ID: 916091893

View in Genome Browser
Species Human (GRCh38)
Location 1:161314159-161314181
Sequence GATTTCGGCAGAAACGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 23}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916091893_916091903 17 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091903 1:161314199-161314221 AAGTCGGCTGCAGGAGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 218
916091893_916091901 11 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091901 1:161314193-161314215 CGGTAGAAGTCGGCTGCAGGAGG 0: 1
1: 0
2: 4
3: 42
4: 125
916091893_916091902 14 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091902 1:161314196-161314218 TAGAAGTCGGCTGCAGGAGGCGG 0: 1
1: 0
2: 2
3: 94
4: 1416
916091893_916091904 20 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091904 1:161314202-161314224 TCGGCTGCAGGAGGCGGAGGAGG 0: 1
1: 0
2: 3
3: 77
4: 623
916091893_916091895 -9 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091895 1:161314173-161314195 GCCGAAATCCTGGCAAATTCCGG 0: 1
1: 0
2: 0
3: 3
4: 47
916091893_916091899 8 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091899 1:161314190-161314212 TTCCGGTAGAAGTCGGCTGCAGG 0: 1
1: 0
2: 4
3: 39
4: 529
916091893_916091898 1 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091898 1:161314183-161314205 TGGCAAATTCCGGTAGAAGTCGG 0: 1
1: 1
2: 2
3: 15
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091893 Original CRISPR GATTTCGGCAGAAACGCCGC TGG (reversed) Intergenic
914743905 1:150487186-150487208 GGTTTCAGCTGAAACGCCACGGG + Intergenic
916091893 1:161314159-161314181 GATTTCGGCAGAAACGCCGCTGG - Intergenic
1068125807 10:52840711-52840733 GAATAGGGCAGAAACGCAGCTGG + Intergenic
1088631197 11:111775367-111775389 CATTTCGGCAGAAATCCAGCTGG + Intergenic
1101017878 12:100520450-100520472 GATTTTGGCAGAAAAGCAACCGG - Intronic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1134850767 16:17476875-17476897 GATTTCAGCAGAAGCACAGCTGG - Intergenic
1139643482 16:68310538-68310560 GATTACGGCGGACACGCTGCTGG + Exonic
1143606816 17:7991720-7991742 GATTCAGGCATAGACGCCGCAGG + Intergenic
1153915007 18:9737590-9737612 CATTTCTGCAGAAGAGCCGCAGG - Intronic
1173002588 20:39115229-39115251 GATTTCTGCAGAAACGCCTCTGG - Intergenic
1180763856 22:18231052-18231074 TATTTCAGCAGAAACCCTGCAGG - Intergenic
1180771790 22:18393490-18393512 TATTTCAGCAGAAACCCTGCAGG + Intergenic
1180803169 22:18643104-18643126 TATTTCAGCAGAAACCCTGCAGG + Intergenic
1181218548 22:21352156-21352178 TATTTCAGCAGAAACCCTGCAGG - Intergenic
1184829449 22:46974956-46974978 GATTTCTGTAGAAAAGCCACAGG + Intronic
1203233627 22_KI270731v1_random:134481-134503 TATTTCAGCAGAAACCCTGCAGG + Intergenic
963746588 3:149130187-149130209 GTTTTCTGCAGAAAGGCCTCTGG + Intronic
972109586 4:35541277-35541299 GATTTCAGCAGACACGGAGCTGG + Intergenic
1001941276 5:175741432-175741454 GATTTCAGCAGAAATGCCATAGG - Intergenic
1041348796 8:56928802-56928824 GATTTGGGCAGAAATGTCCCAGG - Intergenic
1056941674 9:90961544-90961566 GCTGTCGGCAGAAACGCTCCAGG - Intergenic
1057848017 9:98540344-98540366 GATTTTGGCAGAAGCCCTGCAGG + Intronic
1059389247 9:113988518-113988540 GATCTCGGCAGGCACGTCGCTGG - Exonic
1196174324 X:112624409-112624431 GATTTTGGCAGAAGCGCTGGTGG + Intergenic