ID: 916091893

View in Genome Browser
Species Human (GRCh38)
Location 1:161314159-161314181
Sequence GATTTCGGCAGAAACGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 23}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916091893_916091901 11 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091901 1:161314193-161314215 CGGTAGAAGTCGGCTGCAGGAGG 0: 1
1: 0
2: 4
3: 42
4: 125
916091893_916091898 1 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091898 1:161314183-161314205 TGGCAAATTCCGGTAGAAGTCGG 0: 1
1: 1
2: 2
3: 15
4: 92
916091893_916091904 20 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091904 1:161314202-161314224 TCGGCTGCAGGAGGCGGAGGAGG 0: 1
1: 0
2: 3
3: 77
4: 623
916091893_916091899 8 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091899 1:161314190-161314212 TTCCGGTAGAAGTCGGCTGCAGG 0: 1
1: 0
2: 4
3: 39
4: 529
916091893_916091903 17 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091903 1:161314199-161314221 AAGTCGGCTGCAGGAGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 218
916091893_916091895 -9 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091895 1:161314173-161314195 GCCGAAATCCTGGCAAATTCCGG 0: 1
1: 0
2: 0
3: 3
4: 47
916091893_916091902 14 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091902 1:161314196-161314218 TAGAAGTCGGCTGCAGGAGGCGG 0: 1
1: 0
2: 2
3: 94
4: 1416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091893 Original CRISPR GATTTCGGCAGAAACGCCGC TGG (reversed) Intergenic