGGCCAGGTGTGG - Intergenic
1058546037 9:106060807-106060829 ATAGGATATTTGGCCAGGTGTGG - Intergenic
1058846488 9:108965149-108965171 ACAGTGTAGTAGGCCAGGTGTGG - Intronic
1058860750 9:109115818-109115840 AGTGGATTGTAGGCCAGGTGCGG - Intronic
1058984268 9:110196990-110197012 ATGGTAGTGTCGGCCAGGAGAGG + Intronic
1059116661 9:111605982-111606004 ATATTATAGTAGGCTAGGTGCGG + Intergenic
1059117502 9:111612805-111612827 CAAGTAATGGCGGCCAGGTGCGG - Intergenic
1060855325 9:126910454-126910476 ATAGCTTTATTGGCCAGGTGTGG + Intergenic
1060970762 9:127736327-127736349 TAAGTATTTCCGGCCAGGTGCGG + Intergenic
1061099419 9:128481178-128481200 ACAGTTTTTTGGGCCAGGTGTGG + Intronic
1061101679 9:128497016-128497038 AGATTATTATCAGCCAGGTGTGG - Intronic
1185687661 X:1942762-1942784 ATACTATTTTAGGCCGGGTGTGG + Intergenic
1186183704 X:6998048-6998070 ATAGTCTTGTGGACCTGGTGAGG + Intergenic
1186493574 X:9993990-9994012 ACAGTGTTGTTGGCCAGGCGTGG - Intergenic
1187919100 X:24183475-24183497 ATAGCATTTTCGGCCAGGCGTGG - Intronic
1187953915 X:24497068-24497090 AGATTATTCTGGGCCAGGTGCGG - Intronic
1187973080 X:24677856-24677878 AAATTATTGTCGGCCAGGCGTGG + Intergenic
1188789330 X:34388746-34388768 ATTGCATTTTTGGCCAGGTGGGG + Intergenic
1188899715 X:35715006-35715028 ATAAAATTGTCAGCCAGGCGCGG + Intergenic
1189379578 X:40492481-40492503 ATAGCTTTGTTGGCCAGGCGTGG - Intergenic
1190832775 X:54074114-54074136 GTAGCAGTGTCAGCCAGGTGCGG - Intronic
1191048681 X:56167417-56167439 AAAGTAATGTGGGCCAGGCGTGG - Intergenic
1192154238 X:68731916-68731938 AAAATATTGGTGGCCAGGTGTGG + Intergenic
1192605000 X:72507137-72507159 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1193126962 X:77880237-77880259 TTAGTTTTGTAGGCCAGGCGCGG + Intronic
1193353968 X:80494986-80495008 AAAGTAGTACCGGCCAGGTGTGG - Intergenic
1193861463 X:86673043-86673065 AGAATATTTTAGGCCAGGTGTGG + Intronic
1194095552 X:89634451-89634473 ATATTATTCTTGGCCAGGTGTGG + Intergenic
1196158072 X:112452739-112452761 ATAGTAATCCTGGCCAGGTGCGG + Intergenic
1196213244 X:113019975-113019997 ATTGAATTGTCAGCCAGGTGTGG - Intergenic
1196263958 X:113619590-113619612 AAAGTACTATGGGCCAGGTGCGG - Intergenic
1196690115 X:118550146-118550168 ATTGTATTTTGGGCCAGGCGTGG + Intronic
1196722043 X:118863646-118863668 ATAGAAGTGTTAGCCAGGTGCGG + Intergenic
1196825414 X:119736658-119736680 ATAATAGTGAAGGCCAGGTGCGG + Intergenic
1197646901 X:129027691-129027713 ATATTATTATTGGCCAGGCGTGG + Intergenic
1197740832 X:129892311-129892333 ATAGAATTCTGGGCCAGGTGTGG - Intergenic
1197973829 X:132143846-132143868 GTAGAATTGTCAGCCAGATGTGG - Intergenic
1198170931 X:134104556-134104578 AAACTATTCTTGGCCAGGTGTGG + Intergenic
1199101008 X:143799886-143799908 AAAGTTTTATCGGCCAGGCGTGG - Intergenic
1199362680 X:146941733-146941755 ATTGTATTCTTTGCCAGGTGAGG + Intergenic
1199883774 X:151998517-151998539 ATGGTAGTATCGGCCAGGTGCGG - Intergenic
1200171856 X:154082540-154082562 AAAGCATTTTCGGCCGGGTGTGG - Intronic
1200448187 Y:3290633-3290655 ATATTATTCTTGGCCAGGTGTGG + Intergenic
1200862271 Y:8005531-8005553 AAAATATTCTCGGCCAGGGGCGG + Intergenic
1201693511 Y:16796352-16796374 ATAAAATTCTCAGCCAGGTGTGG - Intergenic
1202255794 Y:22918996-22919018 AATGTGTTGTTGGCCAGGTGTGG + Intergenic
1202408785 Y:24552745-24552767 AATGTGTTGTTGGCCAGGTGTGG + Intergenic
1202461998 Y:25117335-25117357 AATGTGTTGTTGGCCAGGTGTGG - Intergenic