ID: 916091895

View in Genome Browser
Species Human (GRCh38)
Location 1:161314173-161314195
Sequence GCCGAAATCCTGGCAAATTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916091893_916091895 -9 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091895 1:161314173-161314195 GCCGAAATCCTGGCAAATTCCGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091895 Original CRISPR GCCGAAATCCTGGCAAATTC CGG Intergenic
902801634 1:18833841-18833863 GCAGAAATCATGGCATGTTCAGG + Intergenic
903462009 1:23526783-23526805 GCCCAAATTCTAGCAAATCCTGG - Intronic
905479607 1:38252385-38252407 GCCGAAATGCTAGCCAATTTTGG + Intergenic
912562195 1:110559090-110559112 GCCCAGACCCTGGCAAGTTCTGG - Intergenic
916091895 1:161314173-161314195 GCCGAAATCCTGGCAAATTCCGG + Intergenic
916890445 1:169107553-169107575 GCCCGAAACCTGGCAAAGTCTGG + Intronic
1076040942 10:127247929-127247951 GCCGAAATCATCCCAGATTCTGG - Intronic
1076497246 10:130905174-130905196 TCAGAAATCCTGGCAAGTTGGGG + Intergenic
1084339839 11:68489611-68489633 GCTGATACCCTGGCAAATACGGG - Intronic
1091662097 12:2391960-2391982 GCGGAACTCCTGGCAAACACGGG - Intronic
1093121451 12:15276267-15276289 GCCGAAATCCTGCCATCTTGTGG - Intronic
1099302376 12:80913614-80913636 TCTGAAATCCTGGCATACTCGGG - Intronic
1100455296 12:94745765-94745787 GCAGGAATCCTGGCAAATCCAGG + Intergenic
1104457518 12:128927737-128927759 CCTGTAATCCTGGCAACTTCGGG + Intronic
1109405422 13:61892252-61892274 GCTGAAATGCTGTTAAATTCAGG + Intergenic
1113011788 13:105775942-105775964 CCCCAAAACCTGGCAAATGCTGG - Intergenic
1126072595 15:44878077-44878099 TACCAAATCCTGGCAAAATCAGG + Intergenic
1126968957 15:54088267-54088289 GCCTGAATCCTGACAAATTACGG - Intronic
1133918420 16:10130290-10130312 TCAGTAATCCAGGCAAATTCAGG + Intronic
1140830376 16:78745327-78745349 GCAGAAAGCCTTGGAAATTCAGG - Intronic
1145249387 17:21289151-21289173 CCCTAAAGCCTGGTAAATTCTGG - Intronic
1148498419 17:48069660-48069682 GCCAAATTCCTGGAAAATTTTGG + Intergenic
1154352806 18:13600657-13600679 GCAGAAATCCTGGCAAAGGTTGG - Intronic
1157765971 18:50297940-50297962 GCCAAAATCCTGACATAGTCAGG + Intergenic
1167375796 19:49110644-49110666 GCCTAAATCCTGAAAAAGTCTGG - Intergenic
924973177 2:149984-150006 GCTGAAATCCTGGAAAATCCTGG - Intergenic
925836951 2:7955472-7955494 ACAGAAATCTTGGCAACTTCTGG + Intergenic
1169405114 20:5316019-5316041 GGCGACATCCTGGCAAAGACAGG + Intergenic
1170313837 20:15021677-15021699 GCCCAATGCCTGGCAACTTCTGG - Intronic
1170317649 20:15060324-15060346 GCAGAGATGCTGGCAAGTTCTGG + Intronic
1175372974 20:58504948-58504970 GCTGAAGTCCTAGCAAATTCAGG + Intronic
1182133518 22:27878246-27878268 GCCACAATACTGGAAAATTCAGG - Intronic
1184940489 22:47761272-47761294 ACCGCAATCCTTGAAAATTCTGG + Intergenic
966498791 3:180612868-180612890 GCTGAATTCCTTGTAAATTCTGG - Intronic
967681820 3:192372519-192372541 GCCTTGATCCTGGTAAATTCAGG + Intronic
975925107 4:79441269-79441291 GGTGAAATCATGGAAAATTCTGG + Intergenic
981724849 4:147836300-147836322 GCTGAAATTCTGACAACTTCTGG - Intronic
982367720 4:154598466-154598488 GAAGAAATCGTGGTAAATTCAGG - Intergenic
988440864 5:31231280-31231302 GACAAAATCCTGGGAATTTCAGG - Intronic
988950606 5:36255422-36255444 GGAGAAATCCTGACAAATTATGG + Intronic
989551631 5:42742353-42742375 CCTGAAATCCTGGCAATTTTAGG - Intergenic
998856495 5:146399515-146399537 GATGAAATCCTGGCATGTTCTGG + Intergenic
1000434387 5:161190113-161190135 GCCGAGAGCCTGGAAAATTACGG - Intergenic
1004123830 6:12852874-12852896 GCTGAAATCATGGCAATCTCTGG + Intronic
1005057323 6:21741981-21742003 GAGGAAATCCTGGAAAATTAAGG + Intergenic
1008735598 6:54539912-54539934 GCCCAAATTATGCCAAATTCTGG - Intergenic
1030653877 7:112144899-112144921 GATGAAATCCAGGCATATTCTGG - Intronic
1039604683 8:38870825-38870847 GCTCAATTCCTGGGAAATTCTGG - Intergenic
1060600012 9:124871024-124871046 ACTGAAACCCTGGCAAATACGGG + Intronic
1202179457 Y:22127100-22127122 GGGGATATCCTGGCAAACTCCGG - Intergenic
1202211904 Y:22459294-22459316 GGGGATATCCTGGCAAACTCCGG + Intergenic