ID: 916091137

View in Genome Browser
Species Human (GRCh38)
Location 1:161308779-161308801
Sequence ATCTTGATGTATAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091137 Original CRISPR ATCTTGATGTATAAGGAAGA GGG (reversed) Intronic
903586881 1:24422687-24422709 ATCTTGATTTCTCAGGATGATGG - Intronic
904234278 1:29104278-29104300 ATCTTGCTGGATAAGTAAGCCGG + Intronic
904902365 1:33867586-33867608 TTCTAGAATTATAAGGAAGAGGG - Intronic
907065849 1:51482284-51482306 AACTTGAGGTATGGGGAAGATGG + Intronic
908776610 1:67646989-67647011 ATCTTAATCTATAAGGAAAGTGG + Intergenic
909039838 1:70635975-70635997 ATCCTGATGTAGGAGGCAGAAGG + Intergenic
910120625 1:83785725-83785747 ACCCTGATATATAAGGAAAATGG + Intergenic
911119140 1:94277715-94277737 ACCTTGATGGAGAAGGAGGAGGG - Intergenic
911728525 1:101267561-101267583 ATATTGTGGTAAAAGGAAGAGGG - Intergenic
912813872 1:112813619-112813641 AGCTTGATGTGTAGGGAAGCGGG - Intergenic
916091137 1:161308779-161308801 ATCTTGATGTATAAGGAAGAGGG - Intronic
918079197 1:181192606-181192628 ATCCTGATGAATGAGGGAGAGGG - Intergenic
918249417 1:182688379-182688401 ATCTTCATTTTTAAGAAAGAAGG + Intergenic
919183112 1:194111009-194111031 CTCTTGATCTATAATGATGATGG + Intergenic
921305021 1:213787637-213787659 AGCTAGGTGGATAAGGAAGATGG + Intergenic
922363184 1:224841432-224841454 AGCTTGATGTGTAGGGAAGTGGG + Intergenic
923621787 1:235585498-235585520 ATCTTTTTGTGTAAGAAAGAAGG - Intronic
924711558 1:246533734-246533756 ATCTTTATGTATCAGAAAGGAGG + Intergenic
1064412170 10:15115155-15115177 ATCTTGAAGCATCAGGAAGGAGG + Intronic
1064474459 10:15672070-15672092 ATCATGAGGTATTAGGAAGTAGG - Intronic
1070005088 10:72416141-72416163 ATCTTGAGGGATAGGGAATAGGG + Intronic
1072442872 10:95472349-95472371 ATCCTGGAGAATAAGGAAGATGG - Intronic
1074106018 10:110390206-110390228 ATATTGATGGATAAGGAGGCTGG - Intergenic
1074658584 10:115623146-115623168 ACCTTGATTTATAAGGTATATGG + Intronic
1076329604 10:129654689-129654711 CTCTTGAGGTATGAGGAAGGTGG + Intronic
1076496724 10:130902257-130902279 ATGATGATGTATGAGGACGATGG + Intergenic
1078675583 11:13409883-13409905 AGCTTGATTAAGAAGGAAGAGGG + Intronic
1079259737 11:18866911-18866933 AGCCTGATGGAGAAGGAAGAGGG - Intergenic
1081296243 11:41393186-41393208 ATTTTGATGTATAAGAAATTTGG - Intronic
1085148374 11:74224980-74225002 ATGCTGATGTATAAGGAATGTGG + Intronic
1085246203 11:75103363-75103385 ATCTTGATGTAGCTGGGAGAGGG - Intronic
1092626459 12:10334469-10334491 AGCTTGATGTATAGGGAAGGGGG + Intergenic
1092912115 12:13154983-13155005 ATCTTGATCTATGAGAAAGCAGG + Intergenic
1093443386 12:19226976-19226998 ATTTTACTGTATAAGGAAGTCGG + Intronic
1093723478 12:22474074-22474096 ATCTTGGTGTAGCAGGAAGCTGG - Intronic
1095220933 12:39613600-39613622 AACTTATTCTATAAGGAAGATGG - Intronic
1095809936 12:46362324-46362346 AACTTGATATAGAAGGCAGAAGG + Exonic
1095902005 12:47337524-47337546 ATCTTGGAATATCAGGAAGAAGG - Intergenic
1099354311 12:81614582-81614604 ATCTTGATGAGTAAGAAATAAGG - Intronic
1100126243 12:91429870-91429892 ATATTAACATATAAGGAAGAAGG + Intergenic
1102326910 12:111993589-111993611 CCCAAGATGTATAAGGAAGAAGG + Intronic
1104508153 12:129352009-129352031 ATCCTGTTGTAAAGGGAAGAGGG + Intronic
1108073548 13:46654632-46654654 ATTTTGATGTATGGGGAAGTCGG + Intronic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1110828272 13:79998475-79998497 ATATTGAGGCATCAGGAAGAAGG + Intergenic
1110928970 13:81192355-81192377 ATAATGATATAGAAGGAAGATGG + Intergenic
1112827380 13:103407579-103407601 ATCTGGGTGTAAAAGGGAGAAGG - Intergenic
1114577019 14:23724816-23724838 ATTTTGATGTATAGTGAAGATGG + Intergenic
1115042784 14:28951818-28951840 ATCATGGAGCATAAGGAAGAAGG - Intergenic
1122452401 14:101820355-101820377 TTCTTGATGTATACGGTGGAAGG + Intronic
1124135036 15:27027816-27027838 ATAATGATGTATCAGGAAAAGGG - Intronic
1124861393 15:33445294-33445316 ATATTGAGGAATAAGGATGAGGG + Intronic
1127029682 15:54848290-54848312 AATTGGATTTATAAGGAAGATGG - Intergenic
1127457937 15:59171703-59171725 GTCTTGATATGTCAGGAAGAAGG - Intronic
1127885737 15:63198709-63198731 ATCCTGATGTATAAAGTGGAAGG + Intronic
1128341409 15:66825039-66825061 ATCTTGAACAAGAAGGAAGAAGG + Intergenic
1128341664 15:66826553-66826575 ATCTTGAATGAGAAGGAAGAAGG - Intergenic
1128911940 15:71523561-71523583 ATGCTGATGTATTAGGAAGATGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129989021 15:79945458-79945480 TTCTTGCAGTATGAGGAAGACGG + Intergenic
1131712746 15:95073661-95073683 CTCTTGATCCATAAGGCAGATGG - Intergenic
1134364687 16:13566127-13566149 ATTTTGATATATTAGAAAGAGGG + Intergenic
1134502930 16:14783220-14783242 AATTTGATGTATAAGGAAGAAGG + Intronic
1134577634 16:15345676-15345698 AATTTGATGTATAAGGAAGAAGG - Intergenic
1134901160 16:17939305-17939327 ATCCTGCTGTTCAAGGAAGAGGG + Intergenic
1136148364 16:28329663-28329685 ATGTTGATGTTAAAGGAAAATGG + Intergenic
1137630995 16:49944998-49945020 ATCTTGCTGTTTAAGCAAAAGGG - Intergenic
1137714122 16:50587560-50587582 ATCTTGATGGATCTGAAAGAAGG + Intronic
1138701563 16:58868754-58868776 ATCTTGATGCATAAATCAGATGG + Intergenic
1139392586 16:66614325-66614347 ATCCTGATGTGTAAGTGAGAGGG - Intergenic
1140796581 16:78444114-78444136 ATCTTGGTGTAAAAAGAAGAGGG - Intronic
1140872903 16:79123107-79123129 TGCGTGCTGTATAAGGAAGAAGG + Intronic
1143694259 17:8599640-8599662 ATCTGGCTGTAAAAGGAAGGTGG + Intronic
1148513581 17:48194755-48194777 AACTTGAATTAAAAGGAAGAGGG - Intronic
1149898108 17:60446745-60446767 ATTTAGATGTATAATGAAAAAGG - Exonic
1151244830 17:72786456-72786478 ATCTTGATGGAAAGGCAAGATGG - Intronic
1153451414 18:5234250-5234272 AACTTGATATATGAGAAAGATGG + Intergenic
1154494915 18:14948495-14948517 TTCTTGATGGTTAAGGGAGAAGG - Intergenic
1156934139 18:42681904-42681926 ATCTTGTTGTTCTAGGAAGATGG - Intergenic
1158328758 18:56338501-56338523 ATCTTGAAAAATAAGGAAGAGGG + Intergenic
1158528748 18:58239266-58239288 TTTTTGCTGTAAAAGGAAGATGG - Intronic
1160230506 18:77045046-77045068 ATCTTGATGTATGATGATGGAGG + Intronic
924975176 2:166773-166795 ACCCTGATGTCTAAGGAAGAAGG - Intergenic
925531652 2:4869551-4869573 ATCTAGATGTAAGAGGAAAACGG - Intergenic
925668410 2:6286746-6286768 ATCTTAATGTTTAAGGCAGAAGG - Intergenic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
926592457 2:14754067-14754089 ATGATGATGTAGCAGGAAGAAGG - Intergenic
926742105 2:16120479-16120501 ATCTAGATGTATAGTGAAAATGG - Intergenic
928192753 2:29188457-29188479 ATCTCTATGTATATAGAAGATGG + Intronic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930098631 2:47586238-47586260 AGCTTGATGTGTAGGGAAGCAGG + Intergenic
930336476 2:50053862-50053884 ATCTTGATGTAAAAGGGAAAAGG - Intronic
930891055 2:56388517-56388539 ATATTGTTGAAAAAGGAAGATGG + Intergenic
930977667 2:57483648-57483670 AATTTGATGTAGAAGAAAGAGGG + Intergenic
931476324 2:62591238-62591260 CCCTTGATGTATAAGGGATATGG + Intergenic
933595091 2:84275317-84275339 GTCTTGATGCAGATGGAAGAGGG - Intergenic
934161581 2:89254499-89254521 ATGATGAGGTATAAGAAAGATGG + Intergenic
934205703 2:89927916-89927938 ATGATGAGGTATAAGAAAGATGG - Intergenic
935200359 2:100851402-100851424 ACCTTGATGTATACTGCAGAAGG - Intronic
935666423 2:105516865-105516887 ATCTTGATGTAGAAGCAAATGGG - Intergenic
935684129 2:105668723-105668745 AGCTTCATGTGAAAGGAAGAAGG + Intergenic
936517406 2:113191095-113191117 TTCCAGATGCATAAGGAAGATGG + Intronic
938769117 2:134484603-134484625 ATATCCATGTATTAGGAAGAGGG + Intronic
939370996 2:141300058-141300080 ATCTTCATGTGTCAGAAAGACGG - Intronic
939442030 2:142261784-142261806 TTGTTGATGTGTAAGGAAGAAGG + Intergenic
940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG + Exonic
941153333 2:161942018-161942040 TTCCTGATGTAGAAGGCAGAAGG + Intronic
941196520 2:162459553-162459575 TTCATGAGGTAGAAGGAAGAAGG - Intronic
943279387 2:185911811-185911833 ATATTGATTTTTAAGGAATAAGG - Intergenic
943612295 2:190047314-190047336 AGTTTGATGGATAAGTAAGAAGG - Intronic
943974441 2:194454751-194454773 ATAATGAAGTATTAGGAAGATGG - Intergenic
944421540 2:199536255-199536277 ATCTTGGTGCATAAGGGGGAAGG - Intergenic
944450407 2:199836493-199836515 CTCTTGATGTAAAAGCAATAGGG - Intronic
944966198 2:204936878-204936900 AATTTGATATATAAGAAAGATGG + Intronic
945333920 2:208569662-208569684 AGCTGGATGTTTGAGGAAGAAGG + Intronic
945686667 2:212979361-212979383 CACTTCATGTATAAGGAACAAGG + Intergenic
946983019 2:225239240-225239262 CTCATGATGAATAAGGAAGTAGG + Intergenic
948186441 2:236025025-236025047 ATCTTGATTTTTCAGGAACAGGG + Intronic
1168736839 20:147639-147661 TTCTTGTTGAATAAGTAAGAGGG + Intergenic
1168951779 20:1807136-1807158 ATTTTGTTGACTAAGGAAGAAGG + Intergenic
1169451349 20:5714429-5714451 ATATTGCTGTACAAGGGAGAAGG - Intergenic
1169748449 20:8966662-8966684 ATGTTTATTTATATGGAAGAGGG - Intronic
1170864260 20:20138842-20138864 ATGTTGATATATGATGAAGATGG - Intronic
1173785088 20:45787153-45787175 ATCTTGATGCCTATGGAAGGTGG - Intronic
1174874579 20:54212858-54212880 ATTTTGATGAATATGGAAGTTGG - Intronic
1176703638 21:10091593-10091615 ATCTTGATGAACAAGGAAATGGG - Intergenic
1177657122 21:24032255-24032277 ATCTTCATGTTAAAAGAAGAAGG + Intergenic
1179480695 21:41676070-41676092 ATCTTGGTATATAAGGACAAGGG - Intergenic
1182528501 22:30937260-30937282 ATCTTGATAAAAAAGGGAGAGGG - Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1183733132 22:39629388-39629410 ATATGGATGTAGGAGGAAGAGGG - Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
950105677 3:10386794-10386816 AGCCTCATGTAGAAGGAAGATGG - Intronic
950728492 3:14935501-14935523 ATTTTCATGGATAAGGAAAAAGG - Intergenic
952159315 3:30677928-30677950 ATTTTAAGGTATAAGGAAGAGGG + Intronic
953080428 3:39611648-39611670 ATCCTGGTGAGTAAGGAAGATGG - Intergenic
953279774 3:41542990-41543012 ATTCTTATGTAAAAGGAAGAAGG + Intronic
953401526 3:42625036-42625058 ATATGGATGTAAAAGGAAGAAGG + Intronic
958540051 3:95459459-95459481 ATCTTGATAAATTAGGAAGAAGG - Intergenic
960641396 3:119827317-119827339 ATCTCTATGAATAATGAAGAGGG - Intronic
962658558 3:137575730-137575752 GTTTTGATGTAGAAGAAAGAAGG + Intergenic
963337184 3:143988548-143988570 AGCTAGCTGTATAGGGAAGAAGG - Intronic
965381844 3:167999086-167999108 ATCTTCATGAATAACCAAGAAGG - Intergenic
966202100 3:177368077-177368099 ATCCTCATGTAAAAGGAAGTGGG - Intergenic
967134419 3:186501523-186501545 CTCTTGTTATATAAGGAAGTTGG + Intergenic
968108321 3:196019948-196019970 ACCCTGATGTCTGAGGAAGAAGG - Intergenic
970817660 4:20177235-20177257 ATCTGTATGTATAAGGCAGATGG + Intergenic
973100636 4:46264609-46264631 ATCTATATCTATAAGGAATATGG + Intronic
974155090 4:58061259-58061281 ATCTTAATATATAAGTAAAATGG - Intergenic
974773335 4:66445236-66445258 ACCTTGATCAATAATGAAGAAGG - Intergenic
974981793 4:68966393-68966415 TCCTTGATGTATAAGGATTATGG + Intergenic
975508254 4:75163581-75163603 ATCTTAAAGAATAAGTAAGAGGG - Intergenic
977024292 4:91796414-91796436 ATCATAATGTATAAGCAAAAAGG + Intergenic
977993254 4:103470288-103470310 AGTTTGATACATAAGGAAGAAGG - Intergenic
978073840 4:104504427-104504449 AGCTTGATCTATAAGGTATAGGG + Intergenic
978822669 4:112983760-112983782 ATCTTGATGAATAAAATAGAAGG + Intronic
978943661 4:114468769-114468791 ACCTTGATGAATGAAGAAGAGGG + Intergenic
980011301 4:127597511-127597533 ATCTAGATGTATCTGGAAGATGG + Intergenic
980375854 4:131947939-131947961 ATCTTGATGAACAAGGAAATGGG - Intergenic
982080066 4:151780660-151780682 ATTTTGAAGCATAAGGAATATGG - Intergenic
982150756 4:152453994-152454016 ATAATGATGTATATGGATGAGGG - Intronic
982242928 4:153318744-153318766 AGTTTTATGTCTAAGGAAGAAGG + Intronic
983264330 4:165492187-165492209 ATGTTGATTTAGAAAGAAGATGG - Intronic
983448343 4:167880494-167880516 AGCTTGATGTGTAGGGAAGGGGG - Intergenic
983527758 4:168777678-168777700 TTCTGGATATATCAGGAAGAGGG - Intronic
984363384 4:178767234-178767256 ACCCTGATGTATAAGGACCATGG + Intergenic
985470260 5:37615-37637 ACCCTGATGTCTGAGGAAGAAGG - Intergenic
986185236 5:5429509-5429531 ATCTTGGGCTAGAAGGAAGACGG - Intronic
986201960 5:5587218-5587240 AACATGATGGAAAAGGAAGATGG + Intergenic
987024854 5:13915520-13915542 ATTTTAACGTATAAGGAAGTTGG + Intronic
988638742 5:33017475-33017497 ATACTGATGTGTAAGGAAGGAGG - Intergenic
988833938 5:35013400-35013422 CTTTTGAGGTATATGGAAGAGGG - Intronic
991682925 5:69156383-69156405 ATCCTGTTGTCTCAGGAAGAGGG - Intergenic
994718468 5:103352242-103352264 ATATTGATGAATAAGGTGGAGGG + Intergenic
996007612 5:118441862-118441884 ACTTTAATGTATAAGGAAGACGG + Intergenic
996574677 5:124967892-124967914 AGCTTGATGTGTAGGGAAGGTGG + Intergenic
996725419 5:126669764-126669786 AGCTTGATGTGTAGGGAAGGTGG + Intergenic
997339445 5:133131332-133131354 ACCTTGATGTTTAAGGAGAAAGG + Intergenic
998009041 5:138678515-138678537 ATCTTGATGGTTATAGAAGAAGG - Intronic
998393622 5:141804137-141804159 CTCCTGCTGAATAAGGAAGAGGG - Intergenic
1000508662 5:162154086-162154108 ATCTTCATGCATGAGGGAGAAGG - Exonic
1001006705 5:168058174-168058196 ATCTACATGTGTAAGGAAAATGG - Intronic
1001085706 5:168698840-168698862 AACTTAATGTAAAAGGAAAAGGG - Intronic
1001600788 5:172926753-172926775 ACCCTGATGGAGAAGGAAGAAGG + Intronic
1003155722 6:3592191-3592213 ATCTTTATGTACAATAAAGAAGG - Intergenic
1003253277 6:4451742-4451764 AACTTCATGTGTAGGGAAGAAGG + Intergenic
1003699930 6:8452252-8452274 GTCATGATGTAGAAAGAAGATGG + Intergenic
1004794404 6:19064969-19064991 CTTTTGTTGTAAAAGGAAGAAGG + Intergenic
1004852108 6:19710273-19710295 ATCCTGAAGCAAAAGGAAGAGGG - Intergenic
1006220872 6:32490165-32490187 ATCATGATGAATGAGGAACAGGG - Intergenic
1006969581 6:38027743-38027765 ATCTGGATGTCTTAGGCAGATGG + Intronic
1007266346 6:40599211-40599233 AACTTGATGGAGAGGGAAGAAGG - Intergenic
1008565642 6:52765632-52765654 AGATTCATGTGTAAGGAAGAGGG - Intergenic
1008569832 6:52805971-52805993 AGATTCATGTGTAAGGAAGAGGG - Intergenic
1009144092 6:59649994-59650016 ATCTTCATGTAAAAAGTAGATGG + Intergenic
1009255443 6:61387494-61387516 ATCTTCATATATAAACAAGATGG + Intergenic
1012908691 6:105095728-105095750 ATCTTTATGTATTAGGAAGCTGG + Intergenic
1013200903 6:107894999-107895021 ATCTGGATGTTTAAAGAAAAAGG + Intronic
1013303675 6:108828325-108828347 ATGTTGATGTATAATGTGGAAGG + Intergenic
1013640991 6:112081182-112081204 GTCTTGATTGATATGGAAGAAGG - Exonic
1014569809 6:122995862-122995884 ATTTTGATGTAGAAGGAGTACGG - Intergenic
1015892223 6:137980303-137980325 GTTTTGCTGTAAAAGGAAGAAGG - Intergenic
1018136124 6:160779844-160779866 AGCTTGATGTATAGGGAAGCGGG - Intergenic
1018229908 6:161665616-161665638 ATTTTGATGTAGAATGAACAAGG - Intronic
1018282849 6:162206522-162206544 TTCTTGATGTGTAAGAAACAAGG - Intronic
1021002372 7:15348274-15348296 ATATTGATGTATATTGATGAGGG - Intronic
1021372655 7:19869000-19869022 ATATTTATTTCTAAGGAAGAAGG + Intergenic
1021393953 7:20124984-20125006 AGCTTGATGTGTAGGGAAGGTGG - Intergenic
1024695467 7:51852091-51852113 ATCTGGATGTATAACAGAGAAGG - Intergenic
1024707237 7:51973633-51973655 ATTTTGATGGATAAGGAAATGGG + Intergenic
1026250391 7:68664938-68664960 ATGTTGATCTATGAGGAAGAAGG + Intergenic
1026616929 7:71913478-71913500 CTCTCTATGTATAAGAAAGAAGG + Intronic
1027537052 7:79416320-79416342 ATCTTGATTCATGAGGAAGGAGG + Intronic
1033580084 7:142724967-142724989 ATTTTGAAGTAGAAGGATGAAGG + Intergenic
1034294987 7:149964243-149964265 TTTTTGATGAATAAGGAATAGGG + Intergenic
1034391462 7:150790807-150790829 ATCTTCATATATAAAGAAAATGG + Intergenic
1034811074 7:154132703-154132725 TTTTTGATGAATAAGGAATAGGG - Intronic
1034831027 7:154307494-154307516 ACCATGAAGTATAATGAAGAGGG + Intronic
1037519017 8:19661915-19661937 ATCTTGAACTATTAGGATGAAGG - Intronic
1039139488 8:34369908-34369930 ATCTTGAGGGATAAGGAGAAGGG - Intergenic
1040493965 8:47949811-47949833 ATCTTGATAAGCAAGGAAGAAGG + Intronic
1041005742 8:53495515-53495537 ACCATGATGTGTTAGGAAGATGG - Intergenic
1041403129 8:57465472-57465494 ATCTTGTTGTAAAAGGGAAAGGG + Intergenic
1041759762 8:61351973-61351995 ATCTTGAAATATCAGGAAGAAGG + Intronic
1045062698 8:98423096-98423118 TTCTTGATGCATCAGGAGGAAGG + Intronic
1045812340 8:106237319-106237341 ATCTTGCTTTATAATGATGAAGG - Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1048365471 8:133734474-133734496 ATCTGCAAGTTTAAGGAAGACGG - Intergenic
1051377463 9:16417827-16417849 AACTTAACGTATAAGCAAGAAGG + Exonic
1051602652 9:18890340-18890362 CTCTTGAAGCATAAGGAAGGTGG - Intronic
1051613758 9:18987279-18987301 TTCTTGGAGTATGAGGAAGAGGG - Intronic
1053640901 9:40078607-40078629 ATCTTGATGAACAAGGAAATGGG - Intergenic
1053765234 9:41386865-41386887 ATCTTGATGAACAAGGAAATGGG + Intergenic
1054321590 9:63674589-63674611 ATCTTGATGAACAAGGAAATGGG - Intergenic
1054543849 9:66298024-66298046 ATCTTGATGAACAAGGAAATGGG + Intergenic
1056487762 9:87076024-87076046 ATTTTGATGTGTGAGGAAGTGGG + Intergenic
1057482038 9:95452284-95452306 ATCTTCAAGTAAAAAGAAGAGGG - Intronic
1058899679 9:109431128-109431150 ATCTTGATGTTGAAGGGTGAGGG + Intronic
1202788675 9_KI270719v1_random:61689-61711 ATCTTGATGAACAAGGAAATGGG - Intergenic
1188574044 X:31624267-31624289 ATCCTGAAGTACAAGGACGACGG + Intronic
1192873099 X:75203912-75203934 ATTTTAATATAAAAGGAAGAGGG + Intergenic
1194190463 X:90829404-90829426 TTCTAGATGTACAAAGAAGAGGG - Intergenic
1197546402 X:127830329-127830351 TTATTCTTGTATAAGGAAGAAGG - Intergenic
1199046632 X:143181945-143181967 ATCTTGTTCTGTTAGGAAGAAGG + Intergenic
1199118418 X:144020595-144020617 ATCTGGATGGATGAGGTAGAGGG + Intergenic
1199974902 X:152888505-152888527 TTGTTGATGTAAAGGGAAGAAGG + Intergenic
1200537121 Y:4411828-4411850 TTCTAGATGTACAAAGAAGAGGG - Intergenic
1201663803 Y:16426801-16426823 ATCTATATATATAGGGAAGAAGG - Intergenic