ID: 916091898

View in Genome Browser
Species Human (GRCh38)
Location 1:161314183-161314205
Sequence TGGCAAATTCCGGTAGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916091893_916091898 1 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091898 1:161314183-161314205 TGGCAAATTCCGGTAGAAGTCGG 0: 1
1: 1
2: 2
3: 15
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091898 Original CRISPR TGGCAAATTCCGGTAGAAGT CGG Intergenic
904269868 1:29342935-29342957 TGACAAATGCCGGGGGAAGTGGG - Intergenic
906836346 1:49086600-49086622 TGGCAAATTCAAGCAGAAGTAGG - Intronic
907832023 1:58073684-58073706 TGGGAAATTCAGGTAGAATTTGG + Intronic
911132302 1:94401358-94401380 TGGCACATTCCTGTAGAATTGGG - Intergenic
915950788 1:160188695-160188717 TGGCAATGTCCGGTAGCTGTAGG + Intergenic
916091898 1:161314183-161314205 TGGCAAATTCCGGTAGAAGTCGG + Intergenic
1064757351 10:18583247-18583269 TGGCAAATTACGGTAAAAGGTGG - Intronic
1066144331 10:32541164-32541186 AGGCAAATTCAGGCAGAAGTAGG + Intronic
1067259520 10:44676287-44676309 TGGAAATTTCTGCTAGAAGTAGG + Intergenic
1073137143 10:101226322-101226344 TGGCCAAGTCGGGTAGGAGTGGG + Exonic
1079018525 11:16889271-16889293 TGGAAAATTACGGTAAAAGATGG - Intronic
1082806713 11:57456325-57456347 TGGCTAATTTTGGTAGAGGTGGG - Intergenic
1083270747 11:61571327-61571349 TGGCTACTTCAGGTAGAAATTGG - Intronic
1090495402 11:127206503-127206525 TGGCAAATTCAGGCAAAAGCAGG - Intergenic
1096809165 12:54158769-54158791 TGGCAAATAGCTGCAGAAGTAGG - Intergenic
1096829417 12:54302532-54302554 TGGCCAATTCCAGCAGAAGCAGG - Intronic
1096947228 12:55420271-55420293 CTGCAAATTCAGGCAGAAGTAGG + Intergenic
1101724484 12:107377695-107377717 TGGCAAATGCCTGTTGAAGATGG + Intronic
1102688082 12:114739727-114739749 TGGCACATTCTGGCGGAAGTGGG + Intergenic
1103027929 12:117588733-117588755 TGGCAAATTGAGGTAGATGTGGG + Intronic
1104492151 12:129203587-129203609 TGGCAAATTTAGGCAGAAGTAGG - Intronic
1104933025 12:132350274-132350296 TGGCATAGTCCTGAAGAAGTTGG + Intergenic
1105246070 13:18651182-18651204 AGGCAAATACTGGTAGAAGAGGG - Intergenic
1106363943 13:29059641-29059663 TGGCAAATTCAGGTAGAAGTAGG + Intronic
1108962507 13:56252728-56252750 TAGCAAATTCCTGGAAAAGTAGG + Intergenic
1109919487 13:69036857-69036879 TAGAAAATTCTGGTAGAAGTTGG - Intergenic
1112004414 13:95242039-95242061 TGGCAACCTCCGGCATAAGTGGG + Intronic
1112534618 13:100239872-100239894 TTGGAAATTCTGGGAGAAGTAGG - Intronic
1114221405 14:20701081-20701103 TGGGAAATTACGGTCAAAGTGGG - Intergenic
1115392162 14:32866098-32866120 CAGCAAATTCAGGCAGAAGTAGG + Intergenic
1135907824 16:26529577-26529599 TGGTAAATTCAGGAAGAACTAGG - Intergenic
1138402596 16:56759372-56759394 AGGCAAATTCTAGTAGAAATGGG + Intronic
1140817105 16:78631413-78631435 TGGCAAACTGCGGAAGAATTAGG + Intronic
1143145819 17:4774596-4774618 AGGCAATTTCAGATAGAAGTAGG + Intronic
1143645910 17:8230008-8230030 AGGCAAATTGGGGTAGAAGCTGG + Intronic
1144959558 17:19037454-19037476 TGGCAAATTCCTGAAGAGGCCGG - Intronic
1144975601 17:19137070-19137092 TGGCAAATTCCTGAAGAGGCCGG + Intronic
1152829257 17:82487069-82487091 TGCCAAATTCCAAGAGAAGTTGG + Intronic
1154442849 18:14408482-14408504 AGGCAAATACTGGTAGAAGAGGG + Intergenic
1157364569 18:47052440-47052462 TGGCAAATTTGGGTTGAATTTGG + Intronic
1158337235 18:56426267-56426289 TGGCAAATTCAGGCAGAAATAGG - Intergenic
1168135442 19:54348101-54348123 TGGAAAATTACGGTAAAAGGTGG + Intergenic
929133840 2:38603516-38603538 GTGCAAAATCTGGTAGAAGTGGG + Intronic
932196851 2:69791455-69791477 TGCCTAATTCCTGTAGAATTTGG - Intronic
934859557 2:97752681-97752703 TGACAAATGCCTGTAGAAGTTGG - Intergenic
941443634 2:165571534-165571556 TGGAAAATTCCTGTAAATGTTGG + Intronic
941697788 2:168571888-168571910 TGGCAAATTACTGTAGACTTGGG + Intronic
943483354 2:188449805-188449827 TGGCAAATTCAGTGAGAAATTGG + Intronic
944927632 2:204481017-204481039 GAGCAAAGTCTGGTAGAAGTGGG - Intergenic
946515995 2:220412230-220412252 TGGCAAATTCAGGCATAAGCAGG + Intergenic
946726933 2:222670868-222670890 TGGAAAATTACAGTAGAAGGTGG - Intergenic
1169249374 20:4048505-4048527 TGGGAAAAGCCGGAAGAAGTTGG + Intergenic
1169521990 20:6384238-6384260 TGACAAAATCCAATAGAAGTGGG - Intergenic
1176153387 20:63605119-63605141 TGGTACATGCCTGTAGAAGTTGG + Intronic
1177240036 21:18444137-18444159 TGGCAAATTCAGGCTGAAGTAGG - Intronic
1177320505 21:19513775-19513797 CAGCAAATTCTGGCAGAAGTAGG - Intergenic
1177590803 21:23164466-23164488 TGGCAAATTTCTATATAAGTTGG + Intergenic
950364322 3:12472229-12472251 TGGTAGAATCCGGTAGAACTGGG + Intergenic
951802897 3:26616425-26616447 TGGAAAATTCTGGTAGAGTTAGG + Intergenic
951938971 3:28055941-28055963 TGGCCAATTCTGGAAGAATTAGG - Intergenic
952558319 3:34559271-34559293 TGGCAAATGCTGATATAAGTAGG - Intergenic
952949507 3:38508942-38508964 TGGAAAATTCCAGTAGATATGGG + Intronic
953080009 3:39608225-39608247 TGGTAAATTCAGGCAGAAATAGG + Intergenic
953817337 3:46170223-46170245 TGGTAAATTCAGGCAGATGTAGG + Intronic
959842522 3:110994647-110994669 TCGCAAATGCCAGTAGATGTTGG - Intergenic
962379833 3:134888949-134888971 TGGCAGATTCCAGTAGCAGAGGG + Intronic
963377165 3:144482923-144482945 TGGAGAATTCAGGTAAAAGTTGG + Intergenic
967253640 3:187568180-187568202 TGGCAAAGTCTGGGAGAAGTAGG + Intergenic
967413097 3:189186824-189186846 TGGGGAATTCCTGAAGAAGTAGG - Intronic
968947088 4:3670811-3670833 TGGGAAATTGCGGGAGACGTGGG - Intergenic
970704577 4:18784445-18784467 TGGCAAATTCCGGCATTACTTGG + Intergenic
974475894 4:62379290-62379312 TGGAAAATTCAGGGAGAATTAGG + Intergenic
977394553 4:96454681-96454703 CAGCAAATTCAGGAAGAAGTAGG + Intergenic
981353511 4:143760206-143760228 TGCCACATACCGATAGAAGTAGG + Intergenic
984769004 4:183421572-183421594 TGGCAAATTCCAGCACAAATAGG - Intergenic
986654716 5:9999748-9999770 TGGCAAATTCAGGCAGAAGTAGG - Intergenic
992314260 5:75536524-75536546 CGGCAAATTCAGGCAGAAGCAGG + Intronic
996306447 5:122053324-122053346 TGGCAAACTCATGCAGAAGTAGG + Intronic
996599457 5:125245213-125245235 TGGCAAATTCAGGCAAAAGTAGG + Intergenic
997419080 5:133751634-133751656 GCGCAAATTCCGGTAGCAGATGG + Intergenic
999493068 5:152070634-152070656 TGGGAAATTCAGGTAGAGGCAGG - Intergenic
1002952763 6:1831727-1831749 TGGCAAATACCTCTAGAAGCAGG - Intronic
1008227764 6:48942604-48942626 TGGGAACTTCAGGTAGAAATGGG + Intergenic
1009497862 6:64373630-64373652 TGGCAAATTCAGGAAGAAGTAGG + Intronic
1014100867 6:117510111-117510133 TAGCAAGTTTCTGTAGAAGTGGG - Intronic
1014377967 6:120700738-120700760 TGTCAAAATCCTGTAGAGGTAGG + Intergenic
1014506444 6:122265344-122265366 TGACAAATTTCAGTGGAAGTGGG + Intergenic
1019031564 6:169018239-169018261 TGGAAAATTCAGACAGAAGTGGG + Intergenic
1021713701 7:23441670-23441692 TTGCAATTTCTGGTAGAGGTGGG - Intronic
1027951582 7:84823398-84823420 TGGAAAATTACGGTAAAAGGTGG - Intergenic
1032580834 7:133102056-133102078 TGGAACATTCTGGTACAAGTGGG - Intergenic
1033603995 7:142911954-142911976 TTGCAAATTCAGGTAGAGGTTGG - Intronic
1041258012 8:55995939-55995961 TGCCAAATCCCTGTAGTAGTGGG + Intronic
1043333759 8:79148962-79148984 TGGCCAACTCAGGTAGATGTGGG - Intergenic
1043767603 8:84156631-84156653 TTGCAAATTCCTGTGGATGTAGG + Intergenic
1046750391 8:117920687-117920709 TTCCAAATTCCTGGAGAAGTGGG + Intronic
1051847250 9:21465451-21465473 TTGCAAATTCAGGCAGAAATAGG + Intergenic
1051891365 9:21945583-21945605 CAGCAAATTCTGGCAGAAGTAGG - Intronic
1052532345 9:29703421-29703443 TGGCAAATTCAAGCATAAGTGGG + Intergenic
1056305060 9:85282421-85282443 TGGTAATTTCAAGTAGAAGTCGG - Intergenic
1057402999 9:94741112-94741134 TGGCAAATTCAGGTAATAGAAGG + Intronic
1058573807 9:106378496-106378518 TAGCCAATTCAGGTTGAAGTAGG + Intergenic
1059490660 9:114664129-114664151 TTGCAAATTAAGGAAGAAGTTGG - Intergenic
1185851932 X:3497510-3497532 TGGCAAGTTCCTGTAGATCTGGG - Intergenic
1186402173 X:9270072-9270094 TGGCAAATTGTGGTAGATTTGGG - Intergenic
1187819356 X:23270090-23270112 TGTCAAATTGCAGTAAAAGTTGG - Intergenic
1191763021 X:64664493-64664515 TGGCAAATTCAGGCAGAAATAGG - Intergenic
1191882711 X:65858492-65858514 TGGGAAATACTGGTAGAGGTAGG - Intergenic
1194982025 X:100450580-100450602 CGGCAAATTCAGGCAGAAATAGG - Intergenic
1196702933 X:118691450-118691472 TGGCTAATTTCTGTAGAATTGGG + Intergenic
1197982726 X:132234707-132234729 TGGCAAATTCACGTAAAAGATGG - Intergenic