ID: 916091789

View in Genome Browser
Species Human (GRCh38)
Location 1:161313281-161313303
Sequence ATCCAATCTACTATCTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091789 Original CRISPR ATCCAATCTACTATCTATGC AGG (reversed) Intergenic
900055807 1:629664-629686 ATCTACTCTACCATCTTTGCAGG + Intergenic
907060702 1:51421004-51421026 ATCCAATCTCCTCTATGTGCCGG + Intronic
916091789 1:161313281-161313303 ATCCAATCTACTATCTATGCAGG - Intergenic
1073476482 10:103757018-103757040 ATCCAGTCTGCCATCTACGCTGG + Intronic
1075489145 10:122851404-122851426 ATCCATTCTGCTAGCTCTGCTGG - Intronic
1086887460 11:92222644-92222666 AACCACTCTACTATTTTTGCAGG + Intergenic
1091599698 12:1910430-1910452 ACCCAATCTACCATGGATGCAGG + Intronic
1095734374 12:45540451-45540473 ATCCCATTTCCTATCTCTGCAGG - Intergenic
1102771741 12:115483406-115483428 ATCCATTCTTCTGTCTATTCAGG + Intergenic
1103291635 12:119850921-119850943 ATCCAATCTACTGTCTTTGTTGG - Intronic
1110917981 13:81047099-81047121 ATCCAATCTACTATTGACGGGGG + Intergenic
1119968227 14:78940912-78940934 ATCCTAGCTACCATTTATGCAGG - Intronic
1120651953 14:87145208-87145230 ATCCAATCTACTCTCCAGGTAGG - Intergenic
1125362988 15:38884207-38884229 ATCAGATCTCTTATCTATGCTGG - Intergenic
1131220270 15:90578031-90578053 ATCCAAGCTACTAGCTACTCGGG - Intronic
1133389356 16:5396811-5396833 AATCAATCTACTCTCTCTGCTGG - Intergenic
1134190714 16:12119174-12119196 CTCCAATCCACTGTCTATGCGGG - Intronic
1137661488 16:50210542-50210564 ATCCAGTCTAGTCTCTTTGCTGG + Intronic
1145209950 17:21005363-21005385 ATCCATTCTACAACCTAGGCAGG + Intronic
1146521084 17:33526157-33526179 TTCAAATCTACTATTTTTGCTGG - Intronic
1158628461 18:59091753-59091775 ATCCAATCAAATAACTATACAGG + Intergenic
1163865273 19:19768388-19768410 ATCCAATGTGCCTTCTATGCTGG + Intergenic
1166588914 19:43977827-43977849 CTCCAATCTACTATCCAAACTGG - Intronic
1167732101 19:51265818-51265840 ATCCAGGGTGCTATCTATGCGGG + Exonic
935999484 2:108812545-108812567 TCCCAATCTACTATCTAATCTGG - Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936987335 2:118323964-118323986 AGCCCATCCACTATCGATGCTGG - Intergenic
941507042 2:166359093-166359115 TTCCAATGAACTATCTATGTAGG + Intronic
942335388 2:174879381-174879403 ATCCAACGTACTATCCATGTTGG + Intronic
943316879 2:186399867-186399889 ATCAAATCTTCTTTCAATGCTGG + Intergenic
944258087 2:197645558-197645580 ATCAAATTTACAATCTAGGCTGG + Intronic
1175287194 20:57844807-57844829 GTCCAATCTCCTCTCCATGCTGG - Intergenic
1177083253 21:16668656-16668678 ATCCAATCCAGTATCTTTACAGG - Intergenic
1180146034 21:45919480-45919502 ATGCAATTTACTATCATTGCAGG + Intronic
950595386 3:13975979-13976001 AGCTAAACTACTCTCTATGCAGG + Intronic
957643721 3:82891055-82891077 AACAAATTTACTATCTTTGCTGG - Intergenic
957716196 3:83932063-83932085 AACCACACCACTATCTATGCTGG + Intergenic
962221747 3:133570301-133570323 ATCCATTCTGCTACCTAGGCTGG - Intergenic
963547723 3:146682806-146682828 ATCCAATCTAGTATGAATGAAGG + Intergenic
966026190 3:175285867-175285889 ATCAAATTTACTATCTTTGAGGG - Intronic
967361043 3:188632278-188632300 ATAAAATCTACTAGCTATCCTGG + Intronic
975799759 4:78048221-78048243 ACCAAATCTACTGTCTATGAGGG - Intergenic
988987743 5:36637202-36637224 ATCCAATCCTCTATTAATGCAGG + Intronic
991269569 5:64763783-64763805 ATCCAATCTTCTGGCTTTGCTGG + Intronic
995245793 5:109934125-109934147 ATCCAAGTTACCCTCTATGCTGG - Intergenic
995314775 5:110756451-110756473 GTCCAATCTATTTTCTTTGCAGG + Intronic
995493737 5:112720152-112720174 ATCAAATCAAGTATCTATACAGG - Intronic
996149458 5:120017651-120017673 TTCCTATCTACTATCTATTGTGG - Intergenic
1002766667 6:246301-246323 ACCCAATCTCCTATCCATTCTGG - Intergenic
1003260963 6:4515793-4515815 ATCCAATCTACGAGCCATTCAGG + Intergenic
1004812964 6:19279607-19279629 ATGCAATCTGTTCTCTATGCAGG + Intergenic
1014606529 6:123480834-123480856 CTCCTATCTCCTATCTTTGCTGG + Intronic
1024612102 7:51075831-51075853 ATCCAATCTTCAGTCTATGTTGG + Intronic
1034729665 7:153375889-153375911 ATCTTTTCTACTATCTATGATGG + Intergenic
1037749632 8:21672803-21672825 ATACAAGCCACTATCTATGGGGG - Intergenic
1046778905 8:118194366-118194388 ATCCTATCAACTTTCTTTGCGGG - Intronic
1050835540 9:10073938-10073960 ATTCAATTTTCTAGCTATGCTGG - Intronic
1056073370 9:83012274-83012296 ATCAAAGATACTATTTATGCAGG - Intronic
1056294653 9:85180560-85180582 ATCAAATTTACCATCTATGTGGG - Intergenic
1202629459 M:4494-4516 ATCTACTCTACCATCTTTGCAGG + Intergenic
1187990613 X:24868317-24868339 ATCCAGTGCACCATCTATGCTGG - Intronic
1192116460 X:68416385-68416407 ATCCCATCGACTATCTATAATGG + Intronic
1193574308 X:83180687-83180709 AACCACTCTCCTAACTATGCTGG - Intergenic
1201793752 Y:17871908-17871930 ATTCAAGCTTCTATCTCTGCTGG + Intergenic
1201807802 Y:18034078-18034100 ATTCAAGCTTCTATCTCTGCTGG - Intergenic
1202355137 Y:24039726-24039748 ATTCAAGCTTCTATCTCTGCTGG + Intergenic
1202515641 Y:25630383-25630405 ATTCAAGCTTCTATCTCTGCTGG - Intergenic