ID: 916091270

View in Genome Browser
Species Human (GRCh38)
Location 1:161309566-161309588
Sequence TGAATTTTACAGATGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 461}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091270 Original CRISPR TGAATTTTACAGATGGAGTC TGG Intronic
900910255 1:5592334-5592356 TGACTTTTGAAGATGGAGTAAGG + Intergenic
900930998 1:5737485-5737507 TGAATTAAATAGATAGAGTCGGG + Intergenic
900931055 1:5737888-5737910 TGAATTAGATAGATAGAGTCGGG + Intergenic
902525608 1:17055157-17055179 TTATTTGTAGAGATGGAGTCTGG + Intergenic
902706115 1:18206066-18206088 TAAATTTTAAATATGGTGTCAGG + Intronic
903205242 1:21777100-21777122 TTTTTTTTTCAGATGGAGTCTGG - Intronic
903851301 1:26307968-26307990 TGAAATTTACAGATGAGGGCCGG + Intronic
905070791 1:35223626-35223648 TTAAATGTAGAGATGGAGTCTGG + Intergenic
905139337 1:35829148-35829170 TGAAATTTTCAGATGGCTTCTGG + Intronic
905301937 1:36991533-36991555 TTCATTTTACAGATGAAATCAGG + Intronic
905368727 1:37471259-37471281 TTTATTTTCGAGATGGAGTCTGG - Intergenic
905369134 1:37474055-37474077 GGCACTTTTCAGATGGAGTCAGG - Intergenic
905615925 1:39398712-39398734 TGACTTACACAGATAGAGTCAGG + Intronic
905871727 1:41408173-41408195 TGAATCTTAGAGATGGAGGCTGG + Intergenic
906817680 1:48895786-48895808 TTAATTTTACAGTTGGGGTGTGG + Intronic
906884747 1:49632199-49632221 TTAATATTCCAGAGGGAGTCTGG + Intronic
907061521 1:51430945-51430967 TGTATTTTTCAGATAGGGTCAGG - Intronic
908050156 1:60220699-60220721 TGAATATTCCAGATTGTGTCAGG + Intergenic
908308976 1:62856740-62856762 GGAACTTTACTGATGGAGTTTGG + Intronic
908566342 1:65360292-65360314 TGAAGGTTACAGATGGACTCTGG + Intronic
908661384 1:66439238-66439260 TGGGTTTTACAGTTGGAATCAGG + Intergenic
909019138 1:70411900-70411922 TAAATTTTAAAGATGTAGTACGG + Intronic
909837775 1:80278690-80278712 TGAATTTTACATATTGAATTTGG - Intergenic
909943852 1:81640617-81640639 TTTATTTTTGAGATGGAGTCTGG - Intronic
910373337 1:86542072-86542094 TGAATTCTCCAGAGAGAGTCAGG - Intergenic
911372941 1:97015926-97015948 TGACTTTTAGAAATGGAGTTAGG + Intergenic
911373003 1:97016755-97016777 TGACTTTTAGAAATGGAGTTAGG - Intergenic
911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG + Intronic
911736169 1:101338759-101338781 TGAGTTTTACAAAGGCAGTCTGG - Intergenic
912105885 1:106274303-106274325 TGAACTTTACACATGTAATCTGG - Intergenic
912667847 1:111599215-111599237 TGTTTTTTTGAGATGGAGTCTGG + Intronic
912804782 1:112746850-112746872 TAAATTTTACATATGGTGTGAGG + Intergenic
915161492 1:153923382-153923404 TCAATTCTAAAGATGGAGACTGG + Intergenic
916050568 1:161033635-161033657 TGTTTTTTTGAGATGGAGTCTGG - Intronic
916091270 1:161309566-161309588 TGAATTTTACAGATGGAGTCTGG + Intronic
916305655 1:163328012-163328034 TGAATTTTAAAAATGGAATAAGG - Intronic
918250161 1:182696332-182696354 TTTATTTTTGAGATGGAGTCTGG + Intergenic
918449624 1:184646024-184646046 TGTTTTTTTGAGATGGAGTCTGG - Intergenic
918800392 1:188962977-188962999 TTATTTTTTGAGATGGAGTCCGG - Intergenic
919694140 1:200556353-200556375 ACAATTTTAAAGCTGGAGTCAGG - Intronic
921281343 1:213571163-213571185 TCCATTTTACAGATAGAGACAGG - Intergenic
921800328 1:219395784-219395806 TGATTTTTACATATGGTGTAAGG + Intergenic
922425062 1:225484839-225484861 TTAATTTTAGAGATGGGGTCTGG - Intergenic
922486201 1:225975111-225975133 TTTATTTTTGAGATGGAGTCTGG + Intergenic
922614394 1:226953039-226953061 TTATTTTTTGAGATGGAGTCTGG + Intronic
922747556 1:228053313-228053335 TGATTTTTACAGATGGTGTGAGG - Intronic
923486156 1:234433224-234433246 TGTTTTTTGGAGATGGAGTCTGG - Intronic
924303323 1:242661927-242661949 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1063723889 10:8615600-8615622 TTTATTTTTGAGATGGAGTCTGG + Intergenic
1065879319 10:30025918-30025940 TGAATTTTAAAGATGGCTTCTGG + Intronic
1066497307 10:35954841-35954863 TTATTTTTTCATATGGAGTCTGG + Intergenic
1069443251 10:68448787-68448809 TTTATTTTTGAGATGGAGTCTGG + Intronic
1069972519 10:72184130-72184152 TTATTTTTTGAGATGGAGTCTGG - Intronic
1072103599 10:92252818-92252840 TGTTTTATACAGTTGGAGTCAGG - Intronic
1073295352 10:102435348-102435370 TGAATTTTGCAGCTGGTGTTTGG + Intergenic
1073410380 10:103336861-103336883 TGCTTTTTTGAGATGGAGTCTGG - Intronic
1074531202 10:114300148-114300170 TGACTAATACAGATGGAATCGGG + Intronic
1075202580 10:120418188-120418210 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1075926634 10:126256415-126256437 CCCATTTTACAGATGGAGACTGG - Intronic
1076525358 10:131109230-131109252 TGAAGTTTACAGAAGAATTCAGG - Intronic
1076644425 10:131942688-131942710 TCATTTTTAGAGATGGGGTCTGG - Intronic
1078019766 11:7646711-7646733 TTATTTTTAGAGATGGGGTCTGG - Intronic
1078172394 11:8938259-8938281 TTATTTTTCGAGATGGAGTCTGG + Intergenic
1078600159 11:12723451-12723473 TTTATTTTACAGATGAATTCTGG - Intronic
1078925394 11:15870310-15870332 TGTTTTTTGGAGATGGAGTCTGG + Intergenic
1080606074 11:33865986-33866008 GGAATTTTACAGATGGAAGAAGG - Intronic
1081281555 11:41214736-41214758 TTTATTTTTGAGATGGAGTCTGG - Intronic
1081369182 11:42277496-42277518 TTTTTTTTAGAGATGGAGTCTGG - Intergenic
1081388697 11:42503506-42503528 TGGATTTAAGACATGGAGTCAGG - Intergenic
1081397928 11:42609514-42609536 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1081865768 11:46359432-46359454 TTTATTTTTGAGATGGAGTCTGG - Intronic
1081924260 11:46811048-46811070 GGAGATTTACAGATGGATTCGGG - Exonic
1082855754 11:57805257-57805279 TGTTTTTTTGAGATGGAGTCTGG + Intronic
1084739566 11:71130623-71130645 TGGATTACACAGATGGATTCAGG + Intronic
1084787774 11:71453369-71453391 AGAATTTTAAAGAGTGAGTCTGG + Exonic
1084970528 11:72768965-72768987 TGAATTATACAGATGCACTGAGG - Intronic
1085628445 11:78091638-78091660 TGAATGTTATTTATGGAGTCTGG + Intergenic
1086203105 11:84227071-84227093 TTAATTTTTAAGATGGAGCCTGG - Intronic
1086337727 11:85815638-85815660 TGCATTTTACAGATGAAGATAGG + Intergenic
1086812543 11:91328797-91328819 TGTATTTTACAGATGGGATGTGG - Intergenic
1088060597 11:105644590-105644612 TTAGTTTTTGAGATGGAGTCTGG - Intronic
1088068176 11:105747520-105747542 TGTATTATTCAGATGGAGTATGG + Intronic
1088604011 11:111512139-111512161 TGAATTTTCCAAATGGAGGTGGG - Intronic
1088644678 11:111908225-111908247 TTAATTTTAGAGATGCAGTAAGG + Intergenic
1089196940 11:116699368-116699390 TTTATTTTTGAGATGGAGTCTGG - Intergenic
1089939686 11:122402885-122402907 TGCATTTTACAAAGGGAGTGGGG - Intergenic
1096005040 12:48162670-48162692 TGTTTTTTTGAGATGGAGTCTGG + Intronic
1096290951 12:50342947-50342969 TTTTTTTTAAAGATGGAGTCAGG + Intronic
1096338523 12:50776873-50776895 TTTATTTTTGAGATGGAGTCTGG + Intronic
1097113996 12:56683636-56683658 TGTTTTTTTGAGATGGAGTCTGG - Intronic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1098291771 12:68963290-68963312 TAACTTTAACAGATGGAGTGAGG - Intronic
1098300848 12:69052799-69052821 TGAAATTTGCAGTTGGAGTCTGG - Intergenic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1099277312 12:80592997-80593019 TTTATTTTTGAGATGGAGTCTGG - Intronic
1099455380 12:82856661-82856683 TGAATATTCCAGATCGAGGCTGG - Intronic
1100233384 12:92632854-92632876 TTAATTTTTCAGATGGAAACTGG - Intergenic
1100240288 12:92704247-92704269 TTCTTTTTAGAGATGGAGTCTGG - Intronic
1101341529 12:103846110-103846132 TTATTTTTTAAGATGGAGTCTGG - Intergenic
1101837162 12:108303729-108303751 TGCATTTTACAGACGGAGCAAGG + Intronic
1102103335 12:110298706-110298728 TGTTTTTTTGAGATGGAGTCTGG - Intronic
1102623031 12:114211825-114211847 TGAGAGTTACAGATGGGGTCAGG + Intergenic
1103190086 12:118993715-118993737 TTCATTTTACAGAAGGAATCTGG + Intronic
1103385670 12:120530568-120530590 TTTATTTTTGAGATGGAGTCTGG - Intronic
1104238768 12:126966194-126966216 TTAATTTTTAAGATGGAGCCAGG + Intergenic
1104413700 12:128580407-128580429 TCATTTTTTGAGATGGAGTCTGG - Intronic
1104634834 12:130431437-130431459 TTAATCATACAGATGGCGTCTGG - Intronic
1104828183 12:131729777-131729799 TAAGCTTTACAAATGGAGTCAGG - Intronic
1106863550 13:33937703-33937725 TTAATTTTAGATAAGGAGTCCGG - Intronic
1107076167 13:36323173-36323195 TTTAATTTACAGATGGACTCTGG - Intronic
1107619593 13:42212627-42212649 TAAATTTTGCAGATGAAATCAGG + Intronic
1108859258 13:54833731-54833753 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1109913108 13:68943076-68943098 TGAAGTTCAGAGATGGATTCTGG - Intergenic
1111067932 13:83122146-83122168 TGACATTTACAGATGAAGTTGGG - Intergenic
1111232389 13:85361024-85361046 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1111250157 13:85591221-85591243 TGTTTTTTTGAGATGGAGTCTGG - Intergenic
1112743900 13:102505953-102505975 TGAATTGTAAAGAGGGAGTAGGG - Intergenic
1113394261 13:109931240-109931262 TGTTTTTTTGAGATGGAGTCTGG - Intergenic
1116751453 14:48890583-48890605 TGAATGTTACAGATGTAGTGAGG + Intergenic
1116814809 14:49573908-49573930 TGAATTTCATAGACTGAGTCTGG - Exonic
1117528611 14:56637036-56637058 TGAACTTTGCAGATGGAGGAAGG + Intronic
1117723490 14:58649363-58649385 TTTATTTTTGAGATGGAGTCTGG + Intergenic
1117981458 14:61345975-61345997 AAAATTTTTCAGATGGACTCTGG + Intronic
1118017087 14:61671673-61671695 TGAAATATACAAATGGAGGCCGG + Intergenic
1118238598 14:64035701-64035723 TGAATTTTAGAGACAGGGTCTGG + Intronic
1119052227 14:71381062-71381084 TTTATTTTTGAGATGGAGTCTGG + Intronic
1120731255 14:88004103-88004125 TTAATTTTAAAGATGTAATCAGG - Intergenic
1122194923 14:100077782-100077804 TGTTTTTTTGAGATGGAGTCTGG + Intronic
1122404465 14:101491816-101491838 AGAATCTTACAGAAGGAGACAGG + Intergenic
1122681645 14:103469191-103469213 TTTATTTTTCAGATGGAATCTGG + Intronic
1123149944 14:106171019-106171041 TGAAATTTACTGATAGAGTCAGG - Intergenic
1123492900 15:20796985-20797007 TGAATATCCCAGATGGAGGCTGG + Intergenic
1123549401 15:21366083-21366105 TGAATATCCCAGATGGAGGCTGG + Intergenic
1123786763 15:23682488-23682510 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1124930944 15:34118934-34118956 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1125003325 15:34794009-34794031 TGAATTTCACTGTTGGAGTGAGG - Intronic
1125053155 15:35325548-35325570 TGATTTTTATGGATGGAGTGAGG - Intronic
1125652405 15:41328063-41328085 TTATTTTTTGAGATGGAGTCTGG - Intronic
1125802119 15:42458694-42458716 TGTTTTTTTGAGATGGAGTCTGG - Intronic
1125844042 15:42834479-42834501 TGAAATATACAGAATGAGTCTGG + Intronic
1126781839 15:52145631-52145653 TTATTTTTTGAGATGGAGTCTGG - Intronic
1126794779 15:52251674-52251696 TTTATTTTTGAGATGGAGTCTGG + Intronic
1127083215 15:55400494-55400516 TTTATTTTTGAGATGGAGTCTGG - Intronic
1127436847 15:58966354-58966376 TAAATTTTTGAGATGGGGTCTGG - Intronic
1127448006 15:59085294-59085316 TGAATGTTACAGATGCTCTCTGG - Intronic
1127479069 15:59361846-59361868 TTATTTTTTGAGATGGAGTCTGG + Intronic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1127974391 15:63986434-63986456 TTATTTTTAGAGATGGGGTCTGG + Intronic
1128593212 15:68921117-68921139 AGAATTTTTCAGGTGGAGTCTGG - Intronic
1129385675 15:75195040-75195062 TGTTTTTTTGAGATGGAGTCTGG - Intergenic
1129491644 15:75932261-75932283 AGAATTTGACAGCTGAAGTCGGG + Intronic
1129801595 15:78418977-78418999 TGGCTGTTACAGATAGAGTCAGG + Intergenic
1130523906 15:84686882-84686904 TTATTTTTTGAGATGGAGTCTGG + Intronic
1130882123 15:88064398-88064420 TGAAGTTTGCAGCTGGAGTAAGG - Intronic
1131507045 15:93028418-93028440 GTAATTTAACAGATGGGGTCTGG + Intergenic
1132300625 15:100773471-100773493 TGAATTTTCCAGATGGTGTATGG + Intergenic
1202957732 15_KI270727v1_random:93301-93323 TGAATATCCCAGATGGAGGCTGG + Intergenic
1132532109 16:457001-457023 TGAAGTTTACAGATAGCTTCGGG + Intronic
1132717063 16:1296306-1296328 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1133838704 16:9389065-9389087 TGAAGCCTAGAGATGGAGTCCGG + Intergenic
1134002886 16:10796442-10796464 TTATTTTTTGAGATGGAGTCTGG + Intronic
1134154375 16:11830816-11830838 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
1134174133 16:11992280-11992302 AAAATTTAAGAGATGGAGTCTGG - Intronic
1134276952 16:12785259-12785281 TTATTTTTACAGATGGGGTCTGG + Intronic
1134400980 16:13909396-13909418 TTTATTTTTGAGATGGAGTCTGG + Intergenic
1135644617 16:24150817-24150839 TGAATTCTAGAGCAGGAGTCAGG - Intronic
1135701624 16:24637795-24637817 TTTATTTTTGAGATGGAGTCTGG + Intergenic
1135859098 16:26038689-26038711 TTTATTTTTGAGATGGAGTCTGG + Intronic
1136266072 16:29119514-29119536 TGACTTTTAAAGAAGGAGACTGG + Intergenic
1136610797 16:31363786-31363808 CCCATTTTACAGATGGAATCTGG + Intronic
1138497723 16:57418343-57418365 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
1138616983 16:58176503-58176525 TAAATGTTACAGATGTAGTTTGG - Intronic
1139013437 16:62661613-62661635 TTATTTTTAGAGATAGAGTCTGG + Intergenic
1139143764 16:64298875-64298897 GGACTTTTACAGAGGTAGTCAGG + Intergenic
1139774502 16:69307771-69307793 TTAATTTTTTAAATGGAGTCGGG - Exonic
1139899502 16:70316641-70316663 TATATTTTTTAGATGGAGTCTGG - Intronic
1139926497 16:70490693-70490715 TGTTTTTTTGAGATGGAGTCTGG + Intronic
1140348000 16:74233675-74233697 TTATTTTTTCAGATGGAGTCTGG - Intergenic
1140734931 16:77890113-77890135 TGGATTTTACAGATGAGGTGGGG + Intronic
1141156459 16:81600756-81600778 TGAATTTTAGAAATGCAGCCAGG + Intronic
1141457464 16:84152943-84152965 TTTTTTTTTCAGATGGAGTCTGG - Intronic
1142054882 16:87987425-87987447 TGACTTTTAAAGAAGGAGGCTGG + Intronic
1142816141 17:2427389-2427411 TGAATTTTCTGCATGGAGTCAGG - Intronic
1143000523 17:3792131-3792153 TTATTTTTTGAGATGGAGTCTGG + Intronic
1144311652 17:14019414-14019436 AGAGTTTTACAGATGGAGGGTGG + Intergenic
1145283291 17:21484042-21484064 TTTATTTTTGAGATGGAGTCTGG - Intergenic
1145394191 17:22481759-22481781 TTTATTTTTGAGATGGAGTCTGG + Intergenic
1146067163 17:29645203-29645225 TTCATTTTATAGATGGGGTCAGG + Intronic
1146119829 17:30182627-30182649 TTATTTTTTGAGATGGAGTCTGG - Intronic
1146834772 17:36101854-36101876 TGATTTTTACAGATGGTGTAAGG + Intergenic
1146849379 17:36209036-36209058 TGATTTTTACAGATGGTGTAAGG + Intronic
1147601832 17:41751391-41751413 TGATTTGTAAAGATGGAGTCTGG - Intergenic
1148176522 17:45570244-45570266 TGTTTTTTTGAGATGGAGTCTGG - Intergenic
1148912694 17:50951396-50951418 TTTATTTTTGAGATGGAGTCTGG - Intergenic
1148923783 17:51063868-51063890 TTTATTTTTGAGATGGAGTCTGG - Intronic
1149102379 17:52922144-52922166 TGTTTTTTTGAGATGGAGTCTGG + Intergenic
1149874133 17:60213952-60213974 TTTTTTTTAAAGATGGAGTCTGG + Intronic
1150047703 17:61929354-61929376 TATATTTTTGAGATGGAGTCTGG - Intergenic
1150087915 17:62291212-62291234 TTTTTTTTAAAGATGGAGTCTGG + Intergenic
1150844168 17:68638300-68638322 TTTATTTTTGAGATGGAGTCTGG + Intergenic
1151357089 17:73565834-73565856 TGTTTTTTTGAGATGGAGTCTGG + Intronic
1151531636 17:74709988-74710010 TGTTTTTTTGAGATGGAGTCAGG + Intronic
1151764716 17:76126696-76126718 TTTATTTTTGAGATGGAGTCTGG - Intergenic
1151844139 17:76639561-76639583 TTATTTTTCGAGATGGAGTCTGG - Intronic
1152148206 17:78582015-78582037 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1153361090 18:4197792-4197814 TGAATGTTAGAGATGAAGTAGGG + Intronic
1154450441 18:14471518-14471540 TGAATATCCCAGATGGAGGCTGG + Intergenic
1155419584 18:25640513-25640535 TCCATTTTACAGATTGAGTGGGG + Intergenic
1155962593 18:32007275-32007297 TGTTTTTTTAAGATGGAGTCTGG + Intergenic
1156497640 18:37536606-37536628 TGCATTTTACAGATGCAGATAGG + Intronic
1157428375 18:47602911-47602933 CAAATTTTCCAGATGGAGTTGGG + Intergenic
1157520816 18:48343994-48344016 TTTATTTTTGAGATGGAGTCTGG + Intronic
1157912199 18:51626868-51626890 CGAATTTTAGAAATGTAGTCAGG - Intergenic
1158415144 18:57243743-57243765 TGTTTTTTTGAGATGGAGTCTGG - Intergenic
1158613660 18:58966577-58966599 TAAATTTTAGAAATGGAATCTGG - Intronic
1159605452 18:70469938-70469960 TGTAAGATACAGATGGAGTCTGG + Intergenic
1159784766 18:72699576-72699598 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1160159600 18:76461168-76461190 TTATTTTTTGAGATGGAGTCAGG - Intronic
1160246018 18:77160172-77160194 TGTTTTTTTGAGATGGAGTCTGG + Intergenic
1160621613 18:80174935-80174957 TTATTTTTTGAGATGGAGTCTGG - Intronic
1160736430 19:664651-664673 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1160815963 19:1035908-1035930 TTTATTTTTGAGATGGAGTCTGG - Intronic
1162045443 19:7996799-7996821 TGGTTTTTGGAGATGGAGTCTGG - Intronic
1162114346 19:8419480-8419502 TTATTTTTTGAGATGGAGTCCGG - Intronic
1162543993 19:11317101-11317123 TGTCTTGTAGAGATGGAGTCAGG - Intronic
1163882316 19:19936018-19936040 TTTCTTTTTCAGATGGAGTCTGG - Intergenic
1164481857 19:28617556-28617578 TTTATTTTTGAGATGGAGTCTGG - Intergenic
1164612913 19:29645213-29645235 TGGATTTTACAGAGAGAGGCTGG + Intergenic
1164736116 19:30542699-30542721 TCTATTTTACAGATGGGGTCTGG - Intronic
1164962138 19:32442802-32442824 TGAACTTTACTGATGGAGGTGGG - Intronic
1165307784 19:35012961-35012983 TGTTTTTTGGAGATGGAGTCTGG - Intronic
1166800205 19:45451976-45451998 TGTTTTTTAGAGATGGGGTCTGG + Intronic
1167105059 19:47425335-47425357 TTTATTTTTGAGATGGAGTCTGG - Intergenic
1167128262 19:47566731-47566753 TTTATTTTTGAGATGGAGTCTGG - Intergenic
1167511662 19:49898307-49898329 TTATTTTTTGAGATGGAGTCTGG - Intronic
1167710316 19:51106516-51106538 TAATTTTTTGAGATGGAGTCTGG + Intronic
1167930403 19:52858529-52858551 TTATTTTTAGAGAGGGAGTCTGG - Intergenic
1168096408 19:54117838-54117860 TATTTTTTAAAGATGGAGTCTGG - Intronic
1168399039 19:56072760-56072782 TTATTTTTTGAGATGGAGTCTGG - Intergenic
925699327 2:6617740-6617762 TCAATTTAACAGATGGTGCCTGG - Intergenic
925707187 2:6697521-6697543 TTATTTTTTGAGATGGAGTCTGG - Intergenic
925891717 2:8439826-8439848 TGAATTCTACATTTGGAGGCTGG - Intergenic
926055830 2:9773411-9773433 CAAATGTTACAGATGGGGTCTGG - Intergenic
926617694 2:15013771-15013793 TTAATTTTTGAGGTGGAGTCTGG - Intergenic
927073547 2:19553989-19554011 AGCATTTGACAGATGGAGGCGGG - Intergenic
927282423 2:21320941-21320963 AGAATTTTACAGAGGGTGTGAGG - Intergenic
930883938 2:56302639-56302661 TGTATTGTAAAGATGGTGTCTGG - Intronic
930923161 2:56782427-56782449 TGTATTTTAAAAATGGAGACTGG + Intergenic
931333677 2:61316872-61316894 TTATTTTTTGAGATGGAGTCTGG - Intronic
931858950 2:66333649-66333671 TTATTTTTTGAGATGGAGTCTGG - Intergenic
933082007 2:78002130-78002152 TGATTTTTAGAGACGGAGTTTGG - Intergenic
933189082 2:79313155-79313177 TGCATTTTATAGTTGGAGTTGGG + Intronic
933668173 2:84981788-84981810 TGTTTTTTTGAGATGGAGTCTGG + Intronic
933995132 2:87662596-87662618 TGCATTTTAAAGAGGGAGTCAGG + Intergenic
934860872 2:97762839-97762861 TTAATTTCAGAGATGGGGTCAGG - Intronic
935050810 2:99523433-99523455 TTTTTTTTGCAGATGGAGTCTGG - Intergenic
935264771 2:101384847-101384869 TTTATTTTATAGATGGGGTCTGG - Intronic
936298729 2:111288317-111288339 TGCATTTTAAAGAGGGAGTCAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937521157 2:122713547-122713569 TGAATTTGACTGTTGGACTCTGG - Intergenic
940532673 2:154899684-154899706 TGATTTTTAAAGATAGAATCAGG - Intergenic
940636634 2:156305842-156305864 TTATTTTTTGAGATGGAGTCTGG - Intergenic
940729992 2:157377324-157377346 TGAGTTTTACAGAGAGGGTCAGG + Intergenic
942424200 2:175842049-175842071 TTATTTTTTGAGATGGAGTCTGG - Intergenic
942497821 2:176558230-176558252 AAAATTATAGAGATGGAGTCTGG - Intergenic
944330358 2:198458244-198458266 TGAATTGTACTGATGCAGTTGGG + Intronic
944581269 2:201134621-201134643 TTAATTTTTGAGATGGAGTCTGG - Intronic
945662901 2:212708315-212708337 TGAATGTTATTGATGGAGTGAGG - Intergenic
946746595 2:222852834-222852856 TGAATTTCAAAGAAAGAGTCAGG - Intergenic
946865328 2:224037336-224037358 TGAAGATTACAGTGGGAGTCCGG + Intronic
947272024 2:228347168-228347190 TGTATTTTTGAGATAGAGTCTGG - Intergenic
947567733 2:231205402-231205424 TGAATTTTATAGATGAAGAAAGG + Intronic
947661448 2:231872082-231872104 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1169487319 20:6044176-6044198 TGAATCTTCAAGATGGAGCCTGG - Intronic
1170068019 20:12335636-12335658 TGAATTTTACAAAAGGAGTTTGG - Intergenic
1170212302 20:13857651-13857673 TGAATTTAACACATGGAGTGGGG + Intronic
1170373751 20:15678050-15678072 TTTTTTTTTCAGATGGAGTCTGG - Intronic
1171332495 20:24352794-24352816 TGAATTGTACATATGGAATATGG - Intergenic
1171336249 20:24388393-24388415 TGAATGCTGCAGATGGAGGCAGG + Intergenic
1171383970 20:24754791-24754813 TCAATTTTAGAGATGGTGGCCGG + Intergenic
1172627254 20:36354308-36354330 TGTTTTCTACAGATGGGGTCTGG - Intronic
1173903528 20:46608563-46608585 TGTACTTTACAGATGAAGTTTGG - Intronic
1174598867 20:51707875-51707897 TGTATTTTAGAGATGGAGTCTGG + Intronic
1176445751 21:6818866-6818888 TGAATATCCCAGATGGAGGCTGG - Intergenic
1176823919 21:13683899-13683921 TGAATATCCCAGATGGAGGCTGG - Intergenic
1177846172 21:26289869-26289891 TGAATTTCACAGATTGAGTCTGG + Intergenic
1178862415 21:36300391-36300413 TTTATTTTTGAGATGGAGTCTGG + Intergenic
1179006244 21:37517903-37517925 TTAATTTTAGAGACGGTGTCTGG + Intergenic
1180242838 21:46523244-46523266 TTATTTTTTGAGATGGAGTCTGG + Intronic
1182254177 22:29026308-29026330 GGAATTTTAGTGATGGGGTCTGG - Intronic
1184151410 22:42641495-42641517 TGTTTTTTTGAGATGGAGTCTGG + Intronic
949658310 3:6247438-6247460 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
950378233 3:12589800-12589822 TTTTTTTTTCAGATGGAGTCTGG + Intronic
950775577 3:15347108-15347130 TGAATTTTGCACATGTATTCAGG + Intergenic
951708927 3:25570361-25570383 TGGATTTCACAGATGGATTGGGG - Intronic
952188975 3:31001906-31001928 TGAATCTTACAAAGGGTGTCAGG + Intergenic
952208981 3:31210133-31210155 TTAAACTTACAGATGGATTCAGG + Intergenic
953617462 3:44504108-44504130 TTATTTTTATAGATGGAGTGAGG - Intronic
953827052 3:46262666-46262688 TTATTTTTTGAGATGGAGTCTGG + Intronic
953840413 3:46385750-46385772 TTTATTTTTTAGATGGAGTCTGG + Intergenic
954611473 3:51946737-51946759 TTATTTTTTCAGATGGAGTCTGG - Intronic
957920393 3:86740533-86740555 TAAATTATACTGATGGAGTGAGG + Intergenic
959295218 3:104527227-104527249 TTAATTTTACAAAGGCAGTCTGG - Intergenic
959332204 3:105020793-105020815 TTTATTTTTGAGATGGAGTCTGG + Intergenic
959432371 3:106270720-106270742 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
959836304 3:110922502-110922524 TTATTTTTTGAGATGGAGTCTGG + Intergenic
961147100 3:124603400-124603422 TGAATTTTAAGGAAGGATTCAGG - Intronic
961979867 3:131065703-131065725 TGAAGTTTATAGTTAGAGTCAGG - Intronic
962103753 3:132369553-132369575 TGAGACTAACAGATGGAGTCGGG - Intergenic
962360667 3:134740307-134740329 TTTATTTTTGAGATGGAGTCTGG + Intronic
963745976 3:149125510-149125532 TCAATGTTAGAGGTGGAGTCTGG + Intergenic
965992200 3:174832471-174832493 TGTTTTTTTGAGATGGAGTCTGG + Intronic
967635993 3:191804006-191804028 TAATTTTTACATATGGTGTCAGG - Intergenic
967781196 3:193441680-193441702 TGACTTTTACAGATAGATCCTGG - Intronic
969427904 4:7136644-7136666 AGAATCTTACAGGTGGAGGCGGG - Intergenic
970021509 4:11574519-11574541 TGAGTTTCAGAGATGGAGTCAGG + Intergenic
970947733 4:21715090-21715112 TTTATTTTTGAGATGGAGTCTGG + Intronic
971294330 4:25376073-25376095 TATATTTTAGAGACGGAGTCTGG + Intergenic
971320309 4:25600185-25600207 TATATTTTTGAGATGGAGTCTGG - Intergenic
971992553 4:33918507-33918529 TGAATTTTAAAGATGTATACGGG + Intergenic
972100636 4:35410281-35410303 TTAATTCTACAGATGGAGTTGGG - Intergenic
972499865 4:39667734-39667756 AGAATTTTAGGGAAGGAGTCAGG - Intergenic
974577507 4:63746095-63746117 TGTTTTTTAGAGATGGAGCCTGG - Intergenic
975112565 4:70643577-70643599 TGAATTTTACCCATGGAGCCCGG + Exonic
976378497 4:84373058-84373080 TGAGTATTACAGAGGGAGTCAGG + Intergenic
977394728 4:96455822-96455844 TCCATTTCACAGATGAAGTCTGG - Intergenic
979805092 4:124961132-124961154 TGATTTTTCCAGATGGATGCTGG + Intergenic
980464725 4:133157946-133157968 AGAATTTCACACATGGAGCCAGG - Intronic
980636786 4:135515974-135515996 TGTTTTTTTGAGATGGAGTCTGG - Intergenic
982589896 4:157295027-157295049 TGAATTTTAATGATGGGTTCTGG - Intronic
982737348 4:159020106-159020128 TTTTTTTTAAAGATGGAGTCTGG - Intronic
983155805 4:164346977-164346999 TGAATTTTAAAAATCTAGTCTGG - Intronic
984736274 4:183111226-183111248 TTATTTTTTGAGATGGAGTCTGG - Intronic
984968157 4:185159340-185159362 TGTATTTTTGAGATGGAGTCTGG - Intergenic
985318769 4:188685929-188685951 TGAATTTTAAAAATCGAATCAGG + Intergenic
986027705 5:3866059-3866081 TTTATTTTTGAGATGGAGTCTGG + Intergenic
986491532 5:8296116-8296138 TGAATTTGTCACATGGAGGCTGG + Intergenic
987863831 5:23516382-23516404 TTATTTTTTTAGATGGAGTCTGG + Intronic
988113960 5:26858886-26858908 TAAATTTTACAGATGAAATAAGG - Intergenic
988312582 5:29580452-29580474 TTATTTTTTGAGATGGAGTCTGG + Intergenic
988500715 5:31781400-31781422 TGCTTTTTTGAGATGGAGTCTGG - Intronic
988689131 5:33554767-33554789 TGAATTTTACAGATTGTCTATGG - Intronic
988716336 5:33832260-33832282 TGAATCTCACACAAGGAGTCAGG - Intronic
988737551 5:34037943-34037965 TGAATTTTAAGGATGGAGAAGGG + Intronic
989059530 5:37396814-37396836 TGTTTTTTGGAGATGGAGTCTGG - Intronic
989319973 5:40122607-40122629 TGCATTTTATAGAGGGAGTTGGG + Intergenic
989342037 5:40387056-40387078 TGATTTTTACAGATGGGGTCAGG + Intergenic
989459783 5:41683991-41684013 TGAATTAGTCAGATGTAGTCAGG - Intergenic
989760651 5:45012110-45012132 TGAGTTTTACAGAGGCATTCTGG + Intergenic
991327170 5:65447262-65447284 TTAAATTTTCAGATGAAGTCAGG - Intronic
992276710 5:75128514-75128536 TTTATTTTTGAGATGGAGTCTGG + Intronic
992823166 5:80518879-80518901 TGAATTTTGGAGATGGATACTGG - Intronic
992868343 5:80980628-80980650 TTATTTTTTGAGATGGAGTCTGG - Intronic
995099878 5:108287096-108287118 TGATTTTTATAGATGGTGTAAGG - Intronic
995510133 5:112900847-112900869 TTTTTTTTAGAGATGGAGTCTGG + Intronic
995950545 5:117707340-117707362 TGAATATTCCAGATGGTGCCTGG - Intergenic
996841679 5:127853388-127853410 TGAATTTAGCAAATGTAGTCAGG - Intergenic
997181814 5:131837036-131837058 TGATTTTTACACATGGTGTAAGG + Intronic
997877568 5:137563075-137563097 TGTGTTTTACAGATAGGGTCTGG - Intronic
997935607 5:138108216-138108238 TGTTTTTTTGAGATGGAGTCTGG + Intergenic
997961800 5:138327623-138327645 TTTATTTTTGAGATGGAGTCTGG - Intronic
998233696 5:140379653-140379675 TATATTTTTGAGATGGAGTCTGG + Intergenic
998393295 5:141801715-141801737 TTTATTTTTGAGATGGAGTCTGG + Intergenic
998457232 5:142282728-142282750 TGTTTTTTTGAGATGGAGTCTGG - Intergenic
998659347 5:144219222-144219244 TTATTTTTTGAGATGGAGTCTGG + Intronic
998692238 5:144599411-144599433 TTTTTTTTACAGATGGAGTCTGG + Intergenic
999564231 5:152839227-152839249 AGAAGTTTACTGATGGTGTCAGG + Intergenic
999860634 5:155641939-155641961 TGAGTTTTACAGATGAAATGGGG + Intergenic
1000981862 5:167824877-167824899 TGCATGTTTCAGATGGAGTCTGG + Intronic
1001721330 5:173859524-173859546 TGAAGATTGCAGCTGGAGTCAGG - Intergenic
1002572118 5:180146152-180146174 TGTTTTTTTGAGATGGAGTCTGG + Intronic
1003878268 6:10457336-10457358 TAAATTTTAGAGATAGGGTCTGG - Intergenic
1003998680 6:11571195-11571217 TCCATTTTAGAGATAGAGTCTGG + Intronic
1004134498 6:12953309-12953331 TTTATTTTTGAGATGGAGTCTGG - Intronic
1004214196 6:13686295-13686317 TTATTTTTTGAGATGGAGTCTGG + Intronic
1004224066 6:13770227-13770249 TTTTTTTTAGAGATGGAGTCTGG + Intergenic
1004651954 6:17618575-17618597 TTTTTTTTAAAGATGGAGTCTGG + Intronic
1004704770 6:18114218-18114240 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1004931534 6:20467343-20467365 TGACGTTTATAGGTGGAGTCAGG + Intronic
1005429978 6:25745885-25745907 TGAACTTTACAGATGAAATATGG - Intergenic
1008188408 6:48423426-48423448 TTTATTTTTGAGATGGAGTCTGG - Intergenic
1009320240 6:62279080-62279102 TTATTTTTTGAGATGGAGTCTGG - Intronic
1009332084 6:62436048-62436070 TGAGTTTTATAGATGGTGTAAGG + Intergenic
1009478694 6:64128279-64128301 TGTATTTTAAAGATGCAGTTAGG - Intronic
1009756182 6:67942955-67942977 TTTATTTTGGAGATGGAGTCTGG + Intergenic
1010448321 6:75974039-75974061 TGAATGTTAGAGATGCAGCCTGG + Intronic
1011143351 6:84185096-84185118 TGAATCTTACAAATGGAATGTGG + Intronic
1012609998 6:101205571-101205593 TGAAATTTTCAGAAGGAGTTGGG + Intergenic
1012810944 6:103957081-103957103 TCATTTTTTGAGATGGAGTCTGG - Intergenic
1013065642 6:106682501-106682523 AAAATTGTAAAGATGGAGTCTGG + Intergenic
1013310943 6:108893313-108893335 TTAATTTTAAAAATGGAATCAGG + Intronic
1013378237 6:109540202-109540224 TGGAGTCTACAGATGCAGTCAGG + Intronic
1013398774 6:109770782-109770804 ACAATTTTGGAGATGGAGTCTGG - Intronic
1013507973 6:110818020-110818042 TGAATATTACAGATTAAGACAGG + Intronic
1013755723 6:113459310-113459332 TCATTTTTTGAGATGGAGTCTGG - Intergenic
1014324138 6:119969967-119969989 TGACTTTTATATATGGAGTGAGG - Intergenic
1014673387 6:124334763-124334785 TTAATTTTACAAAGGCAGTCTGG + Intronic
1014875374 6:126652730-126652752 TGTATTTTTGAGATGGAGTCTGG + Intergenic
1015130261 6:129801727-129801749 TGAACTTTATAGATGGACTATGG + Intergenic
1015603562 6:134933718-134933740 TTTATTTTTGAGATGGAGTCTGG + Intronic
1015603687 6:134934769-134934791 TTTATTTTTGAGATGGAGTCTGG - Intronic
1016093385 6:140006520-140006542 AGAATTTTTCAGATGGAATCAGG + Intergenic
1016423302 6:143907944-143907966 TGATTTTTGCAGATGGTGTAAGG + Intronic
1017501210 6:155025036-155025058 TTATTTTTAGAGACGGAGTCTGG + Intronic
1018403914 6:163456903-163456925 TGAATTTTAAAGATAAAGTCTGG - Intronic
1018453343 6:163929538-163929560 TCAAGTTTACAGATTTAGTCAGG + Intergenic
1018971766 6:168534980-168535002 TTTATTTTTGAGATGGAGTCTGG + Intronic
1019500791 7:1363798-1363820 TTTATTTTCGAGATGGAGTCAGG - Intergenic
1021083674 7:16393558-16393580 TGGAGTTTACAGATTGAGTAGGG - Intronic
1021559207 7:21952642-21952664 TCAATTTTAAAAATGGAGCCTGG + Intergenic
1023932187 7:44712708-44712730 TGATTTTTGGAGATGGAGTCTGG + Intergenic
1024356903 7:48422883-48422905 TGAGCTTTAAAGATGGAGGCTGG + Intronic
1024723993 7:52171347-52171369 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1024897407 7:54276004-54276026 TAAATATTACAGATGGGCTCTGG + Intergenic
1026186746 7:68087889-68087911 TTAATTTTTGAGATGGAGTCTGG + Intergenic
1026282775 7:68936404-68936426 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1026311585 7:69190450-69190472 GGACTTTGACAGGTGGAGTCTGG - Intergenic
1026389439 7:69885415-69885437 TGAATTTTTCAGAAGGAGTTCGG + Intronic
1027035851 7:74924706-74924728 TGTATTTGTGAGATGGAGTCTGG - Intergenic
1027744655 7:82057944-82057966 TGATTCTTAAAGATGGAGACTGG - Intronic
1028003080 7:85526046-85526068 TCAATTTTACAGATTGAGAAAGG + Intergenic
1028528983 7:91817273-91817295 TGCATTTTTCAGATTGAGTGAGG - Intronic
1029094933 7:98077534-98077556 TTTATTTTTGAGATGGAGTCTGG - Intergenic
1029333628 7:99881246-99881268 TGAATTTGGCTGATGCAGTCAGG + Intronic
1029633033 7:101765062-101765084 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1029894639 7:103970152-103970174 TTTTTTTTAGAGATGGAGTCTGG + Intronic
1030520200 7:110589050-110589072 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1032809923 7:135402533-135402555 AGAATTTTCATGATGGAGTCTGG - Intronic
1033134698 7:138774567-138774589 TTTATTTTTGAGATGGAGTCTGG - Intronic
1033309761 7:140252514-140252536 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1033656602 7:143379752-143379774 TGACGTTTACAGATGGAGCAGGG + Intergenic
1033974182 7:147079436-147079458 TGTATTATAAAGAAGGAGTCAGG - Intronic
1033974197 7:147079661-147079683 TGTATTATAAAGAAGGAGTCAGG - Intronic
1036044707 8:5126877-5126899 AGTCCTTTACAGATGGAGTCAGG + Intergenic
1036138877 8:6188031-6188053 AGATTTTCACATATGGAGTCAGG - Intergenic
1036282477 8:7413366-7413388 TCTATTTCACAGATGCAGTCAGG + Intergenic
1036338994 8:7898183-7898205 TCTATTTCACAGATGCAGTCAGG - Intergenic
1036577641 8:10043138-10043160 TGTTTTTTGGAGATGGAGTCTGG - Intergenic
1037557617 8:20040925-20040947 TGAAGTCTACAGATGCAGGCAGG + Intergenic
1037600868 8:20392631-20392653 TAAATTTTTGAGACGGAGTCTGG + Intergenic
1037656780 8:20890672-20890694 TGAATAACACAGATGTAGTCTGG - Intergenic
1039612392 8:38930211-38930233 TTTATTTTTGAGATGGAGTCTGG + Intronic
1039635404 8:39159321-39159343 TGGTTTTTACAGATTGACTCTGG + Intronic
1041641692 8:60209471-60209493 TGTTTTTTGGAGATGGAGTCTGG - Intronic
1041928612 8:63264212-63264234 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1043009282 8:74861739-74861761 TTAATTTTACCTAAGGAGTCAGG + Intergenic
1044297854 8:90549120-90549142 TGATCTTTACAGATGTAGTTAGG + Intergenic
1044735992 8:95278265-95278287 TGAATTTTACAGTTAGACCCAGG - Intergenic
1044833204 8:96270165-96270187 TGCATTTTACTGATAGGGTCTGG - Intronic
1045342036 8:101263669-101263691 TAAATTGTAAAGAAGGAGTCAGG + Intergenic
1045444840 8:102250103-102250125 TTTTTTTTCCAGATGGAGTCTGG + Intergenic
1048931574 8:139319468-139319490 TGAACTTTACTGATGGTGTTGGG + Intergenic
1049627255 8:143630500-143630522 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050600169 9:7242643-7242665 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
1050789764 9:9452398-9452420 TGAATTTTACACATTCAGTCTGG - Intronic
1052929246 9:34042781-34042803 TTAATTTTACATATGGGGCCAGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055374633 9:75635803-75635825 TGAATTTTACAATTGGACTTAGG - Intergenic
1055459849 9:76509381-76509403 TGTATTTTAAATATGGAGACAGG + Intergenic
1057504444 9:95621191-95621213 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1059195035 9:112363181-112363203 ATAATTTTTGAGATGGAGTCAGG + Intergenic
1059458047 9:114412152-114412174 TGGATTCAGCAGATGGAGTCTGG - Intronic
1059860876 9:118460049-118460071 TGAATCTTACAGATGAATCCTGG + Intergenic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1061186249 9:129055835-129055857 TTTTTTTTTCAGATGGAGTCTGG - Intronic
1061976572 9:134070997-134071019 TGAGGTTTGCAGATGGAGGCTGG - Intergenic
1062094141 9:134694421-134694443 TGAATAGAACAGATGGAGCCCGG + Intronic
1203523442 Un_GL000213v1:65659-65681 TGAATATCCCAGATGGAGGCTGG + Intergenic
1185743356 X:2551816-2551838 TTCTTTTTTCAGATGGAGTCTGG + Intergenic
1186427553 X:9475264-9475286 TGTTTTTTTGAGATGGAGTCTGG + Intronic
1187399321 X:18945941-18945963 TTATTTTTTGAGATGGAGTCTGG + Intronic
1189087055 X:38036292-38036314 TTATTTTTTGAGATGGAGTCTGG - Intronic
1189182155 X:39014835-39014857 TGAATGTTAAAGATGGAGCATGG + Intergenic
1190515335 X:51218101-51218123 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1192089523 X:68138934-68138956 TTAATTTTACAGATTAAGCCAGG - Intronic
1192903029 X:75521016-75521038 AGAAAATTACAAATGGAGTCAGG + Intronic
1193130505 X:77914823-77914845 TTTATTTTTGAGATGGAGTCTGG + Intronic
1193749866 X:85328214-85328236 TTATTTTTTGAGATGGAGTCTGG + Intronic
1193984074 X:88219095-88219117 TGCATTGTATTGATGGAGTCAGG + Intergenic
1195151642 X:102077193-102077215 TGAATTTTTCAAAGGGAGTTGGG - Intergenic
1195587211 X:106578741-106578763 TGGAGTCTACAGATGGAGGCAGG + Intergenic
1196192874 X:112812825-112812847 AGAATTTTGGAGATGGAGGCGGG - Intronic
1196271590 X:113718224-113718246 TGAATTTTATATATGGTGTGAGG + Intergenic
1196388568 X:115186547-115186569 TGACTTTTACAGATCGTGACAGG + Intronic
1196423991 X:115551442-115551464 TTTATTTTTGAGATGGAGTCTGG + Intergenic
1196893373 X:120310770-120310792 TGAAATTTAGAGATGCAGTTGGG - Intronic
1197742128 X:129903228-129903250 TGAGTTTTAAAGCTGGACTCTGG - Intergenic
1198274445 X:135087954-135087976 TGGTTGTTACAGATGGATTCTGG + Intergenic
1198800359 X:140441313-140441335 TGAAGTTTACTGAGGGAATCAGG + Intergenic
1199550976 X:149061044-149061066 TGAGTTTTCCTGATGGAGACAGG - Intergenic
1199682693 X:150238643-150238665 TGACTTTGACAGATGGCCTCTGG - Intergenic
1200054660 X:153453746-153453768 TGATTTTTGCATATGGAGTGAGG - Intronic
1200240914 X:154493145-154493167 TGAATTTTACTGACAGTGTCAGG - Intergenic
1200738781 Y:6830823-6830845 TGTTTTTTTGAGATGGAGTCTGG + Intergenic
1201144379 Y:11055460-11055482 TGGATTATACTGATGGATTCAGG + Intergenic
1201322416 Y:12714748-12714770 TAGATTTAACAGATGGAGGCCGG - Intronic
1201391375 Y:13501157-13501179 TTAATTTTCCTGTTGGAGTCTGG - Intergenic
1201948722 Y:19540291-19540313 TTGTTTTTTCAGATGGAGTCTGG - Intergenic
1201951805 Y:19573503-19573525 TTAATCTTAAAGATGGAGGCAGG + Intergenic