ID: 916091899

View in Genome Browser
Species Human (GRCh38)
Location 1:161314190-161314212
Sequence TTCCGGTAGAAGTCGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 529}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916091896_916091899 -7 Left 916091896 1:161314174-161314196 CCGAAATCCTGGCAAATTCCGGT 0: 1
1: 0
2: 0
3: 9
4: 93
Right 916091899 1:161314190-161314212 TTCCGGTAGAAGTCGGCTGCAGG 0: 1
1: 0
2: 4
3: 39
4: 529
916091893_916091899 8 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091899 1:161314190-161314212 TTCCGGTAGAAGTCGGCTGCAGG 0: 1
1: 0
2: 4
3: 39
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091899 Original CRISPR TTCCGGTAGAAGTCGGCTGC AGG Intergenic
900738311 1:4314213-4314235 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
903183530 1:21617322-21617344 TTCCGGTAGATGCGGGCTGTGGG + Exonic
904375124 1:30076343-30076365 TTCAGGCAGAAGTCTGCAGCAGG + Intergenic
905808461 1:40894116-40894138 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
906083408 1:43108801-43108823 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
906655139 1:47542769-47542791 TTCAGGTAGAAGTTTGCTGCAGG + Intergenic
907259415 1:53206253-53206275 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
907749252 1:57246491-57246513 TCCAGGTAGAAGTCTGCTACAGG + Intronic
907808110 1:57841496-57841518 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
907862995 1:58371929-58371951 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
908871711 1:68620495-68620517 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
909083711 1:71146995-71147017 TTCAGTTAGAAGTCTGCTGCAGG + Intergenic
909269172 1:73600921-73600943 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
909368969 1:74861956-74861978 TTCTGGCAGTAGTCTGCTGCAGG - Intergenic
909719818 1:78754767-78754789 TCCAGGTAGAAGTTTGCTGCAGG + Intergenic
909774268 1:79464529-79464551 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
909867024 1:80686279-80686301 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
910493086 1:87794803-87794825 TTCTGGTGGAAGTGGGCTGGAGG + Intergenic
910563544 1:88618506-88618528 TCCTGGCAGAAGTCTGCTGCAGG - Intergenic
911082801 1:93950055-93950077 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
911708316 1:101040562-101040584 TCCAGGTAGAAGTCGGCTGTAGG - Intergenic
912070292 1:105800956-105800978 TCCAGGCAGAAGTCAGCTGCAGG - Intergenic
912405505 1:109434326-109434348 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
912735936 1:112149627-112149649 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
912861138 1:113214913-113214935 TTCAGGCAGAAGCCTGCTGCAGG - Intergenic
913289444 1:117258735-117258757 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
913307795 1:117450853-117450875 TCCAGGTAGAAGTTTGCTGCAGG + Intronic
915058426 1:153158726-153158748 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
915665429 1:157440057-157440079 TTCAGGCAGAAGTCTGCTGCAGG - Intergenic
915689592 1:157675616-157675638 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
915885682 1:159718468-159718490 TTCAGGCAGAAGTCTTCTGCAGG + Intergenic
916000301 1:160608655-160608677 TTCAGGTAGAATTCAGCTACTGG + Exonic
916091899 1:161314190-161314212 TTCCGGTAGAAGTCGGCTGCAGG + Intergenic
916296752 1:163228235-163228257 TACAGGCAGAAGTCTGCTGCAGG - Intronic
916790332 1:168119928-168119950 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
917205175 1:172564122-172564144 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
917261386 1:173173540-173173562 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
918323053 1:183383013-183383035 TGCAGGCAGAAGTCTGCTGCAGG - Intronic
918734201 1:188038006-188038028 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
919211764 1:194495834-194495856 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
921621422 1:217330094-217330116 TCCAGGAAGAAGTCTGCTGCAGG - Intergenic
922666139 1:227471139-227471161 TTGAGGTAGAATTCTGCTGCAGG + Intergenic
923339260 1:232993987-232994009 TTCAGGCAAAAGTCTGCTGCAGG + Intronic
923428043 1:233891582-233891604 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
923890924 1:238214347-238214369 TCCAGGTGGAAGTCTGCTGCAGG - Intergenic
923941531 1:238832623-238832645 TCCAGGCAGAAGTCAGCTGCAGG + Intergenic
1063334051 10:5192907-5192929 TTCAGGAAGACGTTGGCTGCAGG - Intergenic
1064023985 10:11832227-11832249 TCCAGGTGGAAGTTGGCTGCTGG - Intronic
1066273302 10:33844448-33844470 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
1068056211 10:52015177-52015199 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1068163165 10:53293846-53293868 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1068404348 10:56570506-56570528 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1069351364 10:67531073-67531095 TCCAGGTAGAAGTTTGCTGCAGG + Intronic
1069754643 10:70766196-70766218 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1071507033 10:86238850-86238872 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1072358243 10:94633409-94633431 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1072883224 10:99249013-99249035 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1075089377 10:119434874-119434896 CTCAGGTAGAAGTTTGCTGCAGG - Intronic
1076086210 10:127634439-127634461 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1076155574 10:128202652-128202674 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1077740822 11:4843332-4843354 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1078393406 11:10956217-10956239 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1079445876 11:20555738-20555760 TGCAGGCAGAAGTCTGCTGCAGG - Intergenic
1079925154 11:26484538-26484560 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1079952667 11:26823890-26823912 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1080843330 11:36004719-36004741 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1080997260 11:37619164-37619186 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1081270513 11:41077341-41077363 TCCAGGCAGAAGTCTGCTGCTGG - Intronic
1081316536 11:41637510-41637532 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1081358601 11:42144623-42144645 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1081441475 11:43085802-43085824 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1082711760 11:56561256-56561278 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1085000343 11:73027999-73028021 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1085418394 11:76335199-76335221 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1085976346 11:81660118-81660140 TTCAAGCAGAAGTCTGCTGCAGG - Intergenic
1085987134 11:81800984-81801006 TTTAGGCAGAAGTTGGCTGCAGG + Intergenic
1086799380 11:91152608-91152630 TCCAGGTAGAAGTCTGCTGCAGG - Intergenic
1086954861 11:92925513-92925535 TCCAGGAAGAAGTCTGCTGCAGG + Intergenic
1087437867 11:98145397-98145419 TCCAGGTAGAAGTCTACTGCAGG - Intergenic
1088426948 11:109714706-109714728 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
1088953843 11:114598487-114598509 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1090595346 11:128315064-128315086 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1091086337 11:132725176-132725198 TTCAGGCAGAAGTTTGCTGCAGG - Intronic
1091552900 12:1550341-1550363 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1091811849 12:3406007-3406029 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1092944302 12:13438826-13438848 TCCAGGCAGAAGTCTGCTGCGGG - Intergenic
1093581345 12:20787050-20787072 TCCAGGTAGAAGTTTGCTGCAGG + Intergenic
1093591244 12:20904724-20904746 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1094421159 12:30272705-30272727 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1094786888 12:33859187-33859209 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
1095039277 12:37423689-37423711 CACCGGTAGAAGTCGGCTCAAGG - Intergenic
1095300822 12:40581861-40581883 TCCAGGCAGAAGTCTGCTGCGGG - Intergenic
1095308193 12:40662739-40662761 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1095782699 12:46077966-46077988 TCCATGTAGAAGTCTGCTGCAGG - Intergenic
1097302748 12:58035755-58035777 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1097343624 12:58467149-58467171 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1097492699 12:60290719-60290741 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1097510203 12:60529641-60529663 TCCAGGTAGAAGTCTGTTGCAGG + Intergenic
1098434089 12:70450681-70450703 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1098703067 12:73653318-73653340 TTCAGGCAGAAGTCTGCTACAGG + Intergenic
1099386451 12:82018929-82018951 TCCAGGTAGAAGTCTGCTGCAGG + Intergenic
1099487772 12:83249469-83249491 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1099525275 12:83711037-83711059 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1099568136 12:84278737-84278759 TCCAGGCAGAAGTCGGCTGCAGG - Intergenic
1099760304 12:86912451-86912473 TTCAGGCAGAAGTCTGCTGCAGG + Intergenic
1100597938 12:96087737-96087759 TCCAGGCAGAAGTCTGCTGCGGG + Intergenic
1101516344 12:105439009-105439031 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1103223602 12:119267463-119267485 TTCAGGCAGAAGTCTGCTGCAGG + Intergenic
1103358103 12:120336594-120336616 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1103358275 12:120337923-120337945 TCCAGGCAGAAGTCAGCTGCAGG - Intergenic
1105647732 13:22339149-22339171 TTCAGGCAGAAGTGTGCTGCAGG + Intergenic
1106496890 13:30286550-30286572 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1106614730 13:31316055-31316077 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1107330718 13:39296652-39296674 CTCAGGCAGAAGTCTGCTGCAGG + Intergenic
1107343870 13:39438882-39438904 TTCAGGTAGAAGCCTGCTGCAGG + Intronic
1108981808 13:56523642-56523664 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1109297509 13:60552680-60552702 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1109494206 13:63146937-63146959 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1109616217 13:64837235-64837257 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1109876080 13:68405819-68405841 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1110062680 13:71062411-71062433 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1110208623 13:72947081-72947103 TTCAGGCAGAAGTTTGCTGCAGG - Intronic
1110892920 13:80712856-80712878 TTCAGGCAGAAGTCTGCTGCAGG - Intergenic
1110955729 13:81550095-81550117 TCCAGGGAGAAGTCTGCTGCAGG - Intergenic
1111020161 13:82438483-82438505 TCCAGGAAGAAGTCTGCTGCAGG + Intergenic
1111144884 13:84166938-84166960 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1111219089 13:85180799-85180821 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1111419856 13:87998499-87998521 TTCAGGCAGAAGCCAGCTGCAGG + Intergenic
1111494834 13:89034392-89034414 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1111606647 13:90547478-90547500 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1111799069 13:92960140-92960162 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
1112789528 13:102987821-102987843 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1112825041 13:103382309-103382331 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1112954564 13:105042079-105042101 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1113087780 13:106585879-106585901 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1113264885 13:108606605-108606627 TCCAGGTAGAAGTCTGCTGCAGG + Intronic
1113492016 13:110699800-110699822 TTCCGGTAGAAGTGATGTGCGGG + Intronic
1113496990 13:110738846-110738868 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1114171078 14:20273125-20273147 TCCAGGTAGAAGTTTGCTGCAGG + Intronic
1114954876 14:27805308-27805330 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
1115085783 14:29513215-29513237 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1115249421 14:31330136-31330158 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1115277306 14:31622776-31622798 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1115551959 14:34512693-34512715 TTCCAGTAGAAGTGGGATGAGGG + Intergenic
1116789741 14:49327620-49327642 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1116998310 14:51347074-51347096 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1117749247 14:58903202-58903224 TCCAGGTAGAAGTCTGCTGCAGG + Intergenic
1117984548 14:61374480-61374502 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1118079145 14:62338261-62338283 TTGCTGTAGAATTCAGCTGCTGG + Intergenic
1118092484 14:62497682-62497704 TCCGGGCAGAAGTCTGCTGCAGG - Intergenic
1118957004 14:70491554-70491576 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1119963111 14:78882166-78882188 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1120060695 14:79978849-79978871 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
1120225860 14:81790427-81790449 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1120377580 14:83729524-83729546 TCCAGGCAGAAGTCAGCTGCAGG - Intergenic
1120405049 14:84084063-84084085 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1120469403 14:84903559-84903581 TTCAGGCAGAAGTCTGCTACAGG + Intergenic
1121237932 14:92406491-92406513 TCCAGGCAGAAGTCGGCTGCAGG - Intronic
1121384767 14:93509938-93509960 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1124444979 15:29722534-29722556 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1125066086 15:35487342-35487364 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1126825067 15:52540386-52540408 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1131700919 15:94934641-94934663 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1132303796 15:100793902-100793924 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1135208929 16:20507471-20507493 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1138402118 16:56754833-56754855 TCCAGGCAGAAGTCGGCTACAGG - Intronic
1138798879 16:60001951-60001973 TTCAGGAAGAAGTTAGCTGCAGG + Intergenic
1138800104 16:60016634-60016656 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1141214217 16:82009144-82009166 TCCAGGCAGAAGTTGGCTGCAGG + Intronic
1141313077 16:82934152-82934174 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1142938736 17:3362759-3362781 TCCAGGTAGAAGTCTGCTGCAGG - Intergenic
1143455970 17:7067969-7067991 TTCAGGTAGAAGCCTGCTGCAGG - Intergenic
1143520523 17:7441769-7441791 ATCAGGTTGAAGTGGGCTGCAGG - Exonic
1144285461 17:13769997-13770019 TCCAGGCAGAAGTTGGCTGCAGG - Intergenic
1144605179 17:16658439-16658461 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1145022585 17:19443333-19443355 TCCAGGAAGAAGTCTGCTGCAGG + Intergenic
1146391786 17:32429776-32429798 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1147834403 17:43319719-43319741 TCCAGGTAGAGGTGGGCTGCAGG - Intergenic
1149113531 17:53063317-53063339 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
1149143165 17:53458252-53458274 TCCAGGCAGAAGTCAGCTGCAGG + Intergenic
1150350166 17:64438128-64438150 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1151041050 17:70861392-70861414 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1153226174 18:2901718-2901740 TTCAGAAAGCAGTCGGCTGCTGG + Intronic
1153392109 18:4574154-4574176 TGCAGGCAGAAGTCTGCTGCAGG + Intergenic
1155748587 18:29391475-29391497 TTCCTGCAGAAGTTTGCTGCAGG + Intergenic
1156052343 18:32952287-32952309 TTCAGGCAGAAGTTTGCTGCAGG - Intronic
1156122665 18:33863852-33863874 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1158101531 18:53834933-53834955 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1158129742 18:54139648-54139670 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1159288868 18:66390845-66390867 TCCAGGAAGAAGTCTGCTGCAGG + Intergenic
1159650389 18:70971129-70971151 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1160627175 18:80218768-80218790 TTCAGGCAGAAGTCTGCTGCAGG - Intronic
1166624156 19:44334837-44334859 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1168496217 19:56853923-56853945 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
925094526 2:1185469-1185491 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
925494843 2:4435398-4435420 TTCAGGCAGAAGTTTGCTGCGGG - Intergenic
925737995 2:6980837-6980859 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
926598260 2:14814121-14814143 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
926769023 2:16351579-16351601 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
927341894 2:21992300-21992322 TTCAGGCAGATGTCTGCTGCAGG - Intergenic
929612835 2:43284555-43284577 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
930480617 2:51943927-51943949 TCCAGGCAGAAGTTGGCTGCAGG + Intergenic
930481421 2:51952675-51952697 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
930512101 2:52358613-52358635 TTGAGGCAGAAGTCTGCTGCAGG + Intergenic
931436765 2:62254330-62254352 TTCCGGTAGAGATGGGCAGCAGG - Intergenic
931529661 2:63199656-63199678 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
932648509 2:73530713-73530735 TCCAGGAAGAAGTCTGCTGCAGG - Intronic
932956500 2:76357254-76357276 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
934118262 2:88815853-88815875 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
935324953 2:101927571-101927593 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
936586748 2:113764724-113764746 TTCAGGCAGAAGTCTGCTGTGGG - Intergenic
936795002 2:116194283-116194305 TTCAGGTAGAACTCTGCTGCAGG - Intergenic
936800288 2:116257867-116257889 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
936940875 2:117882973-117882995 TCCAGGTAGAAGTTTGCTGCAGG + Intergenic
939361249 2:141175599-141175621 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
939445968 2:142310468-142310490 TCCAGGTAGAAATCTGCTGCAGG - Intergenic
939754612 2:146094172-146094194 TCCAGGTAGAAGTCTGCTGCAGG - Intergenic
939830427 2:147064471-147064493 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
939847782 2:147268875-147268897 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
940149030 2:150578688-150578710 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
940359966 2:152786700-152786722 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
940402867 2:153267363-153267385 TCCAGGAAGAAGTCTGCTGCAGG - Intergenic
941526983 2:166618389-166618411 TTCAGGTAGAAGTTTGCTTCAGG + Intergenic
942380524 2:175386108-175386130 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
942991466 2:182208035-182208057 TCCAGGAAGAAGTCTGCTGCAGG + Intronic
943124784 2:183782817-183782839 TCTAGGTAGAAGTCTGCTGCAGG + Intergenic
943248362 2:185484898-185484920 GTCTGGCAGAAGTCTGCTGCAGG + Intergenic
943315788 2:186385986-186386008 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
944943070 2:204651746-204651768 TTAAGGCAGAAGTCTGCTGCAGG - Intronic
945900683 2:215534187-215534209 TTCAGGCAGAAGTCTGATGCAGG + Intergenic
946317137 2:218923779-218923801 TCCAGGCAGAAGTCAGCTGCAGG - Intergenic
946495588 2:220192462-220192484 TTCTGGTTGAAGTCTGCGGCTGG + Intergenic
946543982 2:220716264-220716286 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
946575558 2:221071725-221071747 TCCAGGCAGAAGTCTGCTGCGGG - Intergenic
946968649 2:225067595-225067617 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
948221016 2:236269866-236269888 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1170479963 20:16755634-16755656 GTCAGGTAGAAGCCTGCTGCAGG - Intronic
1170938558 20:20830136-20830158 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1171399690 20:24864883-24864905 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1171490676 20:25514930-25514952 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1171571031 20:26251723-26251745 CACCGGTAGAAGTCGGCTCAAGG - Intergenic
1172893175 20:38281477-38281499 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1173323423 20:42010077-42010099 TCCAGGTAGAAGTCTGCTCCAGG - Intergenic
1173740846 20:45400784-45400806 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1174531416 20:51217539-51217561 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1177130445 21:17248515-17248537 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
1177187041 21:17808375-17808397 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1177306048 21:19317295-19317317 TTCAAGCAGAAGTCTGCTGCAGG - Intergenic
1177367200 21:20153564-20153586 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1177394087 21:20510847-20510869 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
1178002800 21:28182539-28182561 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1179527936 21:41996017-41996039 TCCAGGAAGAAGTCTGCTGCAGG + Intronic
1180573206 22:16748737-16748759 CACCGGTAGAAGTCGGCTCAAGG - Intergenic
1181448635 22:23000694-23000716 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1182992138 22:34778183-34778205 TACAGGCAGAGGTCGGCTGCAGG + Intergenic
1183275690 22:36896148-36896170 TTCAGGCAGAAGCCTGCTGCAGG + Intergenic
1184338887 22:43874609-43874631 TTGAGGCAGAAGTCTGCTGCAGG + Intergenic
950326012 3:12110560-12110582 TCCAGGAAGAAGTCTGCTGCAGG - Intronic
951430160 3:22597352-22597374 TTCAGGCAGAAGTCAACTGCAGG + Intergenic
952504518 3:33995805-33995827 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
953624823 3:44562083-44562105 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
954484612 3:50836295-50836317 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
956572536 3:70712643-70712665 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
956911398 3:73821658-73821680 TCCAGGTAGAAGTCTACTGCAGG + Intergenic
957412815 3:79862506-79862528 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
957676767 3:83377404-83377426 TTTAGGCAGAAGTCTGCTGCAGG - Intergenic
957870856 3:86089329-86089351 TTCAGGTAGAGGTGTGCTGCAGG - Intergenic
957909514 3:86603738-86603760 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
958006054 3:87812978-87813000 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
958463266 3:94426405-94426427 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
958537704 3:95425330-95425352 TACAGGCAGAAGTCAGCTGCAGG - Intergenic
958754532 3:98234794-98234816 TTCAGGAAGAAGTCTGCTGTAGG + Intergenic
959390108 3:105762657-105762679 TCCAGGTAGAAGTTTGCTGCAGG + Intronic
959873938 3:111360150-111360172 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
959901023 3:111661984-111662006 TCCAGGTAGAAGTCTGCTGCAGG - Intronic
960581459 3:119282757-119282779 TACAGGTAGAAGTCTGCTGCAGG + Intergenic
960724725 3:120658724-120658746 TTCAGGCAGAAGCCAGCTGCAGG - Intronic
961067625 3:123889835-123889857 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
962689377 3:137878333-137878355 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
963022525 3:140886091-140886113 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
964090846 3:152874050-152874072 TTCAGGCAGAAGTCGGCTCTGGG - Intergenic
964943596 3:162190892-162190914 TTCAGGCAGAAGTTAGCTGCAGG + Intergenic
965349642 3:167597380-167597402 TCCAGGCAGAAGTGGGCTGCAGG + Intronic
965395043 3:168152866-168152888 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
965857232 3:173103378-173103400 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
966452564 3:180078523-180078545 TACAGGCAGAAGTCTGCTGCAGG - Intergenic
966760994 3:183419001-183419023 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
967412497 3:189180888-189180910 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
967519850 3:190416659-190416681 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
967567410 3:190988538-190988560 TTCAGGCAGAAGTCTGCTACAGG + Intergenic
968695837 4:2026010-2026032 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
969177034 4:5406508-5406530 TCCAGGTAGAAGTCTGCTGCAGG - Intronic
970061529 4:12039467-12039489 TTCAGGCAGAAGTTTGCTGCTGG + Intergenic
970461291 4:16277257-16277279 TCCTGGCAGAAGTCTGCTGCAGG + Intergenic
971561515 4:28084377-28084399 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
971593464 4:28497927-28497949 TCCAGGTAGAAGTCTGCTGTAGG - Intergenic
971720915 4:30244369-30244391 TTCAGGCAGAAGTCTGCTGCAGG - Intergenic
971741326 4:30525496-30525518 TCCAGGTAGAAGCCTGCTGCAGG - Intergenic
971856732 4:32053913-32053935 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
971858911 4:32079329-32079351 TACAGGCAGAAGTCTGCTGCAGG - Intergenic
971892626 4:32544500-32544522 TCCAGGTAGAAGTCTTCTGCGGG + Intergenic
971948692 4:33315425-33315447 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
971962538 4:33507664-33507686 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
971972230 4:33635132-33635154 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
972101978 4:35431636-35431658 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
972199970 4:36702802-36702824 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
972621211 4:40749945-40749967 GTCCGGGAGCAGTCGACTGCCGG + Exonic
972738525 4:41867531-41867553 TTCCGGAAGCAGTCGGGGGCTGG + Intergenic
972878488 4:43395277-43395299 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
972895995 4:43620499-43620521 TTTAGTTAGAAGTCTGCTGCAGG - Intergenic
974171272 4:58270161-58270183 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
974457405 4:62145794-62145816 TTCAGGCAGAAGGCTGCTGCAGG + Intergenic
974487575 4:62525007-62525029 TCCAGGTAGAAGTTTGCTGCAGG + Intergenic
974931457 4:68365516-68365538 TCCAGGGAGAAGTCAGCTGCAGG + Intergenic
974969604 4:68807676-68807698 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
974973343 4:68858745-68858767 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
975627003 4:76360249-76360271 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
975637393 4:76463913-76463935 TCCAGGTAGACGTCTGCTGCAGG + Intronic
976070111 4:81231471-81231493 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
976706717 4:88026998-88027020 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
976949779 4:90813988-90814010 TTCAGGCAGAAGTCTGCTGCAGG - Intronic
977396563 4:96478781-96478803 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
977512040 4:97973811-97973833 TTCAGGCAGAAGTTTGCTGCAGG + Intronic
977983969 4:103360361-103360383 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
978145424 4:105366242-105366264 TCCAGGTAGAAGTTTGCTGCAGG + Intergenic
978492440 4:109323304-109323326 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
978774338 4:112490748-112490770 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
979209060 4:118077845-118077867 TTCAGGTAGAAGCAGTCTGCTGG + Intronic
979414297 4:120417467-120417489 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
979721469 4:123905279-123905301 TTCAGGCAGATGTCTGCTGCAGG + Intergenic
979856180 4:125637149-125637171 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
979948180 4:126860309-126860331 TTCAGGTAGAAGTCTGCTGCAGG - Intergenic
980168062 4:129252419-129252441 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
980654057 4:135759338-135759360 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
981183960 4:141779675-141779697 TTCAAGCAGAAGTCTGCTGCAGG + Intergenic
981242397 4:142493200-142493222 TCCAGGTAGAAGTCTGCTGCAGG + Intronic
981260076 4:142708704-142708726 TCCAGGCAGAAGTCTGCTGCTGG + Intronic
981275418 4:142893507-142893529 TTCAGGTATAAGTCTGCTGCAGG + Intergenic
981914146 4:150015521-150015543 TCCCGGCAGAGGTCTGCTGCAGG - Intergenic
982432416 4:155338165-155338187 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
982524963 4:156466758-156466780 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
982607923 4:157537809-157537831 TCCAGATAGAAGTCTGCTGCAGG + Intergenic
982917211 4:161227391-161227413 TACAGGCAGAAGTCTGCTGCAGG - Intergenic
983089519 4:163487219-163487241 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
983132843 4:164043249-164043271 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
983171415 4:164540635-164540657 CTCAGGTAGAAGTCTACTGCAGG - Intergenic
983736639 4:171070291-171070313 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
983886803 4:172988927-172988949 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
984026329 4:174547674-174547696 TCCAGGTAGAAATCTGCTGCAGG + Intergenic
984057009 4:174942368-174942390 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
985304320 4:188522095-188522117 TCCAGGCAGAAGTTGGCTGCAGG + Intergenic
985386376 4:189452416-189452438 TTCAGGCAGAAGCCTGCTGCAGG + Intergenic
985607713 5:867277-867299 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
986582343 5:9278878-9278900 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
987162595 5:15159734-15159756 TGCAGGTAGAAGTAGGATGCAGG + Intergenic
987494856 5:18630376-18630398 TCAAGGCAGAAGTCGGCTGCAGG - Intergenic
987851577 5:23361970-23361992 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
987967336 5:24893467-24893489 TCCAGGGAGAAGTCTGCTGCAGG - Intergenic
988768417 5:34406891-34406913 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
988770435 5:34427515-34427537 TCCAGGTAGAAGTCTGCTGCAGG - Intergenic
988925120 5:35982127-35982149 TCCAGGTAGAAGTCTGCTGCAGG + Intronic
988928561 5:36013638-36013660 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
989501867 5:42177360-42177382 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
989520259 5:42392832-42392854 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
989656764 5:43753366-43753388 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
991136257 5:63185822-63185844 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
991355743 5:65767222-65767244 TCCAGGCAGAAGTCTGCTGCGGG - Intronic
992969616 5:82043087-82043109 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
993036979 5:82769385-82769407 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
993084589 5:83348311-83348333 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
993110733 5:83654470-83654492 TTTCAGTAGAAGTTGGATGCAGG - Intronic
993263731 5:85694587-85694609 TGCAGGCAGAAGTCTGCTGCAGG - Intergenic
993456295 5:88131145-88131167 TTCAGGCAGAAGTCTGCAGCAGG - Intergenic
993799889 5:92319698-92319720 TTCAGGAAGAAGTCTGCTGCAGG + Intergenic
994474500 5:100249941-100249963 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
994764548 5:103900190-103900212 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
994813728 5:104556906-104556928 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
994878883 5:105460914-105460936 TTCAGGCAGAAGTCTGTTGCAGG - Intergenic
995283196 5:110358023-110358045 TTCAGGCAGAAGTTTGCTGCAGG + Intronic
995477592 5:112563618-112563640 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
995701377 5:114939287-114939309 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
995723832 5:115165350-115165372 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
995779788 5:115762874-115762896 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
995997858 5:118322687-118322709 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
996046743 5:118882551-118882573 TACAGGCAGAAGTCTGCTGCAGG - Intronic
996404063 5:123089705-123089727 GCCCCGTAGAACTCGGCTGCAGG - Intronic
996453696 5:123656208-123656230 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
996829168 5:127720670-127720692 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
997091558 5:130864513-130864535 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
997110250 5:131066747-131066769 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
997182286 5:131842916-131842938 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
999504409 5:152180051-152180073 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1000103127 5:158035716-158035738 GTCCAGCAGAAGTCTGCTGCAGG + Intergenic
1000492036 5:161926046-161926068 TCCAGGTAGAAGTTTGCTGCAGG + Intergenic
1000575420 5:162969907-162969929 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1001330301 5:170757325-170757347 CTCCGGTAGAAGTCGGTGGCTGG + Intergenic
1002392790 5:178928862-178928884 TCCAGGTAGAAGCCTGCTGCAGG - Intronic
1003798332 6:9630955-9630977 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1003951592 6:11121368-11121390 TTCTGTTAGAAGTCCGCTGTAGG + Intronic
1007021499 6:38526377-38526399 TCCAGGTAGAAGTCTGCTGCAGG + Intronic
1008116325 6:47554641-47554663 TTCAGGTAGAAGAAGGCTGGTGG + Exonic
1008337476 6:50324640-50324662 TCCAGGTAGAAGTTGGCTTCAGG - Intergenic
1008870982 6:56271962-56271984 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1009284961 6:61804574-61804596 TTCAGGCAGAAGTTTGCTGCCGG - Intronic
1009377928 6:62994442-62994464 TTCAGACAGAAGTCTGCTGCAGG - Intergenic
1009710240 6:67308688-67308710 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
1009791195 6:68403618-68403640 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1010268257 6:73891792-73891814 TCCAGGTAGAAGTCCACTGCAGG + Intergenic
1010345047 6:74801015-74801037 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1010360461 6:74987249-74987271 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1010517398 6:76789912-76789934 TTCAGGCAGAAGCCTGCTGCAGG - Intergenic
1010594579 6:77748268-77748290 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1010611040 6:77953980-77954002 TTCAGGAAGAAGCCTGCTGCAGG + Intergenic
1010674043 6:78720770-78720792 TCCAGGGAGAAGTCTGCTGCAGG + Intergenic
1010860166 6:80900290-80900312 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1011294080 6:85808170-85808192 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1011876281 6:91966091-91966113 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1012161324 6:95888709-95888731 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1012342381 6:98143072-98143094 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1012811655 6:103966843-103966865 TTCAGGCAGAAGTCTTCTGCAGG - Intergenic
1012883304 6:104816570-104816592 TCCAGGAAGAAGTCTGCTGCAGG + Intronic
1013928613 6:115502872-115502894 TTCAGGCAGAAGTCTGCTGCAGG + Intergenic
1014067556 6:117145030-117145052 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1014374767 6:120659166-120659188 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1014665358 6:124230789-124230811 TTCAGGCAGAAGTTTGCTGCAGG + Intronic
1014933792 6:127363937-127363959 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1015652511 6:135479079-135479101 TCCAGGTAGAAGTCCACTGCAGG + Intronic
1016785898 6:148010687-148010709 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1017654425 6:156613931-156613953 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1017860547 6:158393482-158393504 TCCAGGGAGAAGTCTGCTGCAGG - Intronic
1017938080 6:159024887-159024909 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1018155714 6:160983562-160983584 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1018407699 6:163505201-163505223 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1018592650 6:165443673-165443695 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1018662591 6:166102012-166102034 TCCTGGCAGAAGTCTGCTGCAGG - Intergenic
1020730176 7:11870041-11870063 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1020979785 7:15053191-15053213 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1022784771 7:33627351-33627373 TTCAGGCAGAAGTCTGCTGCAGG + Intergenic
1023235445 7:38081501-38081523 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1023236868 7:38099222-38099244 TCCAGGTAGAAGTTTGCTGCAGG + Intergenic
1024158283 7:46648299-46648321 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
1024845459 7:53636765-53636787 TTCAGACAGAAGTCTGCTGCAGG + Intergenic
1024865814 7:53904257-53904279 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1025225877 7:57162155-57162177 TTCAGGCAGAAGTCTTCTGCAGG - Intergenic
1027560219 7:79719605-79719627 TCCCGGCAGAAGTCTGCTGCAGG - Intergenic
1027695454 7:81404612-81404634 TTCAGGCAGAAATCAGCTGCAGG - Intergenic
1027977597 7:85179079-85179101 TCCTGGCAGAAGTCTGCTGCAGG + Intronic
1028054174 7:86222750-86222772 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1028140945 7:87274223-87274245 TCCAGGTAGCAGTCTGCTGCAGG - Intergenic
1028289301 7:89045266-89045288 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1028301432 7:89205916-89205938 TCCAGGTAGAAGTTTGCTGCAGG - Intronic
1028438303 7:90830181-90830203 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1030357311 7:108556879-108556901 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1030452545 7:109731073-109731095 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1030868769 7:114731560-114731582 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
1031170905 7:118290984-118291006 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1031435603 7:121728604-121728626 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
1031545728 7:123049780-123049802 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
1031583458 7:123505420-123505442 TCCAGGCAGAAGTTGGCTGCAGG - Intronic
1031608247 7:123794728-123794750 TCCAGGTAGAAGTTTGCTGCAGG + Intergenic
1031652071 7:124303531-124303553 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1032330514 7:130974979-130975001 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1032366774 7:131307260-131307282 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1032560989 7:132892908-132892930 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1034510690 7:151532214-151532236 TTCTGGCAGAAGTTTGCTGCAGG - Intergenic
1034689288 7:153000936-153000958 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1034904799 7:154934482-154934504 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1035120735 7:156564509-156564531 TTCAGACAGAAGTCTGCTGCAGG - Intergenic
1035452106 7:158983935-158983957 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1038684318 8:29702584-29702606 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1040078058 8:43260165-43260187 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1040091273 8:43401156-43401178 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1040401204 8:47051622-47051644 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1040721441 8:50329379-50329401 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1041849871 8:62378755-62378777 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1041852083 8:62403689-62403711 GTCAGGCAGAAGTCTGCTGCAGG + Intronic
1042501627 8:69515185-69515207 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1042529006 8:69795801-69795823 TCCAGGTAGAAGCCTGCTGCAGG - Intronic
1042982103 8:74541005-74541027 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1043199103 8:77340442-77340464 TCCAGGTGGAAGTCTGCTGCAGG + Intergenic
1043805895 8:84671488-84671510 TTCAGGCAGAAGTTTGCTGCAGG - Intronic
1044760705 8:95514464-95514486 TCCAGGTAGAAGTTTGCTGCAGG - Intergenic
1044886337 8:96782175-96782197 TCCAGGTAGAAATCTGCTGCAGG - Intronic
1045700632 8:104862563-104862585 TCCAGGTAGAACTCTGCTGCAGG + Intronic
1046056245 8:109082307-109082329 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1046134693 8:110011134-110011156 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1046232312 8:111373751-111373773 TACAGGCAGAAGTCTGCTGCAGG + Intergenic
1046668841 8:117035699-117035721 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1046735173 8:117768851-117768873 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1046839520 8:118841463-118841485 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1046878046 8:119277735-119277757 TCTAGGTAGAAGTCTGCTGCAGG - Intergenic
1047937735 8:129798586-129798608 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1048046110 8:130774936-130774958 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
1048700012 8:137078116-137078138 TCCAGGTAGAAGTTTGCTGCAGG + Intergenic
1050109525 9:2200315-2200337 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1050674524 9:8036832-8036854 TCCAGGAAGAAGTCTGCTGCAGG - Intergenic
1050772087 9:9215166-9215188 TTCCTTTAGAAGTCATCTGCTGG + Intronic
1050953568 9:11627448-11627470 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1051285582 9:15492691-15492713 TCCAGGTAGAAGTCTGCTGCAGG - Intronic
1051990384 9:23145474-23145496 TTCAGGCAGAAGTCTGCTGCAGG - Intergenic
1052168041 9:25357670-25357692 TTCAGGCAGAAGTCTGCTGCAGG - Intergenic
1052382739 9:27789270-27789292 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1053616383 9:39770530-39770552 TCCAGGGAGAAGTCTGCTGCAGG - Intergenic
1053898065 9:42764750-42764772 TCCAGGGAGAAGTCTGCTGCAGG + Intergenic
1053925186 9:43047087-43047109 TTCAGGCAGAAGTTTGCTGCAGG + Intergenic
1054237134 9:62571859-62571881 TCCAGGGAGAAGTCTGCTGCAGG + Intergenic
1054551273 9:66606370-66606392 TCCAGGGAGAAGTCTGCTGCAGG + Intergenic
1054897335 9:70328816-70328838 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1056625777 9:88252052-88252074 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1058323096 9:103658594-103658616 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1058385366 9:104429492-104429514 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1059570084 9:115425064-115425086 TCCAGGCAGAAGTTGGCTGCAGG - Intergenic
1059604993 9:115824863-115824885 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1185737203 X:2502647-2502669 TTCCAGTAGGAGTCTGCTGGGGG - Intronic
1186488556 X:9953089-9953111 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1186620430 X:11235124-11235146 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1187133590 X:16525975-16525997 TTCAAGCAGAAGTCAGCTGCAGG - Intergenic
1187603771 X:20861543-20861565 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1187634413 X:21211225-21211247 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1187639648 X:21274110-21274132 TTCAGGCAGAAGTCTGATGCAGG - Intergenic
1187734402 X:22289644-22289666 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1187894415 X:23966936-23966958 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1188127114 X:26383295-26383317 TCCAGGAAGAAGTCCGCTGCAGG + Intergenic
1188221494 X:27546555-27546577 TCCTGGTAGAAGTCTGCTGGAGG - Intergenic
1188616520 X:32165031-32165053 TCCAGGCAGAAGTCTGCTGCAGG + Intronic
1188662341 X:32775415-32775437 TTCAGGTAGAAGTCTGCTGCAGG - Intronic
1189035105 X:37487682-37487704 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1189071299 X:37866596-37866618 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1189553089 X:42113509-42113531 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1189652773 X:43208212-43208234 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1190387612 X:49898164-49898186 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1191096772 X:56681344-56681366 GTCAGGCAGAAGTCTGCTGCAGG + Intergenic
1192713572 X:73616557-73616579 TTCAGGCAGAAGTTTGCTGCAGG - Intronic
1192955315 X:76063861-76063883 TTCAGGTAGAAGTCTGCTGCAGG - Intergenic
1193256482 X:79355059-79355081 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1193406439 X:81107483-81107505 TCCAGGTAGAAGCCTGCTGCAGG + Intergenic
1193509131 X:82377938-82377960 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1193911261 X:87309478-87309500 TCTAGGTAGAAGTCTGCTGCAGG - Intergenic
1193988424 X:88275596-88275618 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1194125632 X:90012830-90012852 TTCAGGCAGAAGTGTGCTGCAGG + Intergenic
1194253968 X:91613642-91613664 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1194339803 X:92694121-92694143 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1194352684 X:92840106-92840128 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1194525270 X:94969741-94969763 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1194603824 X:95957300-95957322 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1194941510 X:100016378-100016400 TCCCGGCAGAAGTTTGCTGCTGG + Intergenic
1196168912 X:112565661-112565683 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1196390633 X:115203980-115204002 TCCAGGCAGAAGTCTGCTGCAGG - Intronic
1196524692 X:116718763-116718785 TTCAGGCAGAAGTCTGCTTCAGG - Intergenic
1196582537 X:117393951-117393973 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1197075039 X:122343513-122343535 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1197392387 X:125883596-125883618 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1197439971 X:126475974-126475996 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1197569518 X:128131808-128131830 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1197583210 X:128310858-128310880 TTCAGGCAGAAGTCTGCTGCAGG - Intergenic
1197910988 X:131482493-131482515 TTCAGGAAGAAGTTTGCTGCAGG + Intergenic
1199072756 X:143497977-143497999 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1199170930 X:144733597-144733619 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1199203847 X:145124482-145124504 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1199214027 X:145246527-145246549 TTCAGGCAGAAGTATGCTGCAGG - Intergenic
1199250785 X:145659568-145659590 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1199330290 X:146550915-146550937 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1199370497 X:147042390-147042412 TCCAGGTAGAAGTCGGCTGCAGG + Intergenic
1199400720 X:147395523-147395545 TTCAGGCAGAAGTCTGCTCCAGG + Intergenic
1199776107 X:151013306-151013328 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1200255478 X:154580284-154580306 TCCAGGCAGAAGTCTGCTGCAGG + Intergenic
1200262291 X:154624120-154624142 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1200345283 X:155441226-155441248 TTCAGGTAGAGGTCTGCTGCAGG - Intergenic
1200459731 Y:3440650-3440672 TCCAGGCAGAAGTCGGCTTCAGG - Intergenic
1200572752 Y:4853219-4853241 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1200648186 Y:5810904-5810926 TTCAGGCAGAAGTTTGCTGCAGG - Intergenic
1200660989 Y:5956848-5956870 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic
1200668531 Y:6057823-6057845 TCCAGGCAGAAGTCTGCTGCAGG - Intergenic