ID: 916091901

View in Genome Browser
Species Human (GRCh38)
Location 1:161314193-161314215
Sequence CGGTAGAAGTCGGCTGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916091893_916091901 11 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091901 1:161314193-161314215 CGGTAGAAGTCGGCTGCAGGAGG 0: 1
1: 0
2: 4
3: 42
4: 125
916091896_916091901 -4 Left 916091896 1:161314174-161314196 CCGAAATCCTGGCAAATTCCGGT 0: 1
1: 0
2: 0
3: 9
4: 93
Right 916091901 1:161314193-161314215 CGGTAGAAGTCGGCTGCAGGAGG 0: 1
1: 0
2: 4
3: 42
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091901 Original CRISPR CGGTAGAAGTCGGCTGCAGG AGG Intergenic
903179879 1:21599778-21599800 GGGTAGGAGGAGGCTGCAGGGGG - Intronic
911011809 1:93288602-93288624 AGGCAGAAGTTTGCTGCAGGGGG + Intergenic
912348310 1:108987130-108987152 CAGGAGAAGCTGGCTGCAGGAGG - Intronic
913937093 1:125065262-125065284 CGGTGGAAGTCGGCTCACGGAGG - Intergenic
916091901 1:161314193-161314215 CGGTAGAAGTCGGCTGCAGGAGG + Intergenic
916814427 1:168337706-168337728 TGGCAGAAGTTTGCTGCAGGTGG - Intergenic
917971004 1:180207700-180207722 CAGTATGAGCCGGCTGCAGGAGG + Intergenic
919371910 1:196738892-196738914 AGGCAGAAGTTTGCTGCAGGGGG - Intronic
920071203 1:203304585-203304607 CGGTAGATGTCTGCTGAATGAGG - Intergenic
1064543611 10:16429592-16429614 CTGTAGAATGCAGCTGCAGGAGG - Intergenic
1065313313 10:24437277-24437299 TGTTAGAAGTCGGCTTGAGGGGG - Intronic
1066154215 10:32657345-32657367 AGGCAGAAGTTTGCTGCAGGTGG - Intronic
1068956045 10:62819030-62819052 CAGTAGAAGGCGGGTGGAGGAGG + Intronic
1081175476 11:39922234-39922256 AGGCAGAAGACTGCTGCAGGAGG + Intergenic
1087690669 11:101317465-101317487 AGGCAGAAGTTTGCTGCAGGGGG - Intergenic
1091567817 12:1661653-1661675 GGGTCGCAGTGGGCTGCAGGGGG - Intergenic
1095038485 12:37419359-37419381 CGGTGGAAGTCGGCTCAAGGAGG - Intergenic
1095038945 12:37421786-37421808 TGGTGGAAGTCGGCTCAAGGAGG - Intergenic
1095039275 12:37423686-37423708 CGGTAGAAGTCGGCTCAAGGAGG - Intergenic
1095049088 12:37541396-37541418 CGGTGGAAGTTGGCTCCAGGAGG + Intergenic
1095049475 12:37543587-37543609 CGGTGGAAGTCGGCTCAAGCAGG + Intergenic
1095562267 12:43580052-43580074 CTGTAGAATTCAGCTGCAGATGG - Intergenic
1097190523 12:57217245-57217267 CGCCTGAAGTCGGCTGCAAGGGG - Intronic
1097460610 12:59857290-59857312 GGATAGAAGTAGGCTTCAGGAGG + Intergenic
1097481045 12:60126344-60126366 AGGCAGAAGTTTGCTGCAGGGGG + Intergenic
1103645115 12:122385689-122385711 CAGTGGATGTCGGCTGCAGGAGG + Intronic
1108559559 13:51628618-51628640 CGGAAGAGGCCGGCTGCAGCAGG - Intronic
1109210448 13:59529294-59529316 CAGTAGAAGAAGGCTGCAGAGGG + Intergenic
1111526535 13:89478096-89478118 CAGTAGAAGTGGGCTGAAGGTGG + Intergenic
1114325257 14:21582399-21582421 GGGTGGAAGACTGCTGCAGGTGG + Intergenic
1114798131 14:25739976-25739998 AGGCAGAAGTTTGCTGCAGGGGG - Intergenic
1116275249 14:42824463-42824485 AGGCAGAAGTTAGCTGCAGGGGG + Intergenic
1118351061 14:64972550-64972572 CGGTAGAAGTGGGCTGGGTGGGG - Intronic
1120659024 14:87230679-87230701 AGGCAGAAGTATGCTGCAGGAGG - Intergenic
1130229275 15:82084301-82084323 CTGTAGAATTCGTCTGCATGGGG - Intergenic
1138547083 16:57726304-57726326 GGGCAGGGGTCGGCTGCAGGAGG + Intronic
1138818753 16:60233491-60233513 TTGTAGAAGTCGAGTGCAGGTGG + Intergenic
1139030807 16:62878394-62878416 AGGCAGAAGTTTGCTGCAGGTGG + Intergenic
1139465172 16:67150519-67150541 GGGTCGCAGTCGGCAGCAGGGGG + Exonic
1139531314 16:67544032-67544054 GGGTAGGAGTAGGCTGCAGGCGG - Intronic
1140890879 16:79284202-79284224 GGGTAGAAGGCGGATGGAGGTGG - Intergenic
1143520522 17:7441766-7441788 AGGTTGAAGTGGGCTGCAGGTGG - Exonic
1145306632 17:21679062-21679084 GGGTAGAAGTCGGCTCAAGGAGG - Intergenic
1145370102 17:22300686-22300708 TGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145378973 17:22376748-22376770 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145379452 17:22379118-22379140 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145379930 17:22381488-22381510 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145380410 17:22383863-22383885 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145380889 17:22386210-22386232 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145381368 17:22388585-22388607 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145382101 17:22392359-22392381 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145382576 17:22394724-22394746 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145382856 17:22396087-22396109 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145383429 17:22398910-22398932 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145383943 17:22401378-22401400 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145384381 17:22403580-22403602 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1145384700 17:22405042-22405064 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1149446690 17:56718660-56718682 AGGTAGAAGTCGGCTGCACCTGG + Intergenic
1158555375 18:58470748-58470770 GGGTAGCAGCCGGCTGAAGGGGG - Intergenic
1161153402 19:2720964-2720986 GCGAAGAAGGCGGCTGCAGGAGG + Intronic
1165180000 19:33959422-33959444 CGGTCGAAGTCAACTGCAGTTGG + Intergenic
1165595259 19:37007566-37007588 CGGTAGAAGTCGACTCAAGGAGG + Intergenic
1165595690 19:37009859-37009881 TGGTAGAAGTTGGCTCAAGGAGG + Intronic
1165596092 19:37012131-37012153 CGGTAGAAGTCGGCACAAGGAGG + Intronic
1165601177 19:37056783-37056805 CGGTAGGAGTTGGCTCAAGGAGG + Intronic
1165601607 19:37059143-37059165 CGGTGGAAGTCGACTCAAGGAGG + Intronic
1165993071 19:39826951-39826973 CGGGACACGGCGGCTGCAGGAGG - Exonic
925596293 2:5558577-5558599 AGGCAGAAGTTTGCTGCAGGGGG - Intergenic
925821684 2:7805156-7805178 GGGTAGAAGAGGACTGCAGGGGG + Intergenic
929659352 2:43768657-43768679 CCCTAGAAATCAGCTGCAGGGGG - Intergenic
932599044 2:73111831-73111853 ACGTAGAAGCTGGCTGCAGGGGG - Intronic
938267201 2:129936511-129936533 CGTAAGAATTGGGCTGCAGGGGG + Intergenic
938653304 2:133406344-133406366 ATGCAGAAGTAGGCTGCAGGGGG + Intronic
1171524546 20:25798784-25798806 CAGTGGAAGTCGGCTCAAGGAGG - Intronic
1171531890 20:25858580-25858602 CGGTGGAAGTCAGCTCAAGGTGG - Intronic
1171543624 20:25984899-25984921 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1171552281 20:26057099-26057121 CAGTGGAAGTCGGCTCAAGGAGG + Intergenic
1171570834 20:26250521-26250543 CGGTGGAAGTCGGCTCAGGGAGG - Intergenic
1171571029 20:26251720-26251742 CGGTAGAAGTCGGCTCAAGGAGG - Intergenic
1171793417 20:29548391-29548413 AGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1171806757 20:29687956-29687978 CGGTGGAAGTCTGCTCAAGGAGG + Intergenic
1171846650 20:30281505-30281527 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1171847106 20:30283955-30283977 CAGTGGAAGTCGGCTCAAGGAGG + Intergenic
1171855043 20:30335988-30336010 CGGTGGAAGTCGGCTCAAGGAGG - Intergenic
1172685213 20:36748667-36748689 CGGTATCAGTATGCTGCAGGAGG - Intergenic
1173098489 20:40061197-40061219 AGGCAGAAGTCTGTTGCAGGTGG + Intergenic
1174183116 20:48687312-48687334 CGGGAGGAGCAGGCTGCAGGGGG - Intronic
1175653176 20:60746616-60746638 GGGAAGAAGTCAGCTGGAGGAGG + Intergenic
1176682277 21:9825590-9825612 CGGTGGAAGTCGGCTCAAGCAGG - Intergenic
1176682556 21:9826999-9827021 CGGTGGAAGTCGGCTCAAGCAGG - Intergenic
1176682834 21:9828418-9828440 CGGTGGAAGTCGGCTCAAGCAGG - Intergenic
1176683114 21:9829815-9829837 CGGTGGAAGTCGGCTCAAGCAGG - Intergenic
1176683393 21:9831225-9831247 CGGTGGAAGTCGGCTCAAGCAGG - Intergenic
1176683673 21:9832634-9832656 CGGTGGAAGTCGGCTCAAGCAGG - Intergenic
1176683952 21:9834037-9834059 CGGTGGAAGTCGGCTCAAGCAGG - Intergenic
1176684230 21:9835446-9835468 CGGTGGAAGTCGGCTCAAGCAGG - Intergenic
1176684509 21:9836847-9836869 CGGTGGAAGTCGGCTCAAGCAGG - Intergenic
1176685087 21:9839672-9839694 CGGAGGAAGTCGGCTCAAGGAGG - Intergenic
1177641098 21:23845619-23845641 AGGCAGAAGTCTGCCGCAGGGGG - Intergenic
1180572995 22:16747540-16747562 CGGTGGAAGTCGGCTCAGGGAGG - Intergenic
1180573204 22:16748734-16748756 CGGTAGAAGTCGGCTCAAGGAGG - Intergenic
1182137045 22:27915926-27915948 CTGAAGAAGTCATCTGCAGGTGG + Intronic
1183275691 22:36896151-36896173 AGGCAGAAGCCTGCTGCAGGAGG + Intergenic
1183336190 22:37248164-37248186 AGGGAGAGGTGGGCTGCAGGGGG - Intergenic
949195225 3:1297578-1297600 TGGTAGAAGTCCACTGCAGTAGG - Intronic
961374916 3:126457834-126457856 TGGTAAAACTCCGCTGCAGGTGG - Intronic
965834995 3:172841343-172841365 CGGTAGAAGTGGACAGAAGGGGG - Intergenic
968570426 4:1337599-1337621 AGGAAGAAGTCAGTTGCAGGTGG - Intronic
970157221 4:13153427-13153449 AGGCAGAAGTTTGCTGCAGGGGG - Intergenic
970382109 4:15518619-15518641 AGGCAGAAGTTTGCTGCAGGGGG - Intronic
971593462 4:28497924-28497946 AGGTAGAAGTCTGCTGTAGGTGG - Intergenic
972816972 4:42656281-42656303 CGGTGGGACTCCGCTGCAGGAGG + Intronic
974573714 4:63689171-63689193 AGGCAGAAGTCTGTTGCAGGGGG + Intergenic
979079147 4:116312176-116312198 AGGCAGAAGTCTGCTGCAGTCGG - Intergenic
979951328 4:126897246-126897268 AGGTAGAAGTCTGCTGCAAGAGG - Intergenic
980084450 4:128377185-128377207 AAGCAGAAGTCTGCTGCAGGGGG - Intergenic
980407031 4:132366558-132366580 AGGCAGAAGTCTGCTGCAAGGGG - Intergenic
982372425 4:154648041-154648063 TGGCAGAAGTAGGCTTCAGGAGG + Intronic
983419223 4:167496372-167496394 AGGCAGAAGTCTGCTGCAAGAGG - Intergenic
985649799 5:1102139-1102161 GGGAAGGAGGCGGCTGCAGGTGG + Intronic
985705926 5:1401372-1401394 CGGAATATGTCAGCTGCAGGTGG - Intronic
985850803 5:2387860-2387882 CGTCAGCAGTCGGCTGCTGGTGG + Intergenic
989778105 5:45233078-45233100 AGGTAAAAGTTTGCTGCAGGGGG - Intergenic
999286722 5:150398628-150398650 CCGTAGAAGTGGCCTGCCGGAGG + Intronic
999370570 5:151052571-151052593 GGGTAGAAGTCAGCTGGGGGAGG - Intronic
1000575057 5:162966693-162966715 AGGCAGAAGTCTGCTGCAGCGGG - Intergenic
1001826821 5:174751790-174751812 CGGGAGAAGGGGGCTGCAGCCGG - Intergenic
1005977942 6:30814457-30814479 CGGTAGAAGTCGGCTTGATGGGG + Intergenic
1010594575 6:77748265-77748287 AGGCAGAAGTCTGCTGCAGGGGG - Intronic
1013414648 6:109913583-109913605 CTGTTGAAGGAGGCTGCAGGTGG + Intergenic
1015178629 6:130338328-130338350 AGGCAGAAGTCTGCTGCAAGGGG + Intronic
1015954155 6:138583008-138583030 CGGCTGAACTCGGCTGAAGGTGG + Intronic
1017169911 6:151447177-151447199 AGGTAGGAGTGAGCTGCAGGAGG + Intronic
1017662473 6:156687593-156687615 CTGGAGAAGCCGGCGGCAGGGGG + Intergenic
1017953842 6:159161739-159161761 GGGTAGGAGTGGGCTGCAGCAGG + Intergenic
1025284578 7:57651434-57651456 CGGTGGAAGTCAGCTCAAGGAGG - Intergenic
1025285008 7:57653851-57653873 CGGTGGAAGTCGGCTTAAGGAGG - Intergenic
1025295383 7:57772181-57772203 CGGTGGAAGTCGGCTCAAGCAGG + Intergenic
1025301400 7:57821803-57821825 CGGCGGAAGTCGGCTCCAGGAGG + Intergenic
1026735160 7:72944695-72944717 CGGGTGAAGTCAGCTGCAGGAGG + Intronic
1026785501 7:73299624-73299646 CGGGTGAAGTCAGCTGCAGGAGG + Intergenic
1027108571 7:75420312-75420334 CGGGTGAAGTCAGCTGCAGGAGG - Intronic
1031249119 7:119357051-119357073 AGGCAGAAGTCTGCTGCAGCAGG - Intergenic
1031476036 7:122222915-122222937 GGGTAGAAGTGGCCTGCAGAGGG - Intergenic
1035304786 7:157924650-157924672 GGTAAGAAGTCCGCTGCAGGTGG + Intronic
1041476504 8:58272853-58272875 GGGTAGAAGTCAGCGGGAGGTGG + Intergenic
1043214462 8:77568869-77568891 TGGTAGAAGGTGGCAGCAGGGGG + Intergenic
1043418924 8:80079289-80079311 CTGTAGAAGTTGGGGGCAGGAGG - Intronic
1046878043 8:119277732-119277754 AGGTAGAAGTCTGCTGCAGGGGG - Intergenic
1047466879 8:125125310-125125332 CGTTAGAAGGCCACTGCAGGAGG - Intronic
1048700016 8:137078119-137078141 AGGTAGAAGTTTGCTGCAGGGGG + Intergenic
1050415172 9:5409047-5409069 AGGCAGAAGCCTGCTGCAGGGGG + Intronic
1053784336 9:41643736-41643758 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1053784898 9:41646611-41646633 CGGTGGAAGTCGGCTCAAGCAGG - Intergenic
1053792869 9:41699277-41699299 CGGCGGAAGTCGGCTCAAGGAGG - Intergenic
1054152308 9:61615548-61615570 CTGTGGAAGTCGGCTCAAGGAGG + Intergenic
1054160113 9:61667571-61667593 CGGTGGAAGTCGGCTCAAGCAGG + Intergenic
1054161430 9:61674305-61674327 CGGTGGAAGTCGGCTCAAGGAGG - Intergenic
1054172291 9:61853869-61853891 CCGTGGAAGTCGGCTCAAGGAGG + Intergenic
1054447150 9:65382896-65382918 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1054472080 9:65546691-65546713 CGGTGGAAGTCGGCTCAAGGAGG + Intergenic
1054665246 9:67726936-67726958 CCGTGGAAGTCGGCTCAAGGAGG - Intergenic
1056787668 9:89604475-89604497 CGCTAGTGGTCAGCTGCAGGGGG + Intergenic
1056827034 9:89883621-89883643 CGGTGGAGGGAGGCTGCAGGAGG - Intergenic
1057633665 9:96742261-96742283 AGTTAGCAGTGGGCTGCAGGTGG - Intergenic
1059069487 9:111120435-111120457 AGGTAGAGGTGTGCTGCAGGAGG - Intergenic
1062438789 9:136559748-136559770 AGACAGAAGTCTGCTGCAGGGGG + Intergenic
1203664607 Un_KI270754v1:14041-14063 TGGTGGAAGTCGGCTGAAGCAGG - Intergenic
1203665177 Un_KI270754v1:16856-16878 TGGTGGAAGTCGGCTGAAGCAGG - Intergenic
1188657624 X:32717515-32717537 AGGTAGAAGTCTGCTGCAGCGGG + Intronic
1188886796 X:35560885-35560907 CGGTAGAAAGAGGCTGCAGGTGG - Intergenic
1199346492 X:146746861-146746883 AGGTAGAAGTTTGCTGCAGTGGG - Intergenic