ID: 916091328

View in Genome Browser
Species Human (GRCh38)
Location 1:161309893-161309915
Sequence TGCCCCAGCTATGGCTCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 12, 3: 41, 4: 280}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916091328_916091344 17 Left 916091328 1:161309893-161309915 CCCCAGGAGCCATAGCTGGGGCA 0: 1
1: 0
2: 12
3: 41
4: 280
Right 916091344 1:161309933-161309955 CATCTGTGGGGTTGAGAAAGTGG 0: 1
1: 0
2: 0
3: 22
4: 228
916091328_916091338 -8 Left 916091328 1:161309893-161309915 CCCCAGGAGCCATAGCTGGGGCA 0: 1
1: 0
2: 12
3: 41
4: 280
Right 916091338 1:161309908-161309930 CTGGGGCAGGGGCAGGGGCCCGG 0: 1
1: 13
2: 209
3: 978
4: 3306
916091328_916091340 4 Left 916091328 1:161309893-161309915 CCCCAGGAGCCATAGCTGGGGCA 0: 1
1: 0
2: 12
3: 41
4: 280
Right 916091340 1:161309920-161309942 CAGGGGCCCGGAGCATCTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 168
916091328_916091346 19 Left 916091328 1:161309893-161309915 CCCCAGGAGCCATAGCTGGGGCA 0: 1
1: 0
2: 12
3: 41
4: 280
Right 916091346 1:161309935-161309957 TCTGTGGGGTTGAGAAAGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 320
916091328_916091345 18 Left 916091328 1:161309893-161309915 CCCCAGGAGCCATAGCTGGGGCA 0: 1
1: 0
2: 12
3: 41
4: 280
Right 916091345 1:161309934-161309956 ATCTGTGGGGTTGAGAAAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 265
916091328_916091339 3 Left 916091328 1:161309893-161309915 CCCCAGGAGCCATAGCTGGGGCA 0: 1
1: 0
2: 12
3: 41
4: 280
Right 916091339 1:161309919-161309941 GCAGGGGCCCGGAGCATCTGTGG 0: 1
1: 0
2: 2
3: 27
4: 245
916091328_916091347 20 Left 916091328 1:161309893-161309915 CCCCAGGAGCCATAGCTGGGGCA 0: 1
1: 0
2: 12
3: 41
4: 280
Right 916091347 1:161309936-161309958 CTGTGGGGTTGAGAAAGTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 337
916091328_916091341 5 Left 916091328 1:161309893-161309915 CCCCAGGAGCCATAGCTGGGGCA 0: 1
1: 0
2: 12
3: 41
4: 280
Right 916091341 1:161309921-161309943 AGGGGCCCGGAGCATCTGTGGGG 0: 1
1: 0
2: 1
3: 22
4: 187
916091328_916091348 26 Left 916091328 1:161309893-161309915 CCCCAGGAGCCATAGCTGGGGCA 0: 1
1: 0
2: 12
3: 41
4: 280
Right 916091348 1:161309942-161309964 GGTTGAGAAAGTGGGGGACCAGG 0: 1
1: 0
2: 0
3: 15
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091328 Original CRISPR TGCCCCAGCTATGGCTCCTG GGG (reversed) Exonic
900951294 1:5859492-5859514 TGCCCCAGCTCCCGCACCTGAGG - Intergenic
900952411 1:5865402-5865424 GGCCCCAGCTCTGCCTCCTGTGG - Intronic
900952426 1:5865452-5865474 GGCCCTAGCTCTGCCTCCTGGGG - Intronic
901019124 1:6247054-6247076 TGCCCCAGGGTTGGCACCTGGGG - Intergenic
901196327 1:7442004-7442026 TACCCCACCTCTGGCTTCTGGGG + Intronic
901367364 1:8764231-8764253 TGCCTCATCTATGACTCTTGGGG + Intronic
902298672 1:15485963-15485985 TGCTCCAGCTCTGGCTGGTGGGG + Exonic
906733869 1:48105697-48105719 TGCACCAGCTATCTCCCCTGTGG + Intergenic
912834791 1:112986526-112986548 TGCCCCAGCTGTGGTTCAAGTGG - Intergenic
916091328 1:161309893-161309915 TGCCCCAGCTATGGCTCCTGGGG - Exonic
916434631 1:164766478-164766500 TGCCCTAGGAAGGGCTCCTGAGG + Intronic
916870982 1:168914315-168914337 TGCCCCAGCAGTGGGTGCTGAGG - Intergenic
918040311 1:180910284-180910306 TTACCCAGCTGTGGATCCTGGGG + Intergenic
918320054 1:183355688-183355710 AGCCCCAGCCTGGGCTCCTGTGG + Intronic
919803645 1:201368093-201368115 TGCCTCAGGAATGGCTCCAGGGG + Intronic
919903178 1:202058796-202058818 TGCCTCACCTCTGGCCCCTGAGG - Intergenic
919952336 1:202376868-202376890 TGTCCAACCTATGGCCCCTGAGG + Intronic
920831592 1:209470410-209470432 TGCCCCAAGTGTGGCTCCAGGGG - Intergenic
920933873 1:210412933-210412955 TGCCCCAAGGGTGGCTCCTGTGG - Intronic
921073685 1:211683218-211683240 TGCCCCAGCATTTCCTCCTGTGG - Intergenic
921356798 1:214292223-214292245 AGACTCAGATATGGCTCCTGAGG - Intronic
921466337 1:215492579-215492601 AGCTCCAGCTATGGCTTCAGAGG + Intergenic
921939888 1:220828423-220828445 TGCCTCAGCTGTGGCTCCACTGG + Intergenic
922997074 1:229972802-229972824 TGTCTCAGCAATGGCTTCTGAGG - Intergenic
924002227 1:239567219-239567241 TGTCCCAGCTATGGAGGCTGAGG + Intronic
1062905251 10:1175508-1175530 TGGCCCAGAAGTGGCTCCTGGGG - Intergenic
1066563251 10:36692538-36692560 TGGCCCAGCTCCGGCTCCGGAGG + Intergenic
1068532875 10:58209222-58209244 TGCCCCAGCTATGTCTACAGTGG + Intronic
1069698315 10:70404172-70404194 TGCCGCTGCTGTTGCTCCTGAGG + Intergenic
1071098637 10:82009792-82009814 AGCCCCAGCCATGCCTCCTTTGG + Intronic
1071508020 10:86244608-86244630 AGCCCCACCTCTGGCTCCAGCGG + Intronic
1071951644 10:90709923-90709945 TGCCCTTGCCATGGCTCCTCAGG - Intergenic
1071969878 10:90893324-90893346 TGGCCCAGCTGTGACTACTGGGG - Intronic
1074349750 10:112724650-112724672 TGCCCCAGCTCTGGGGTCTGAGG - Intronic
1074696264 10:116052310-116052332 TGACCCAGCTCTGACTGCTGGGG - Intergenic
1074774503 10:116757162-116757184 TCCCCCAGCTAAGCCTACTGTGG - Intergenic
1075389561 10:122082937-122082959 TGCCGCCGCGATGTCTCCTGGGG - Exonic
1075848068 10:125562911-125562933 TGCCCCAGCTAGGGGAGCTGTGG + Intergenic
1076217039 10:128703506-128703528 CACCCCAGCCATGGCTTCTGGGG - Intergenic
1076538578 10:131198952-131198974 CGCCCCAGCTGTGGCTCAAGTGG - Intronic
1076996258 11:298861-298883 GGCCCCAGCTATGGACCCGGGGG + Intronic
1077258058 11:1598006-1598028 TGCACCAGCTGTGGCTCCTGTGG - Exonic
1077259451 11:1608072-1608094 TCCTCCAGCTGTGGCTCCTGTGG - Exonic
1077259487 11:1608204-1608226 TGCTCCAGCTGTGGCTCCTGTGG - Exonic
1077261200 11:1621870-1621892 TGCTCCAGCTGTGGCTCCTGTGG - Exonic
1077274466 11:1697384-1697406 TGCACCAGCTGTGGCTCTTGTGG + Exonic
1077331746 11:1987015-1987037 TGCCCCCGCCCTGGCTCCCGAGG - Intergenic
1077400230 11:2351996-2352018 TGCCTCAGCTATGGCTCACATGG - Intergenic
1077636630 11:3846227-3846249 TGCCTCTGCTGTGGCTCCAGGGG + Intergenic
1078144372 11:8712960-8712982 TGCCCCAGCTCAGTCTCCAGAGG - Intronic
1078907116 11:15697854-15697876 TGCCACAGCTAAGGCTCCTGGGG + Intergenic
1079027429 11:16960334-16960356 TGGCCCAGCTCAGGCTTCTGGGG - Intronic
1080768457 11:35318265-35318287 TACCCCAGCAAGGGCTCCTTTGG - Intronic
1083226056 11:61285598-61285620 TGCCCCTCCCATGGCTCCTCGGG + Intronic
1083773165 11:64879365-64879387 TGCCCCAGCTATAGCCTTTGTGG - Intronic
1084798785 11:71527460-71527482 TGCTCCAGCTGTGGCTCCTGTGG + Exonic
1084800116 11:71538194-71538216 TGCTCCAGCTGTGGCTCCTGTGG + Exonic
1084803889 11:71565768-71565790 TGCTCCAGCTGTGGCTCCTGTGG + Exonic
1084806477 11:71582656-71582678 TGCTCCAGCTGTGGCTCCTGTGG - Exonic
1084951427 11:72668267-72668289 TGCCCCAGGTCTGGCTCCACTGG + Intronic
1089766553 11:120771759-120771781 TGCCCCAGGTGTGGCTCCAGTGG + Intronic
1091125385 11:133091108-133091130 TTCCCCAGCTGTGGCTCAAGTGG + Intronic
1091296310 11:134476191-134476213 AGCACCAGCTCTGGCTGCTGTGG + Intergenic
1202814727 11_KI270721v1_random:42191-42213 TGCCCCCGCCCTGGCTCCCGAGG - Intergenic
1091466850 12:692252-692274 TGGCCCAGCTGTGCCTCCTGGGG - Intergenic
1091659880 12:2375417-2375439 TGGCCCACCTTCGGCTCCTGTGG + Intronic
1092634773 12:10431864-10431886 TGTCCCATCTTTGGCTTCTGTGG - Intronic
1094090494 12:26644234-26644256 TGCCCCAGGTATGGCTCCAGTGG + Intronic
1094874072 12:34621129-34621151 AGTCACAGCTATGGCTGCTGTGG - Intergenic
1095929866 12:47614493-47614515 TGCCCCAGCTGTGGCTCAGAGGG - Intergenic
1095954524 12:47798591-47798613 TGCCGCAGCTCTTGTTCCTGGGG + Exonic
1096409336 12:51365717-51365739 TTCCCCAGCTCCGGCTTCTGTGG - Intronic
1096771479 12:53938629-53938651 TGCCCCGGCCAGGTCTCCTGGGG - Intergenic
1096973431 12:55684994-55685016 TTCCCCAGAGATGGCTCCTTGGG - Exonic
1100024985 12:90117118-90117140 CTCCCCAGCCATGTCTCCTGTGG + Intergenic
1100932996 12:99632136-99632158 TGCCCCAGCCATGGCTTAAGTGG + Intronic
1101158016 12:101945977-101945999 TGCCCCAGCTCTTGCACGTGCGG + Intronic
1102001086 12:109558509-109558531 TGCCCCAGCCCTGGCTTCTGTGG - Intronic
1103829776 12:123769514-123769536 TGCCACAGCAATGTCTGCTGAGG + Intronic
1104210267 12:126682232-126682254 TGTACCAGCTCTGTCTCCTGAGG + Intergenic
1104962159 12:132493497-132493519 GGCCCCAGCCCTGGCCCCTGGGG + Intronic
1106459833 13:29959172-29959194 TGCCCCAGATCTGGCTCTTATGG - Intergenic
1106734203 13:32572414-32572436 TTCCCCTGCTATGGTTTCTGGGG + Intergenic
1107857508 13:44630653-44630675 TGCCCCAACCATGGCTCAAGTGG + Intergenic
1110369849 13:74727705-74727727 TCCCACAGCTATGGATCCTGAGG + Intergenic
1110516005 13:76413178-76413200 AGCCCCAGCTATGGCCTCTCTGG + Intergenic
1113450099 13:110402954-110402976 TGCCCCAGCTGTGGCTCCAGTGG - Intronic
1113885419 13:113656301-113656323 TTCCCCCGCTGTGGGTCCTGTGG + Intronic
1114254495 14:20989992-20990014 TGCCGCCGCCATGGCTCCGGAGG - Exonic
1115541248 14:34423592-34423614 AACCCCAGCCATGGCTCCCGGGG + Intronic
1119561018 14:75589837-75589859 TACCCCAGCCATGGCTCAAGTGG - Intronic
1120292206 14:82589948-82589970 TGCACCAGCTATTGCTCAGGTGG + Intergenic
1121315980 14:92961252-92961274 GGCCCCAGGTGTGGCTCCTGAGG + Intronic
1121717872 14:96089061-96089083 TGCCCCATCTTGGTCTCCTGTGG + Exonic
1122900552 14:104780599-104780621 GGCCCCAGCTATGGCCACAGGGG + Intronic
1122900824 14:104781682-104781704 TGCCCAAGCCAGGGCTGCTGGGG + Intronic
1122938895 14:104972500-104972522 GGCCCCAGCAAAGGCTCTTGCGG - Intronic
1123215965 14:106809714-106809736 GGCTCTGGCTATGGCTCCTGTGG - Intergenic
1124006393 15:25798533-25798555 TGACCCTGCAATAGCTCCTGGGG + Intronic
1125887194 15:43237918-43237940 TGCCCCAGAAATGGATCCTGAGG - Intronic
1127213948 15:56804185-56804207 TGCCCCAGTTCTGGCTCTTTTGG - Intronic
1127691167 15:61399112-61399134 TTCCCCAGGTTTTGCTCCTGCGG + Intergenic
1129670775 15:77606569-77606591 AGCCCCAGCTCTGGGTGCTGCGG + Intergenic
1130434439 15:83883678-83883700 AGTCCCAGCTATAGCTACTGGGG - Intronic
1131996617 15:98139164-98139186 TGCACAAGCAGTGGCTCCTGAGG - Intergenic
1132655066 16:1038404-1038426 TGCTCCAGCCCTGGCTCCTGGGG + Intergenic
1132783731 16:1642741-1642763 TGCCCCAAGTATGGATCCTGCGG - Intronic
1134247689 16:12552234-12552256 TGCCCCAGCTTTGCCTCCTAGGG + Intronic
1135254146 16:20927121-20927143 TGCCCCAGCCATGGCTCAAATGG - Intergenic
1135935348 16:26775110-26775132 TGCCCTAGGGTTGGCTCCTGGGG + Intergenic
1137008591 16:35301272-35301294 TGCCCCAGCTTTGGATTCAGAGG + Intergenic
1139199758 16:64962454-64962476 TACCCCAGCACTGGTTCCTGAGG - Intronic
1139820615 16:69718282-69718304 TGGCCCAGCTTTGGCCCCTCTGG - Intronic
1140665720 16:77225436-77225458 TGGCCCTGCTAGGGCTCCAGGGG - Intergenic
1141019596 16:80482886-80482908 TCCTCCACCTATGTCTCCTGAGG + Intergenic
1141162501 16:81638732-81638754 TGCCCCAGTTCAGCCTCCTGTGG + Intronic
1141326613 16:83065832-83065854 TTCCCCAGCTGTGTGTCCTGTGG - Intronic
1141557489 16:84845691-84845713 CGCCCCAGCCTGGGCTCCTGTGG - Intronic
1141624140 16:85252634-85252656 GGCCCCAGCTGTGGCTTCAGGGG + Intergenic
1141660838 16:85440712-85440734 TGCCCCCGTGATGGTTCCTGGGG - Intergenic
1141774243 16:86111552-86111574 TGCCCCAGCTATGGTACCCAGGG - Intergenic
1141997696 16:87645748-87645770 TGCCCAGGGTCTGGCTCCTGTGG + Intronic
1142056743 16:88002405-88002427 TGGCCCTGCGCTGGCTCCTGGGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143994601 17:10995828-10995850 CGTCCCAGCTGTGGCTGCTGTGG - Intergenic
1146464295 17:33074099-33074121 TGCCTCAGTTAGGGCTCCTGGGG - Intronic
1146476774 17:33169131-33169153 TGCCCCAGCTATGGCTCAAGTGG + Intronic
1147433413 17:40389587-40389609 TGACTCAGCTGTGGCTCCTCGGG - Exonic
1148224126 17:45886363-45886385 TGCCCCAGTTGTGCCTCCTCAGG + Intergenic
1148734845 17:49859502-49859524 TGCCCAAGCTACAGCTTCTGTGG - Intergenic
1149492777 17:57097045-57097067 TGCTGCGACTATGGCTCCTGTGG + Intronic
1150005700 17:61467679-61467701 TGCCCCAGACTTGCCTCCTGGGG - Intronic
1151383985 17:73744084-73744106 TCACCCACCTGTGGCTCCTGGGG + Intergenic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1152618790 17:81350516-81350538 TGCCCAAGCAAGTGCTCCTGCGG - Intergenic
1154940974 18:21112104-21112126 TGCCCCAGCTCTGTTTCCTCTGG + Intergenic
1155341915 18:24821761-24821783 TTCCAGAGCTATGGCTGCTGTGG - Intergenic
1155591158 18:27428812-27428834 TGCCTCAGCTATGACACCAGAGG - Intergenic
1155631183 18:27895457-27895479 TGCTCCAGCTAAGGTTGCTGAGG - Intergenic
1156490917 18:37495526-37495548 TGCCCCATCTGAGGCTCCAGTGG + Intronic
1157477930 18:48035364-48035386 TGCCCCAGCCATGCCTGATGGGG - Intronic
1160047623 18:75401244-75401266 TGCCCCAGCTTTGGTACCTGAGG - Intergenic
1160943903 19:1632372-1632394 CGGCCCAGCTCAGGCTCCTGGGG - Exonic
1161479569 19:4503783-4503805 AGCCCCAGCTGTGGCTGCTGTGG + Exonic
1161992835 19:7694723-7694745 TGCCCCAGTTAGGGCAGCTGGGG + Intronic
1164591598 19:29510651-29510673 AGCCCCAGCTGTGGCTCCCTGGG - Intergenic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1165020898 19:32923105-32923127 GGCCCCAGCGATGGCTCCCAGGG - Intronic
1165152811 19:33770959-33770981 TGCCCCAGTTCTGGCCACTGTGG - Intronic
1165397429 19:35573033-35573055 AGTCACAGCTATGGCTGCTGTGG - Intergenic
1166736893 19:45091192-45091214 TGCCCCACCTGTGGTTGCTGTGG + Exonic
1166830157 19:45634457-45634479 GGCTCCAGCTATGGCTACCGTGG - Exonic
1167455517 19:49595387-49595409 TGCCCCAGCCGTGGCTCCGCTGG - Exonic
1168467779 19:56618173-56618195 CCCCCGAGCTGTGGCTCCTGAGG - Intronic
1168712875 19:58511842-58511864 TGACCCTGCGCTGGCTCCTGGGG - Exonic
925388113 2:3477073-3477095 TGCCCCAGCCCTGACTCCTGAGG - Intronic
925401157 2:3574403-3574425 TTCCCCAGCAATAGATCCTGCGG + Intergenic
925871913 2:8278964-8278986 TGCCCCAACTCTGCCTCCTGGGG + Intergenic
927519251 2:23689254-23689276 AGCCACAGCCATGCCTCCTGTGG + Intronic
928314934 2:30237700-30237722 AGCCCCAGCTACTGGTCCTGGGG + Intronic
928460428 2:31467386-31467408 AGCCGCAGCCATGGCTTCTGGGG - Intergenic
929699617 2:44150750-44150772 TGCCCCAGCTACGGCTCAAGTGG + Intergenic
934569487 2:95359822-95359844 TGCCCCAGCTGTGGCTCAAGTGG - Intronic
936270262 2:111043604-111043626 AGCCTCAGATATGGCTGCTGGGG + Intronic
936879363 2:117231891-117231913 AGCCCCAGCTATGTCTGCAGTGG + Intergenic
937132564 2:119524338-119524360 TGGCTCAGCCATGGCTCCTCGGG - Exonic
937720016 2:125083183-125083205 TGTCCCAACTCTGGCACCTGAGG + Intergenic
940372408 2:152918052-152918074 TGCCCCACATGTGGCTCCAGTGG + Intergenic
942303228 2:174582493-174582515 TTCCCCAGCTTTTCCTCCTGTGG - Intronic
944379598 2:199092615-199092637 GGCCCCAGCTGTGGCTCAAGTGG - Intergenic
947047567 2:226005477-226005499 TACCCTAGCTATGGCTCAAGTGG - Intergenic
949052394 2:241904112-241904134 AGCCCCAGATATGGCTCCAGAGG - Intergenic
1170750589 20:19141180-19141202 TTACGCAGCTGTGGCTCCTGTGG - Intergenic
1172304129 20:33869685-33869707 TGCCCCAGAAATGGTGCCTGAGG + Intergenic
1172443956 20:34983632-34983654 TCCTGCAGCCATGGCTCCTGCGG - Intronic
1172607261 20:36222387-36222409 AGCCACAGGTAAGGCTCCTGAGG + Exonic
1172650737 20:36499883-36499905 TGGCCCAGCCATGGCCCCCGTGG - Intronic
1176127998 20:63484479-63484501 GGTCCCAGCTCTGGCACCTGAGG - Intergenic
1176178220 20:63738452-63738474 TTCCCCTGCTGTGGCTCTTGGGG - Exonic
1178621635 21:34182477-34182499 TGCTCCAGCAATGGCTGGTGTGG - Intergenic
1178716412 21:34968405-34968427 TGCCCCACCTGTGGCTCCCCAGG - Intronic
1179187606 21:39096928-39096950 TGCTGCAGCTATGGGCCCTGGGG - Intergenic
1179289483 21:40006135-40006157 TGAGCCAGCTGAGGCTCCTGGGG - Intergenic
1179361522 21:40713953-40713975 TGCCCCAGCCATGGCTCAAGTGG + Intronic
1179444922 21:41424473-41424495 TGCCCCAGCTTTAGGTCCTGGGG - Intronic
1180906856 22:19419665-19419687 AGCCACAGCTCTGGGTCCTGAGG - Intronic
1181364996 22:22369605-22369627 AGCCCCAGCTCTGGCACCAGGGG + Intergenic
1181368061 22:22395009-22395031 AGCCCCAGCTCTGGCGCCAGGGG + Intergenic
1181659217 22:24329614-24329636 TGCCCCAGCTATGGCTCTGATGG + Intronic
1183404994 22:37626038-37626060 TACCCCAGGTGTGGATCCTGTGG + Intronic
1184294616 22:43515648-43515670 GGCCCCGGCTCTGGCTCCTGAGG + Intergenic
1184517028 22:44968907-44968929 TGCTCCAGCTGTGGCCACTGGGG + Intronic
1184650206 22:45916172-45916194 GGCCCCAGCTGTGGCTTCTTTGG + Intergenic
1184650225 22:45916243-45916265 GGCCCCAGCTGTGGCTTCTTTGG + Intergenic
1184650242 22:45916314-45916336 GGCCCCAGCTGTGGCTTCTTTGG + Intergenic
1184650259 22:45916385-45916407 GGCCCCAGCTGTGGCTTCTTTGG + Intergenic
1184650276 22:45916456-45916478 GGCCCCAGCTGTGGCTTCTTTGG + Intergenic
1184855000 22:47142049-47142071 TGCCACAGCTCTGGCCCCTGTGG + Intronic
1185107894 22:48884824-48884846 GGCCCCGGCGATGGCGCCTGTGG + Intergenic
1185145837 22:49136205-49136227 GGGCCCAGCTGTGGCTCATGGGG + Intergenic
950425127 3:12921044-12921066 TGTCTCAGCCATGGCTACTGAGG + Intronic
950437812 3:12991297-12991319 TCGCCCTGCTTTGGCTCCTGCGG - Intronic
950462720 3:13134991-13135013 GGCCCGAGCTCTGCCTCCTGGGG - Intergenic
950467424 3:13163499-13163521 TGCCCCAGCCACGGGGCCTGAGG - Intergenic
950931111 3:16789699-16789721 TGCCCCAGCTGTGGCTCAGATGG - Intergenic
951803660 3:26623614-26623636 CCCCGCAGCTCTGGCTCCTGAGG + Intronic
953282402 3:41571948-41571970 TGCCCCAGCTCGGGCCCGTGTGG - Intronic
954072289 3:48151660-48151682 TGCCCCAGGTTTGTCTCCTCAGG - Intergenic
954453851 3:50586406-50586428 TGCCCCAGCTATGCCTAAAGGGG + Intergenic
954643223 3:52114721-52114743 TGGCCCATCTCTGGCTCCTGGGG - Intronic
954701161 3:52451587-52451609 TGTCCCTGCTCTGCCTCCTGGGG - Intronic
954841507 3:53515682-53515704 TGCCAGAGCTAGGGCTCCTCAGG + Intronic
955301455 3:57783916-57783938 TGCCCTAGCTGTGGCTCAAGTGG + Intronic
956463913 3:69500114-69500136 AGCCACAGCTCTGGGTCCTGGGG - Intronic
960592320 3:119378229-119378251 TGCCCCAGCTGTGGGTTCTGTGG + Intronic
966040291 3:175476698-175476720 TGCCACAGCTTTGTCTGCTGAGG + Intronic
967226076 3:187292405-187292427 TGCCACAGGTATTGCTCATGGGG - Intergenic
967952946 3:194854761-194854783 CTTCCCAGCTATGGCACCTGAGG + Intergenic
968751884 4:2394336-2394358 TGACCCAGCTGTGCCACCTGCGG - Intronic
968794225 4:2691622-2691644 TGTCCCAGCTTTGGCTAGTGAGG - Intronic
969633836 4:8353733-8353755 TGCCCCAGCCATGGGTCCCCTGG - Intergenic
969928004 4:10603504-10603526 TGCCGCAGGTTGGGCTCCTGAGG + Intronic
970361236 4:15310767-15310789 TGCCCCAGCCATGGCTCAAAGGG + Intergenic
971727158 4:30328326-30328348 TGCTCCAGCTATGCCTCATCGGG - Intergenic
972339244 4:38136890-38136912 TTCTCCTGCTATGGCTGCTGTGG - Intronic
972345715 4:38190816-38190838 TGGCCCAGCTGTGGGGCCTGTGG + Intergenic
972348637 4:38214807-38214829 GGACCCAGCCAAGGCTCCTGAGG - Intergenic
974000359 4:56505780-56505802 GGCCCCAGGTGTGGCTCCCGAGG - Intronic
974198702 4:58611186-58611208 TGCCCCAGCTGTGACTCATGTGG + Intergenic
978027594 4:103896698-103896720 AGCCCCAGCTATGTCTGCAGTGG - Intergenic
978547973 4:109893605-109893627 ATCCCCAGCCATGCCTCCTGTGG + Intergenic
980044603 4:127973664-127973686 TGGCAAAGGTATGGCTCCTGTGG + Intronic
981751149 4:148093254-148093276 TGCCCCAGCAATGACTTGTGAGG - Intronic
982442433 4:155452730-155452752 TACCACAGCGATGGCTACTGAGG + Intergenic
982836413 4:160124989-160125011 CGCACCGGCTCTGGCTCCTGAGG + Intergenic
984431863 4:179660832-179660854 TGTCCCAGGTGTGGCTCCAGTGG + Intergenic
985670438 5:1203947-1203969 GTCCCCTCCTATGGCTCCTGGGG + Intronic
986609651 5:9553593-9553615 TGCCCCAGCTGGGGCTCAAGTGG - Intergenic
987113938 5:14712152-14712174 TTCCCCAGCCATGGCAGCTGAGG - Intronic
987476059 5:18393686-18393708 TGCCTCAGGCAAGGCTCCTGAGG - Intergenic
988641917 5:33049779-33049801 TGCCTCAGCTGTGGCACCAGGGG - Intergenic
989836613 5:46001601-46001623 AGTCACAGCTATGGCTGCTGTGG - Intergenic
990280181 5:54242088-54242110 TGGCCCAGCAATGCCTCCTGAGG + Intronic
991766379 5:69985202-69985224 TGTCCCAGAAATGTCTCCTGTGG - Intergenic
991780939 5:70132951-70132973 TGTCCCAGAAATGTCTCCTGTGG + Intergenic
991845612 5:70860285-70860307 TGTCCCAGAAATGTCTCCTGTGG - Intergenic
991873385 5:71133265-71133287 TGTCCCAGAAATGTCTCCTGTGG + Intergenic
992752716 5:79875659-79875681 TGCCCCAGCCAGGGCTTCAGTGG + Intergenic
995169543 5:109091324-109091346 CACCCCAGATATGGCTCCTGTGG + Intronic
996142744 5:119932718-119932740 GGCTCCAGCTAAGGCTGCTGTGG + Intergenic
996415981 5:123210719-123210741 TTCATCAGCTATGGCTCCTTGGG - Intergenic
997214842 5:132102033-132102055 TGCCCCAGTTAAATCTCCTGGGG + Intergenic
1002183219 5:177442099-177442121 CGCCCCCGCCTTGGCTCCTGGGG + Exonic
1002321077 5:178376414-178376436 TGTCCCAGCTGTGGTCCCTGGGG - Intronic
1003209895 6:4053248-4053270 TCCCTAAGCTGTGGCTCCTGGGG + Intronic
1003283295 6:4712503-4712525 CTCCCCAGCCATGGCTGCTGTGG - Intronic
1004801521 6:19153682-19153704 TCTCTGAGCTATGGCTCCTGTGG - Intergenic
1005020499 6:21413481-21413503 TTCCTCAGCTGTGTCTCCTGGGG - Intergenic
1005716071 6:28549758-28549780 TGCTCCAGCCATGGCTCTGGAGG + Intergenic
1006446813 6:34084345-34084367 TGCCCCACTGATGGCTCCTGAGG - Intronic
1006578086 6:35060449-35060471 TGCCCCAGAAACGGCTCCAGAGG + Intronic
1006706812 6:36027806-36027828 TGCGCCCGCTAAGGCTCCAGTGG - Exonic
1006860799 6:37170507-37170529 AGCCCCGGCTCCGGCTCCTGCGG + Exonic
1007208412 6:40171462-40171484 TGCCCCAGCTATGCCCTCTCAGG - Intergenic
1007230695 6:40345808-40345830 TGCCTCCTCTGTGGCTCCTGTGG - Intergenic
1018681905 6:166271642-166271664 GCCCCCAGCCATGGCCCCTGAGG - Intergenic
1019616397 7:1964865-1964887 TGCCGCAGGTGAGGCTCCTGGGG + Intronic
1019664345 7:2243945-2243967 TGCTCCTGCTGTGGCTACTGTGG - Intronic
1020271948 7:6602149-6602171 TGGCCCAGCTAGGAGTCCTGAGG - Intronic
1020574892 7:9913682-9913704 TGCCCCAGCTGTGTCTCATTGGG + Intergenic
1021062511 7:16131458-16131480 TGCCCCAGGTACAGCTCCAGTGG + Intronic
1023161616 7:37302247-37302269 TGTCCCAGCTATGGGGACTGAGG - Intronic
1023189830 7:37568445-37568467 GGACCCACCCATGGCTCCTGTGG - Intergenic
1023292014 7:38678561-38678583 TGCCCCAGGCCTCGCTCCTGTGG - Intergenic
1023938835 7:44757456-44757478 TGCTGCAGCTGTGGCTGCTGCGG + Exonic
1024910263 7:54439480-54439502 TGGACCAGCTCTGTCTCCTGAGG - Intergenic
1026111925 7:67465311-67465333 TGCTCCAGCTGTTGCTGCTGTGG - Intergenic
1026846409 7:73701190-73701212 TGCCCTGGCCATAGCTCCTGAGG + Intronic
1030269751 7:107658440-107658462 TGCCCCAGCTATTTCTGCTATGG + Intergenic
1031919038 7:127588291-127588313 TCCCCCGGCTCTGGCTCCTAGGG - Intronic
1031970256 7:128059890-128059912 TGCCCCAGCTGTGGGGACTGGGG + Intronic
1032264324 7:130360288-130360310 GGCCCCAGCCATGGGTGCTGGGG + Intronic
1032460056 7:132103498-132103520 TGCCCCAGTCATGGCCTCTGGGG - Intergenic
1035683039 8:1502855-1502877 TGCCCCAGAGAAGGCCCCTGGGG - Intronic
1035890920 8:3341654-3341676 TGCCCCTGCTATGGCTCCCTGGG - Intronic
1036576499 8:10032183-10032205 TGCCCCAGGTGTGGCTCCAGTGG - Intergenic
1037203108 8:16282194-16282216 GGACCCACCTATGGCTCCTATGG - Intronic
1040636818 8:49284645-49284667 TGCCCTAGTCATGTCTCCTGGGG - Intergenic
1041466541 8:58163036-58163058 TGCCCCATCTATGTCCCCTGAGG + Intronic
1042959145 8:74284108-74284130 TTCACCAGCCCTGGCTCCTGAGG - Intronic
1043749887 8:83922027-83922049 AGCCCAAGCCATGGCTTCTGAGG - Intergenic
1043946006 8:86253392-86253414 TGCCTCAGCTGTGGCTCAAGTGG - Intronic
1044538247 8:93381795-93381817 AGCTCCAGCTATGGCTTCAGAGG - Intergenic
1046898024 8:119494239-119494261 TACCCCAGTTATGGCTTCTAGGG - Intergenic
1047012332 8:120685478-120685500 TGCCCCAGTTGTGGCTCAAGTGG - Intronic
1048092887 8:131260346-131260368 TGCCCCTGCTGTGGCTTCTATGG + Intergenic
1048658992 8:136575072-136575094 TGCCCCAGCTCTGGGTGCTCTGG + Intergenic
1049212998 8:141395350-141395372 TGCCCCACCTAGGGGTCCTTAGG - Intronic
1049427797 8:142545049-142545071 TGACCCAGCCCTGGCTGCTGGGG + Intergenic
1049813826 8:144588745-144588767 TGGCCCAGCTGAGGCTGCTGAGG - Intronic
1049865769 8:144934493-144934515 AGCCCCAGCCCTGGCTCCAGAGG + Intronic
1050067172 9:1771970-1771992 TGCCCCAGGTGTGACTCCAGTGG - Intergenic
1050388004 9:5111067-5111089 TGGCCCAGCTCAGGCTCCTGGGG + Intronic
1055021513 9:71675367-71675389 TGCCCCAGGTGTGGCTCTCGTGG + Intergenic
1055669991 9:78595137-78595159 TGCCCCAGCTATGGCTCAAGTGG + Intergenic
1056707794 9:88966865-88966887 GGCCCCAGCTCTGGGTCCTGGGG + Intergenic
1058343029 9:103921133-103921155 AGCCCCAGCTATGTCTACGGTGG - Intergenic
1058365681 9:104205958-104205980 TACCCCAGCACTGGTTCCTGCGG - Intergenic
1058757159 9:108093831-108093853 TGCACCAGCTATGGCCTGTGGGG - Intergenic
1058852083 9:109022285-109022307 TCTCCTGGCTATGGCTCCTGAGG + Intronic
1059231627 9:112726165-112726187 TGCCCCAGCTGTAGCTCAAGTGG - Intergenic
1059305490 9:113350210-113350232 TGCCCCAGCTCCCGCCCCTGTGG + Intronic
1059525813 9:114989985-114990007 CTCCCGAGCTGTGGCTCCTGAGG + Intergenic
1060821746 9:126665295-126665317 CGCCCCAGCCCTGGCTCCAGGGG - Intronic
1060864253 9:126982339-126982361 TGCCCCAGCTATGTGACCTTGGG + Intronic
1062119033 9:134824228-134824250 AGCCCCAGCTAGGGCTGCAGAGG + Intronic
1062472941 9:136714132-136714154 TGACCCTGCTGTGGATCCTGGGG - Intronic
1185430904 X:11193-11215 TTCCCCAGCTATGGCTTCTTGGG + Intergenic
1185440170 X:223590-223612 TTCCCCAGCTATGGCTTCTTGGG + Intergenic
1187020385 X:15375444-15375466 TGCTGTAGCTATGGCTGCTGTGG + Intronic
1187347581 X:18480740-18480762 TGTCCCTGCTTTGGCTACTGGGG + Intronic
1189239122 X:39512162-39512184 TTCCCCCTCTATTGCTCCTGAGG - Intergenic
1189249640 X:39590458-39590480 TGCCCTGCCTGTGGCTCCTGGGG + Intergenic
1190468497 X:50751332-50751354 ATCCTCAGCTATAGCTCCTGGGG + Intronic
1194174052 X:90624985-90625007 TACCCCAGGTATGACTCCAGTGG - Intergenic
1195532301 X:105970379-105970401 TGCCCCAGCTGGGGCTCAGGAGG - Intergenic
1196075254 X:111569028-111569050 TCCCCCTCCTATGGCCCCTGAGG + Intergenic
1196251000 X:113459858-113459880 TGCCCCAGGTGTGGCTCCAGTGG - Intergenic
1197870308 X:131057975-131057997 TGCCCGATCAAGGGCTCCTGGGG + Intergenic
1199842295 X:151662306-151662328 TGTTCCAGCTTTGGCTCATGGGG + Intronic
1199942428 X:152638695-152638717 TTCCCCAGCTTTGGCACCTGTGG + Intronic
1200160093 X:154002642-154002664 TGCCACAGGCATGGCTCTTGGGG + Intergenic
1200489817 Y:3811136-3811158 AGCCCCAGCTATGTCTTCAGTGG - Intergenic
1200520273 Y:4202686-4202708 TACCCCAGGTATGACTCCAGTGG - Intergenic