ID: 916091902

View in Genome Browser
Species Human (GRCh38)
Location 1:161314196-161314218
Sequence TAGAAGTCGGCTGCAGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1513
Summary {0: 1, 1: 0, 2: 2, 3: 94, 4: 1416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916091897_916091902 -8 Left 916091897 1:161314181-161314203 CCTGGCAAATTCCGGTAGAAGTC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 916091902 1:161314196-161314218 TAGAAGTCGGCTGCAGGAGGCGG 0: 1
1: 0
2: 2
3: 94
4: 1416
916091893_916091902 14 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091902 1:161314196-161314218 TAGAAGTCGGCTGCAGGAGGCGG 0: 1
1: 0
2: 2
3: 94
4: 1416
916091896_916091902 -1 Left 916091896 1:161314174-161314196 CCGAAATCCTGGCAAATTCCGGT 0: 1
1: 0
2: 0
3: 9
4: 93
Right 916091902 1:161314196-161314218 TAGAAGTCGGCTGCAGGAGGCGG 0: 1
1: 0
2: 2
3: 94
4: 1416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091902 Original CRISPR TAGAAGTCGGCTGCAGGAGG CGG Intergenic
901429140 1:9201811-9201833 AAGGAGTCAGCTGGAGGAGGAGG - Intergenic
902161824 1:14536592-14536614 TTGAAGTCGGCTGCGTGTGGTGG + Intergenic
902509140 1:16956084-16956106 GCGAACTGGGCTGCAGGAGGTGG + Exonic
903566780 1:24273731-24273753 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
903702970 1:25264292-25264314 CAGAAGTTTGCTGCAGGAGCAGG - Intronic
904769521 1:32872894-32872916 GAGAAGGCGGCTGAAGGAGGGGG + Intergenic
906579443 1:46924401-46924423 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
906586919 1:46986033-46986055 GAGAAGCAGGCTTCAGGAGGTGG + Intergenic
906655142 1:47542775-47542797 TAGAAGTTTGCTGCAGGGGTAGG + Intergenic
906834913 1:49073224-49073246 TAGAAGTAGGCTTCAGAAGATGG - Intronic
906901007 1:49836554-49836576 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
907015315 1:51006388-51006410 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
907353655 1:53854274-53854296 TAAAAGTTGGCAGCAGGAGAAGG - Intronic
907439263 1:54468785-54468807 CAGAAGTTTGCTGCAGGAGCAGG + Intergenic
907565770 1:55431730-55431752 CAGAAGTAGGCTTCAGGATGTGG + Intergenic
907953682 1:59207654-59207676 CAGAAGTAGGCTTCAGAAGGAGG + Intergenic
908450849 1:64252926-64252948 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
908584490 1:65553694-65553716 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
908598142 1:65710520-65710542 TAGAAGTAGGCTTCAGAATGTGG - Intergenic
908601287 1:65743178-65743200 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
909301259 1:74015531-74015553 CAGAAGTAGGCTTCAGGAGGTGG + Intergenic
909303213 1:74038988-74039010 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
909384362 1:75037818-75037840 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
909415800 1:75403861-75403883 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
909492999 1:76246783-76246805 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
909690010 1:78397215-78397237 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
909874485 1:80784707-80784729 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
910016696 1:82534078-82534100 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
910177340 1:84444234-84444256 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
910635579 1:89404438-89404460 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
910799662 1:91132391-91132413 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
910821859 1:91359267-91359289 CAGAAGTAGGCTACAGAAGGTGG + Intronic
911217846 1:95215666-95215688 AAGAAGTAGGCTTCAGAAGGTGG - Intronic
911530817 1:99040727-99040749 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
911669630 1:100593045-100593067 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
911985471 1:104616743-104616765 TAGAAGTTTGCTGCAGGGGAGGG - Intergenic
912076597 1:105883670-105883692 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
912235472 1:107845462-107845484 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
912270897 1:108208402-108208424 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
912405504 1:109434320-109434342 CAGAAGTTTGCTGCAGGAGCAGG - Intergenic
912676034 1:111681363-111681385 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
912882412 1:113429408-113429430 TGGGAGTGGGCTCCAGGAGGTGG + Intronic
912894736 1:113575166-113575188 CAGAAGTAGGCTTCAGGAGGTGG - Intronic
913108531 1:115638447-115638469 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
913208443 1:116563505-116563527 CAGAAGTTTGCTGCAGGAGTGGG - Intronic
913396350 1:118376455-118376477 AAGAAGTTTGCTGCAGGAGCAGG - Intergenic
914399539 1:147304987-147305009 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
914404741 1:147359130-147359152 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
914967008 1:152269124-152269146 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
914969361 1:152292993-152293015 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
915077223 1:153319263-153319285 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
915649235 1:157295383-157295405 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
915990751 1:160513026-160513048 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
915995535 1:160558651-160558673 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
916091902 1:161314196-161314218 TAGAAGTCGGCTGCAGGAGGCGG + Intergenic
916140685 1:161694294-161694316 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
916379811 1:164196664-164196686 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
916612675 1:166408902-166408924 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
916614726 1:166428437-166428459 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
916625478 1:166551418-166551440 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
916814426 1:168337703-168337725 CAGAAGTTTGCTGCAGGTGGAGG - Intergenic
916878598 1:168997574-168997596 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
917007179 1:170427602-170427624 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
917023245 1:170613505-170613527 CAGAAGTGGGCTTCAGAAGGTGG - Intergenic
917059274 1:171018568-171018590 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
917091872 1:171360700-171360722 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
917159695 1:172043611-172043633 AAGAGGTAGGCTACAGGAGGGGG + Intronic
917248446 1:173030669-173030691 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
917424656 1:174901649-174901671 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
917584844 1:176416170-176416192 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
917682625 1:177383859-177383881 CAGAAGTAGGCTCCAGAAGGTGG - Intergenic
917894912 1:179478320-179478342 CAGAAGTTTGCTGCAGGAGTGGG - Intronic
917900657 1:179540171-179540193 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
917915361 1:179695506-179695528 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
918160156 1:181890540-181890562 CAGAAGTAGGCTCCAGGAGGTGG + Intergenic
918167109 1:181960915-181960937 CAGAAGTAGGCTTCAGGAGGTGG - Intergenic
918353635 1:183684145-183684167 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
918943289 1:191028031-191028053 AAGAAGTAGGCTTCAGAAGGTGG + Intergenic
919124389 1:193378111-193378133 CAGAAGTTTGCTGCAGGAGCAGG + Intergenic
919146640 1:193644369-193644391 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
919223299 1:194660042-194660064 TAGAAGTAGGCTTTAGAAGGTGG + Intergenic
919231593 1:194780669-194780691 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
919599130 1:199600633-199600655 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
920428804 1:205900589-205900611 TAGAAGTAGGCTTCAGAAAGTGG + Intergenic
920625148 1:207589628-207589650 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
921461411 1:215432130-215432152 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
921496871 1:215853101-215853123 TAGAAGTTTGCTGCAGGGGCAGG - Intronic
921631478 1:217438392-217438414 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
921792728 1:219308765-219308787 CAGAAGTTTGCTGCAGGAGTAGG + Intergenic
921881128 1:220255443-220255465 CAGAAGTCGGCTTCAGAAGGTGG + Intronic
921943002 1:220863099-220863121 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
922011099 1:221588282-221588304 CAGAAGTTTGCTGCAGGAGTGGG + Intergenic
922058386 1:222063674-222063696 CAGAAGTTTGCTGCAGGAGTGGG - Intergenic
922379887 1:225012940-225012962 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
922396924 1:225211167-225211189 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
922693696 1:227714568-227714590 CAGAAGTAGGCTTCAGAAGGAGG + Intergenic
922716143 1:227873327-227873349 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
922937093 1:229431469-229431491 GAGAAGTCGCGTGCTGGAGGTGG + Exonic
923061106 1:230475604-230475626 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
923421863 1:233823445-233823467 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
924179854 1:241429935-241429957 CAGAAGTAGGCTTCAGCAGGTGG - Intergenic
924412515 1:243820464-243820486 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
924631515 1:245745214-245745236 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
924822979 1:247512487-247512509 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
924948166 1:248859489-248859511 TAGAAGTGGGCTGTAGCTGGTGG - Intergenic
1064848317 10:19681636-19681658 CAGAAGTCGGTTTCAGAAGGTGG - Intronic
1065075869 10:22079297-22079319 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1065735901 10:28752218-28752240 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1066058610 10:31703370-31703392 CAGAAGTCTGCTGCAGAAGCAGG + Intergenic
1066159803 10:32715563-32715585 CAGAAGTAGGCTTCAGGAGGTGG + Intronic
1066224998 10:33373553-33373575 TTGAAGTGGGAGGCAGGAGGAGG + Intergenic
1066699007 10:38106515-38106537 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1067236252 10:44453200-44453222 CAGAAGTGGGCTTCAGAAGGTGG - Intergenic
1067252151 10:44595302-44595324 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1067579419 10:47432810-47432832 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1067675543 10:48372386-48372408 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1068085962 10:52374206-52374228 CAGAAATAGGCTGCAGAAGGTGG - Intergenic
1068623140 10:59208588-59208610 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1068956048 10:62819033-62819055 TAGAAGGCGGGTGGAGGAGGGGG + Intronic
1069093348 10:64228964-64228986 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1069348843 10:67501942-67501964 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1069351368 10:67531079-67531101 TAGAAGTTTGCTGCAGGGGCAGG + Intronic
1069368743 10:67721636-67721658 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1069371069 10:67747773-67747795 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1069591313 10:69644078-69644100 TAGAAATCGGCTAGAGGAGGAGG - Intergenic
1069757332 10:70781355-70781377 TGGAGGTCAGCTCCAGGAGGGGG + Intronic
1070234326 10:74608209-74608231 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1070709363 10:78667490-78667512 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1071190201 10:83090338-83090360 CAGAAGTAGGCTTCAGAAGGGGG + Intergenic
1071272545 10:84021073-84021095 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1071401650 10:85279366-85279388 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1071844453 10:89506738-89506760 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1072024656 10:91443061-91443083 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1072025041 10:91446534-91446556 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1072394576 10:95025740-95025762 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1072493562 10:95933360-95933382 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1072872432 10:99133885-99133907 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1072953428 10:99868953-99868975 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1073698265 10:105894607-105894629 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1073942397 10:108713629-108713651 CAGAAGTTTGCTGCAGGAGCAGG + Intergenic
1073962509 10:108949693-108949715 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1074016624 10:109541564-109541586 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1074098456 10:110333971-110333993 TAGAAGTCAGGATCAGGAGGAGG + Intergenic
1074636202 10:115320847-115320869 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1074668368 10:115758139-115758161 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1075089373 10:119434868-119434890 TAGAAGTTTGCTGCAGGGGCGGG - Intronic
1075281972 10:121147009-121147031 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1075963482 10:126588868-126588890 CAGAAGTAGGCTTCAGAAGGAGG + Intronic
1076185267 10:128441541-128441563 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1077428170 11:2497644-2497666 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1077551802 11:3203726-3203748 CAGAAGGCGGCTGCAGCAGCAGG - Intergenic
1077696571 11:4398022-4398044 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1078336490 11:10467179-10467201 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1078686056 11:13533637-13533659 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1078691371 11:13583471-13583493 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1078732767 11:13991554-13991576 CAGAAGTAGGCTTCAGAAGGCGG - Intronic
1078809294 11:14742563-14742585 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1078810788 11:14759869-14759891 TAGAGCTCAGCTTCAGGAGGAGG + Intronic
1078813980 11:14801131-14801153 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1079262425 11:18896585-18896607 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1079426189 11:20343843-20343865 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1079437589 11:20473716-20473738 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1079510438 11:21204589-21204611 GAGAAGTAGGCTTCAGAAGGTGG - Intronic
1079580228 11:22055124-22055146 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1079654620 11:22973204-22973226 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1079736192 11:23999795-23999817 CAGAAGTTGGCTGCAGGGGCAGG - Intergenic
1079799659 11:24853599-24853621 AAGAAGTAGGCTTCAGAAGGTGG - Intronic
1079856385 11:25610467-25610489 AAGAAGTTTGCTGCAGGAGTGGG - Intergenic
1079993611 11:27272878-27272900 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1080083685 11:28252989-28253011 TAGAAGTCTGTTAGAGGAGGAGG - Intronic
1080118074 11:28642422-28642444 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1080965495 11:37210084-37210106 CAGAAGTAGGCTTTAGGAGGTGG - Intergenic
1081221719 11:40470548-40470570 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1081317608 11:41650064-41650086 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1081340014 11:41917045-41917067 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1081363418 11:42206494-42206516 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1081593052 11:44438481-44438503 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1082127702 11:48452789-48452811 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1082182711 11:49139821-49139843 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1082249716 11:49964632-49964654 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1082876194 11:57991668-57991690 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1082924518 11:58531215-58531237 TAGAAGTAGGCTTCAGAAGGTGG + Intronic
1083385393 11:62305633-62305655 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1083506286 11:63160502-63160524 TAGAAGTTTGCTGCAGGGGTGGG + Intronic
1083510351 11:63203319-63203341 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1083879482 11:65540945-65540967 TGGAACTCGGCTGCAGGGGCAGG + Exonic
1085434000 11:76482413-76482435 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1085755048 11:79195195-79195217 CAAAAGTCTGCTGCAGGAGTGGG + Intronic
1085827788 11:79865857-79865879 TAGAGGTAGGCTTCAGAAGGTGG + Intergenic
1085909006 11:80798962-80798984 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1086085906 11:82955343-82955365 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1086129337 11:83384133-83384155 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1086312159 11:85547963-85547985 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1086410851 11:86542318-86542340 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1086414365 11:86574185-86574207 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1086422044 11:86646213-86646235 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1086505434 11:87498861-87498883 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1086532228 11:87800160-87800182 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1086820616 11:91432569-91432591 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1087326236 11:96727099-96727121 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1087364089 11:97197685-97197707 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1087410540 11:97785553-97785575 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1087474632 11:98620507-98620529 CAGAAGTTGGCTGCAGGAGCAGG + Intergenic
1087667927 11:101071489-101071511 CAGAAGTAGGCTTCAGGAGGCGG + Intronic
1087690668 11:101317462-101317484 CAGAAGTTTGCTGCAGGGGGTGG - Intergenic
1087718644 11:101637115-101637137 CAGAAGTGGGCTTCAGAAGGTGG + Intronic
1087868389 11:103261862-103261884 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1087887901 11:103501662-103501684 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1087925271 11:103911641-103911663 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1088078175 11:105877887-105877909 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1088426943 11:109714700-109714722 TAGAAGTTTGCTGCAGGGGTGGG - Intergenic
1089078841 11:115760041-115760063 CAGAAGCCGGCGGCAGGAGCGGG + Intergenic
1089765900 11:120765436-120765458 TAGAAGTAGGCTTCAGAAGGTGG - Intronic
1089882320 11:121786798-121786820 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1090307922 11:125706129-125706151 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1090318532 11:125819104-125819126 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1090567248 11:128007645-128007667 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1090895984 11:130976064-130976086 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1091089882 11:132761786-132761808 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1091222542 11:133937729-133937751 CAGGGGTCGGCTGCAGTAGGAGG + Intronic
1091417253 12:298712-298734 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1091604828 12:1941486-1941508 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1092320853 12:7472737-7472759 CAGAAGTGGGCTTCAGAAGGTGG + Intronic
1092336433 12:7638340-7638362 TAGCAGGAGGCTGGAGGAGGAGG - Intergenic
1092581535 12:9848517-9848539 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1092581541 12:9848578-9848600 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1092703385 12:11257513-11257535 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1093277937 12:17152618-17152640 AAGAAGTTTGCTGCAGGAGTGGG - Intergenic
1093335911 12:17905049-17905071 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1093383218 12:18520693-18520715 CAGAAGTAGGCTTCAGAAGGGGG - Intronic
1093664333 12:21794522-21794544 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1094656880 12:32429004-32429026 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1094694856 12:32808503-32808525 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1094781942 12:33801837-33801859 CAGAAGTAGGCTTCAGAAGGAGG - Intergenic
1094827171 12:34278465-34278487 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1095084638 12:38048376-38048398 CAGAAGTCGGCTTCAGAACGTGG - Intergenic
1095128456 12:38509164-38509186 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1095230233 12:39731132-39731154 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1095356553 12:41281379-41281401 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1095406425 12:41871318-41871340 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1095488629 12:42709347-42709369 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1095547226 12:43386965-43386987 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1095674366 12:44898769-44898791 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1095779013 12:46038016-46038038 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1095831356 12:46590656-46590678 AAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1095920495 12:47525554-47525576 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1096015987 12:48275414-48275436 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1096894907 12:54811930-54811952 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1097340057 12:58427029-58427051 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1097375673 12:58840361-58840383 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1097404820 12:59176855-59176877 CAGAAGTTTGCTGCAGGAGCGGG - Intergenic
1097421976 12:59391161-59391183 CAGAAGTCGGCTTCAGAAAGTGG + Intergenic
1097455197 12:59791876-59791898 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1097517292 12:60620906-60620928 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1097526754 12:60746603-60746625 CAGAAGTAGGCTTCAGGAGGTGG + Intergenic
1097619635 12:61923751-61923773 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1097635069 12:62112960-62112982 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1097763223 12:63493107-63493129 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1097898666 12:64852463-64852485 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1097948685 12:65402591-65402613 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1098183051 12:67868844-67868866 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1098193494 12:67976037-67976059 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1098438648 12:70496194-70496216 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1098509169 12:71291695-71291717 CAGAAGTTTGCTGCAGGAGTGGG - Intronic
1098635754 12:72781363-72781385 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1098680742 12:73350354-73350376 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1098697188 12:73573577-73573599 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1098704731 12:73672547-73672569 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1098780294 12:74677548-74677570 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1098839862 12:75466088-75466110 AAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1099253592 12:80288877-80288899 CAGAAGTAGGCTTCAGGAAGTGG - Intronic
1099344421 12:81480388-81480410 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1099435131 12:82634158-82634180 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1099492187 12:83300913-83300935 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1099502556 12:83431978-83432000 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1099522644 12:83682707-83682729 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1099523624 12:83693816-83693838 CAGAAGTAGGCTTCAGGAGGTGG + Intergenic
1099527661 12:83735699-83735721 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1099540304 12:83899941-83899963 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1099550905 12:84042732-84042754 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1099568133 12:84278731-84278753 CAGAAGTCGGCTGCAGGGACTGG - Intergenic
1099694268 12:85997995-85998017 TAGAAGTTTGCTGCAGGGGCAGG - Intronic
1099809047 12:87557333-87557355 CAGAAGTCAGCTTCAGAAGGTGG + Intergenic
1099878566 12:88438135-88438157 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1099892360 12:88605493-88605515 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1100111183 12:91243718-91243740 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1100703307 12:97172405-97172427 CAGAAGTCAGCTGCAGAAAGTGG - Intergenic
1100740175 12:97582549-97582571 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1100768600 12:97897271-97897293 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1100896392 12:99186888-99186910 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1100941224 12:99724168-99724190 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1101069719 12:101061858-101061880 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1101296273 12:103426123-103426145 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1101601114 12:106211449-106211471 CAGAAGTAGGCTTCAGCAGGTGG - Intergenic
1102040282 12:109796507-109796529 TTGAGGTGGGCTCCAGGAGGGGG - Exonic
1102262427 12:111452006-111452028 TAGAGATCTGCTTCAGGAGGAGG - Intergenic
1102323572 12:111958509-111958531 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1102345439 12:112158185-112158207 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1105286181 13:19006703-19006725 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1105355247 13:19653574-19653596 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1105552347 13:21409861-21409883 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1105645667 13:22315422-22315444 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1105672563 13:22636052-22636074 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1105769549 13:23595271-23595293 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1106326207 13:28693038-28693060 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1106334950 13:28775870-28775892 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1106335885 13:28783177-28783199 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1106387681 13:29303316-29303338 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1106496894 13:30286556-30286578 CAGAAGTCTGCTGCAGGGGCAGG + Intronic
1106797268 13:33219430-33219452 AATAGGTCGGATGCAGGAGGTGG + Intronic
1107325696 13:39240003-39240025 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1107473334 13:40711846-40711868 CAGAAGTAGGCTTCAGAAGGAGG - Intergenic
1107641822 13:42452144-42452166 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1107648300 13:42517451-42517473 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1107970720 13:45640154-45640176 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1108029943 13:46219578-46219600 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1108153915 13:47565080-47565102 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1108235183 13:48395391-48395413 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1108262657 13:48674599-48674621 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1108304738 13:49119501-49119523 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1108383937 13:49880543-49880565 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1108559556 13:51628615-51628637 AAGAGGCCGGCTGCAGCAGGGGG - Intronic
1108850104 13:54718075-54718097 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1108940695 13:55948805-55948827 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1109163309 13:59003242-59003264 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1109188038 13:59292859-59292881 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1109393647 13:61725585-61725607 CAGAAGTCTGCTGCAGGGGTAGG - Intergenic
1109439473 13:62350242-62350264 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1109615546 13:64829184-64829206 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1109635405 13:65108869-65108891 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1109661498 13:65466588-65466610 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1109891304 13:68617820-68617842 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1110135634 13:72063450-72063472 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1110199589 13:72833246-72833268 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1110389842 13:74960630-74960652 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1110821708 13:79925187-79925209 GAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1110824808 13:79959253-79959275 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1110890419 13:80690806-80690828 CAGAAGTAGGCTTCAGGAGCTGG + Intergenic
1111029367 13:82575301-82575323 CAGAAGTTTGCTGCAGGATGGGG - Intergenic
1111045304 13:82806227-82806249 CAGAAGTAGGTTTCAGGAGGTGG + Intergenic
1111083506 13:83343061-83343083 CAGAAGTTTGCTGCAGGAGCAGG + Intergenic
1111114338 13:83755538-83755560 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1111219093 13:85180805-85180827 CAGAAGTCTGCTGCAGGGGCAGG + Intergenic
1111544888 13:89719569-89719591 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1111577546 13:90176083-90176105 TATAAGTAGGCTTGAGGAGGTGG - Intergenic
1111615074 13:90652472-90652494 AAGAAGTTTGCTGCAGGAGCAGG + Intergenic
1111621606 13:90732011-90732033 CAGAAGTTTGCTGCAGGAGTAGG + Intergenic
1111635199 13:90893811-90893833 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1111799065 13:92960134-92960156 TAGAAGTTTGCTGCAGGGGCAGG - Intergenic
1112152058 13:96774343-96774365 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1112165983 13:96919884-96919906 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1112231731 13:97594376-97594398 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1112620026 13:101045922-101045944 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1114418273 14:22558513-22558535 TGGAAGCCGGAAGCAGGAGGTGG - Intronic
1114710198 14:24769615-24769637 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1114745119 14:25137885-25137907 CAGAAGTTGGCTTCAGAAGGTGG + Intergenic
1114798130 14:25739973-25739995 CAGAAGTTTGCTGCAGGGGGAGG - Intergenic
1114845023 14:26310078-26310100 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1114869984 14:26644785-26644807 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1115124326 14:29973501-29973523 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1115265506 14:31495565-31495587 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1115357303 14:32461743-32461765 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1115359671 14:32487520-32487542 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1115385340 14:32789884-32789906 CAGAAGTAGGCTTCAGGAGGTGG + Intronic
1115690883 14:35843156-35843178 CAGAAGTAGGCTTCAGTAGGTGG - Intronic
1115912027 14:38267921-38267943 CAGAAGTAGGCTTCAGGAGGTGG - Intergenic
1116002381 14:39258562-39258584 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1116273227 14:42799246-42799268 AAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1116301535 14:43189209-43189231 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1116362788 14:44022981-44023003 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1116428750 14:44821273-44821295 CAGAAATAGGCTGCAGAAGGTGG + Intergenic
1116511762 14:45755586-45755608 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1116771330 14:49130749-49130771 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1117121207 14:52569455-52569477 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1117172528 14:53114888-53114910 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1117299115 14:54406818-54406840 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1117466378 14:55999039-55999061 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1117533731 14:56684656-56684678 AAGTAGTCTGCTGGAGGAGGTGG + Intronic
1117616945 14:57544064-57544086 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1117624370 14:57619703-57619725 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1117641176 14:57800529-57800551 CAGAAGTAGGCTTCAGAAGGGGG + Intronic
1117751178 14:58924915-58924937 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1117821989 14:59658896-59658918 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1117829382 14:59734398-59734420 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1117849938 14:59957607-59957629 TAGAAGTAGGCTTCAGAAGGTGG - Intronic
1117857436 14:60050544-60050566 TAGAAGTAGGCTTCAGAAGGTGG - Intronic
1117859498 14:60074624-60074646 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1118544844 14:66874419-66874441 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1120271656 14:82321061-82321083 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1120368874 14:83607110-83607132 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1120575337 14:86174648-86174670 TAAAAGTTTGCTGCAGGAGTGGG + Intergenic
1120643249 14:87040846-87040868 TTGAAGTCGGCTGCAGTGAGGGG + Intergenic
1120659023 14:87230676-87230698 CAGAAGTATGCTGCAGGAGGTGG - Intergenic
1120770237 14:88371035-88371057 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1120799302 14:88670581-88670603 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1121199944 14:92108452-92108474 TAGGAGGAGGATGCAGGAGGCGG + Intergenic
1121490462 14:94355408-94355430 TATAACTGGGGTGCAGGAGGTGG - Intergenic
1121899115 14:97675731-97675753 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1122262619 14:100531835-100531857 GGGAAGGAGGCTGCAGGAGGGGG - Intergenic
1122374646 14:101249712-101249734 TTGAAGTCGGCAGGAGGAGGTGG - Intergenic
1122684691 14:103496175-103496197 AAGGAGGCAGCTGCAGGAGGAGG - Intronic
1202842729 14_GL000009v2_random:138039-138061 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1202912124 14_GL000194v1_random:128281-128303 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1202880494 14_KI270722v1_random:54348-54370 CAGAAGTAGGCTTCAGAAGGCGG + Intergenic
1123429111 15:20199808-20199830 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1123817442 15:23994298-23994320 TATGAGTAGGCTGGAGGAGGTGG + Intergenic
1124197066 15:27640312-27640334 TAGAAGTAGGCTTCAGCAGGTGG + Intergenic
1124474381 15:30019869-30019891 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1124964339 15:34422121-34422143 TAGAACACTGCTACAGGAGGCGG - Intronic
1124980958 15:34568349-34568371 TAGAACACTGCTACAGGAGGCGG - Intronic
1125054457 15:35341346-35341368 TAGAAGTAGGCTTCAGAAGGTGG - Intronic
1125180867 15:36880196-36880218 AAGGAGGCGGCTGGAGGAGGGGG - Intergenic
1125227300 15:37409310-37409332 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1125257168 15:37778252-37778274 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1125288647 15:38120891-38120913 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1126126407 15:45298216-45298238 CAGAAGTCTGCTGCAGGGGTGGG + Intergenic
1126500401 15:49339108-49339130 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1126554213 15:49967283-49967305 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1126720205 15:51569954-51569976 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1126784422 15:52164874-52164896 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1126825065 15:52540380-52540402 CAGAAGTCTGCTGCAGGAGCAGG - Intergenic
1127282121 15:57501592-57501614 AAGAAGTGGGGAGCAGGAGGAGG + Intronic
1127317743 15:57814096-57814118 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1127373865 15:58364068-58364090 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1128528773 15:68430676-68430698 TAGAAGCCAGCTGCGGGAGGAGG - Intronic
1128852382 15:70972964-70972986 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1128883813 15:71266623-71266645 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1129495447 15:75976314-75976336 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1129563347 15:76593988-76594010 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1129620194 15:77137175-77137197 CAGAAGTTGGCTGCAGGGGTCGG + Intronic
1130448762 15:84030047-84030069 CAGAAGTTTGCTGCAGGAGTAGG + Intronic
1130728545 15:86466471-86466493 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1130738981 15:86577899-86577921 TAGAAGTTTGCTGCAGGGGCAGG + Intronic
1130778415 15:87009435-87009457 CAGAAGTTTGCTGCAGGAGCAGG + Intronic
1130779311 15:87017811-87017833 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1130886137 15:88094142-88094164 AAGAAGTGGGCTGCAGGAAGGGG + Intronic
1130891200 15:88135441-88135463 TGGAAGGCTACTGCAGGAGGTGG - Intronic
1131589565 15:93733719-93733741 TAGAACTTGGCTGCAGCAGCAGG + Intergenic
1131784743 15:95899993-95900015 TAGAAATTGGCTGCTGGAGGGGG + Intergenic
1132222464 15:100115232-100115254 TGTGAGTCGGATGCAGGAGGTGG - Intronic
1133956850 16:10452097-10452119 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1134476094 16:14575105-14575127 AAGAAGTCTGCTGCAGGGGTGGG + Intronic
1136352371 16:29719319-29719341 TATGAGTAGGCTGGAGGAGGCGG - Intergenic
1136855208 16:33649924-33649946 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1137239368 16:46641670-46641692 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1137336346 16:47553514-47553536 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1137828234 16:51517942-51517964 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1138818754 16:60233494-60233516 TAGAAGTCGAGTGCAGGTGGAGG + Intergenic
1138887049 16:61091926-61091948 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1140165383 16:72544698-72544720 CAGAAGTAGGTTTCAGGAGGTGG + Intergenic
1140182573 16:72735533-72735555 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1141214222 16:82009150-82009172 CAGAAGTTGGCTGCAGGGGTGGG + Intronic
1203116790 16_KI270728v1_random:1498408-1498430 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1142720335 17:1771626-1771648 AGGAAGTGGGCTGCAGGAGACGG + Intronic
1144356948 17:14455270-14455292 TAGAAGCCAGCTACAGAAGGTGG + Intergenic
1145246509 17:21273229-21273251 TAGAAGGAGGCTGAGGGAGGAGG - Intergenic
1146742973 17:35302316-35302338 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1146758921 17:35458740-35458762 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1146817275 17:35953057-35953079 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1146825803 17:36022511-36022533 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1147028348 17:37609156-37609178 TGGAACTGGGCTGCGGGAGGAGG - Intronic
1148747689 17:49927652-49927674 TTGAAGTGGGTTGGAGGAGGGGG - Intergenic
1148967526 17:51448150-51448172 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1148981158 17:51575862-51575884 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1149216195 17:54357465-54357487 TAGAAGTATGCTGCAGGGGTGGG - Intergenic
1149281138 17:55107415-55107437 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1149352071 17:55800553-55800575 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1150090906 17:62323774-62323796 CAGAAGTAGGCTTCAGGAGGTGG + Intergenic
1150196376 17:63304062-63304084 CAGAAGTGGGCTTCAGAAGGTGG - Intronic
1150545919 17:66156545-66156567 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1151326389 17:73382322-73382344 TAGAAGACGGCAGCAGGCAGGGG - Intronic
1151663766 17:75533964-75533986 CAGATGTCAGCTCCAGGAGGTGG - Intronic
1151757191 17:76081732-76081754 GAGCAGTGGGTTGCAGGAGGAGG - Exonic
1153562111 18:6382310-6382332 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1153858233 18:9172696-9172718 TAGAAGTAGGCTTCAGAAGGTGG - Intronic
1154101415 18:11478416-11478438 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1155150151 18:23116708-23116730 TAGAAGAAGCCTGCAGGAGCTGG - Intergenic
1155665053 18:28298495-28298517 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1156188246 18:34689122-34689144 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1156230618 18:35151165-35151187 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1156415014 18:36878994-36879016 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1156664708 18:39390933-39390955 CAGAAGTAGGCTTCAGGAAGTGG + Intergenic
1157066415 18:44356162-44356184 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1157178730 18:45476960-45476982 CAGAAGTAGGCTTCAGAAGGCGG - Intronic
1157442612 18:47722133-47722155 GAGAAGCTTGCTGCAGGAGGGGG - Intergenic
1158073130 18:53496622-53496644 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1158297546 18:56015531-56015553 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1158373303 18:56833000-56833022 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1158676853 18:59528443-59528465 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1159581460 18:70237880-70237902 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1159645664 18:70915731-70915753 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1159661103 18:71097101-71097123 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1159901907 18:74054422-74054444 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1160551436 18:79696118-79696140 AGGAGGGCGGCTGCAGGAGGAGG + Intronic
1160697809 19:493177-493199 TTGATGGAGGCTGCAGGAGGGGG - Intronic
1162066571 19:8129359-8129381 TTGATGTCTGCGGCAGGAGGAGG + Exonic
1163908138 19:20165576-20165598 TAGAAGTAGGCTTCAGAAGATGG + Intergenic
1163990005 19:20989340-20989362 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1164059006 19:21649308-21649330 GAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1164067659 19:21734227-21734249 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1164152248 19:22565335-22565357 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1164178733 19:22801411-22801433 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1164416745 19:28051865-28051887 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1164599882 19:29553619-29553641 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1164850745 19:31481971-31481993 TAGGAGTGGGCTGGAGGAAGAGG + Intergenic
1166105541 19:40596473-40596495 GATAAGTGGGGTGCAGGAGGGGG + Intronic
1167491124 19:49793105-49793127 TAGATATTGGCTGCTGGAGGTGG + Intronic
1168457836 19:56527488-56527510 CAGAAGTAGGCTTCAGAAGGTGG + Exonic
1168496221 19:56853929-56853951 CAGAAGTCTGCTGCAGGGGTAGG + Intergenic
1168530723 19:57126737-57126759 TAGAACTAGGCTTCAGAAGGTGG - Intronic
1202656103 1_KI270708v1_random:23450-23472 CAGAAGTAGGCTTCAGAAGGCGG + Intergenic
925245177 2:2376406-2376428 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
925484375 2:4312342-4312364 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
925789585 2:7470473-7470495 AGGAAGTCACCTGCAGGAGGTGG + Intergenic
926483317 2:13426765-13426787 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
926483951 2:13432356-13432378 CAGAAGTTTGCTGCAGGAGTGGG - Intergenic
926797776 2:16632933-16632955 TAGCACAGGGCTGCAGGAGGGGG + Intronic
926873290 2:17446692-17446714 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
927076371 2:19581766-19581788 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
927182927 2:20459772-20459794 CAGAAGTAGGCTCCAGAAGGTGG + Intergenic
928750791 2:34467671-34467693 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
928758171 2:34551105-34551127 TGGAAGCAGGCTGCAGGGGGAGG + Intergenic
929062778 2:37940869-37940891 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
929064619 2:37961668-37961690 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
929115592 2:38441348-38441370 AAGAGGTGGGCTGCAGGAGACGG + Intergenic
929333394 2:40711900-40711922 CAGAAGTAGGCTTCAGAAGGGGG - Intergenic
929612838 2:43284561-43284583 CAGAAGTCTGCTGCAGGAGTGGG + Intronic
929956752 2:46464128-46464150 TAGAAGACTGAGGCAGGAGGAGG - Intronic
930216877 2:48706869-48706891 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
930223213 2:48766862-48766884 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
930323465 2:49883338-49883360 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
930359457 2:50359270-50359292 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
930440027 2:51392674-51392696 AAGAAGTAGGCTTCAGAAGGTGG + Intergenic
930476862 2:51892475-51892497 CAGAAGTAGGGTTCAGGAGGGGG + Intergenic
930581360 2:53216439-53216461 CAGAAATAGGCTTCAGGAGGTGG - Intergenic
931004228 2:57829113-57829135 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
931074096 2:58689656-58689678 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
931362773 2:61592207-61592229 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
931480528 2:62634439-62634461 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
931529665 2:63199662-63199684 CAGAAGTCTGCTGCAGGGGCAGG + Intronic
931814967 2:65891119-65891141 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
931886580 2:66624966-66624988 AAGAAGTAGGCTTCAGAAGGTGG - Intergenic
932581380 2:72994684-72994706 TGGAAGTGGGCTGGAGGAGAAGG - Intronic
932646648 2:73510196-73510218 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
932899639 2:75682607-75682629 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
933008238 2:77023000-77023022 CAGAAGTTTGCTGCAGGAGCAGG - Intronic
933166510 2:79082732-79082754 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
933413070 2:81950183-81950205 TAGAAGTAGGCCTCAGAAGGTGG - Intergenic
934106901 2:88703356-88703378 CAGAAGTTTGCTGCAGGAGTGGG - Intronic
934622737 2:95825423-95825445 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
934811041 2:97276680-97276702 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
934826651 2:97431259-97431281 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
935010815 2:99134557-99134579 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
935162075 2:100537912-100537934 TATGAGTAGGCTGGAGGAGGTGG + Intergenic
935325961 2:101936823-101936845 TAGAATTAGGCTTCAGAAGGTGG + Intergenic
935567825 2:104628674-104628696 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
935625961 2:105172499-105172521 TAAAAGTTTGCTGCAGGAGCAGG - Intergenic
935929835 2:108112678-108112700 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
936518600 2:113198047-113198069 TAGAAAGCGGCAGCAGGAAGAGG + Intronic
936685360 2:114821113-114821135 TATGAGTAGGCTGGAGGAGGTGG + Intronic
937031525 2:118744718-118744740 CAGAAGTTTGCTGCAGGAGCAGG - Intergenic
937562834 2:123245894-123245916 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
937807423 2:126161938-126161960 CAGAAATCGGCTTCAGAAGGTGG + Intergenic
938224161 2:129601560-129601582 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
938874291 2:135517251-135517273 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
939116775 2:138070315-138070337 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
939180517 2:138797103-138797125 CAGAAGTGGGCTTCAGAAGGTGG + Intergenic
939381906 2:141447391-141447413 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
939652943 2:144786435-144786457 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
939687015 2:145212808-145212830 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
939762421 2:146199145-146199167 TAGAAGTTTGCTGCAGGGGTGGG + Intergenic
939876561 2:147585436-147585458 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
940054412 2:149499193-149499215 CAGAAGTTGGCTTCAGAAGGTGG - Intergenic
940096209 2:149978680-149978702 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
940400837 2:153245811-153245833 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
940407961 2:153327772-153327794 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
940821533 2:158360838-158360860 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
940925302 2:159357138-159357160 CAGAAGTGGGCTTCAGAAGGTGG + Intronic
940964640 2:159823110-159823132 CAGAAGTGGGCTTCAGAAGGTGG + Intronic
941041340 2:160627549-160627571 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
941076530 2:161011455-161011477 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
941088414 2:161146299-161146321 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
941149129 2:161891774-161891796 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
941478174 2:165972927-165972949 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
941565234 2:167098520-167098542 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
941682195 2:168412022-168412044 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
941845434 2:170127068-170127090 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
941886098 2:170529207-170529229 TAGAGGTCGGGAGGAGGAGGAGG + Intronic
942010737 2:171760491-171760513 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
942200039 2:173561080-173561102 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
942319599 2:174724848-174724870 TAGAAGTTTGCTGCAGGAGCAGG - Intergenic
942989363 2:182181065-182181087 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
943004735 2:182375762-182375784 CAGAAGTTTGCTGCAGGATGGGG - Intronic
943047327 2:182874184-182874206 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
943112217 2:183620929-183620951 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
943350844 2:186794154-186794176 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
943408629 2:187519120-187519142 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
943446744 2:187995805-187995827 TATGAGTAGGCTGGAGGAGGTGG - Intergenic
943478179 2:188385154-188385176 CAGAAGTTTGCTGCAGGAGTAGG - Intronic
943552351 2:189356712-189356734 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
943836963 2:192525639-192525661 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
944094668 2:195952910-195952932 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
944169300 2:196757596-196757618 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
944292174 2:198019398-198019420 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
944347532 2:198685956-198685978 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
944400520 2:199320544-199320566 TAGAGCTGAGCTGCAGGAGGTGG + Intronic
944421706 2:199537514-199537536 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
944608067 2:201370793-201370815 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
944764492 2:202850300-202850322 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
945024207 2:205605185-205605207 TAGAAGTAGGCTTCAGAAGGTGG - Intronic
945371271 2:209021316-209021338 TAGAAGTAGGCTTCAGAAAGTGG + Intergenic
945389128 2:209242593-209242615 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
945409315 2:209489454-209489476 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
945533630 2:210986194-210986216 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
945643518 2:212461052-212461074 TAGAAGTTTGCTGCAGGGGAAGG + Intronic
945675928 2:212855660-212855682 GAGAAGGTGGCTGAAGGAGGTGG - Intergenic
945927539 2:215820490-215820512 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
946913128 2:224486276-224486298 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
947225719 2:227838661-227838683 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
948395189 2:237640207-237640229 TAGAAGTCGGCTGCAGGCTCAGG + Intronic
948458799 2:238119376-238119398 AAGGAGTTGGATGCAGGAGGTGG + Intronic
948902383 2:240963174-240963196 TAGACGCCGGGGGCAGGAGGTGG + Intronic
1169176776 20:3523077-3523099 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1169319912 20:4624297-4624319 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1169396915 20:5240721-5240743 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1169416824 20:5424282-5424304 TAAATGTAGGCTGCAGGAGCAGG - Intergenic
1169606005 20:7319794-7319816 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1169979104 20:11363790-11363812 CAGAAGTCGGCTTCAGAAGATGG - Intergenic
1170229259 20:14027438-14027460 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1170364922 20:15588044-15588066 CAGAAGTTTGCTGCAGGAGCAGG - Intronic
1170454740 20:16521181-16521203 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1170727197 20:18940827-18940849 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1170730115 20:18966601-18966623 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1171441532 20:25167096-25167118 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1172307632 20:33892530-33892552 TAGTAGTCTGCTGCTGGAGAAGG + Intergenic
1173149504 20:40553921-40553943 CAGAAGTCGGCTTCAGAAGGTGG + Intergenic
1173751027 20:45477155-45477177 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1174548591 20:51344819-51344841 TAGCAGTCAGGTGCAGGAAGAGG - Intergenic
1174990015 20:55499557-55499579 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1175242097 20:57557173-57557195 TACAAGGCCCCTGCAGGAGGGGG - Intergenic
1176523073 21:7839244-7839266 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1176631479 21:9142958-9142980 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1176641821 21:9311899-9311921 CAGAAGTAGGCTTCAGAAGGCGG + Intergenic
1176987537 21:15455347-15455369 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1177092117 21:16782079-16782101 AAGAAGTTGGCTTCAGAAGGTGG + Intergenic
1177184053 21:17774723-17774745 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1177332750 21:19683376-19683398 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1177722079 21:24919869-24919891 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1178657093 21:34469256-34469278 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1178761188 21:35404365-35404387 TAGAAGACGGCTGCAGAATCAGG - Intronic
1180375111 22:12084649-12084671 CAGAAGTAGGCTTCAGAAGGCGG + Intergenic
1182204619 22:28610734-28610756 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1182420702 22:30247235-30247257 GAGAAGGAGGCTCCAGGAGGAGG + Intergenic
1182505927 22:30782312-30782334 TAGTGGTTGTCTGCAGGAGGTGG - Intronic
1182992142 22:34778189-34778211 CAGAGGTCGGCTGCAGGGGTGGG + Intergenic
1183021356 22:35029924-35029946 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1183461460 22:37953482-37953504 TAGAAGTGGGCTCCCGGAGGCGG + Exonic
1183501910 22:38185338-38185360 AAGAAGTCGGCTGGGGGTGGTGG - Intronic
949175919 3:1062761-1062783 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
949222576 3:1653556-1653578 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
949377791 3:3408732-3408754 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
949423393 3:3890597-3890619 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
949440280 3:4072495-4072517 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
949955189 3:9261362-9261384 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
950195391 3:11005809-11005831 GAGACGTCTGCTGCAGGATGAGG - Intronic
950326008 3:12110554-12110576 AAGAAGTCTGCTGCAGGGGCAGG - Intronic
950561851 3:13735377-13735399 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
950992164 3:17450396-17450418 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
951137379 3:19119094-19119116 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
951237584 3:20253662-20253684 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
951347090 3:21560136-21560158 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
951432741 3:22627484-22627506 TAGAAGTAGGCTTCAGAAGTTGG - Intergenic
951468988 3:23035380-23035402 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
951503529 3:23417028-23417050 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
951777121 3:26323046-26323068 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
951826798 3:26877011-26877033 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
951996458 3:28735745-28735767 CAGAAGTAGGCTTCAGAAGGGGG - Intergenic
952607850 3:35171928-35171950 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
952831398 3:37568077-37568099 CAGAAATCTGCTGCAGGAGTGGG - Intronic
953092466 3:39742945-39742967 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
953102210 3:39841432-39841454 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
953264401 3:41371807-41371829 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
953286782 3:41617785-41617807 CAGAAGTAGGCTTCAGAAGGCGG + Intronic
953446637 3:42974236-42974258 CAGAAGTTTGCTGCAGGAGTGGG + Intronic
953895050 3:46791110-46791132 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
954016842 3:47700603-47700625 TTGAAGGAGGTTGCAGGAGGCGG - Intronic
954508063 3:51096621-51096643 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
954510374 3:51119941-51119963 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
954525088 3:51262581-51262603 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
954950669 3:54469592-54469614 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
954978551 3:54722387-54722409 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
955069940 3:55563982-55564004 GAGAAGTTGGATACAGGAGGAGG + Intronic
955453839 3:59099490-59099512 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
955644359 3:61120757-61120779 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
955657698 3:61262811-61262833 AAGAAGTAGGCTTCAGAAGGTGG - Intergenic
955831989 3:63014853-63014875 CAGAAGTCAGCTTCAGAAGGTGG - Intergenic
956169531 3:66421827-66421849 TAGAAGTTTGCTGCAGGGGCGGG - Intronic
956220217 3:66894191-66894213 CAGAAGTAGGCTGCAGAAGGTGG + Intergenic
956243544 3:67155435-67155457 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
956382925 3:68685411-68685433 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
956396501 3:68832157-68832179 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
957098310 3:75798756-75798778 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
957449874 3:80366085-80366107 TAGATGTCGGCTAAATGAGGAGG + Intergenic
957489576 3:80906274-80906296 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
957596482 3:82273376-82273398 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
957929765 3:86863093-86863115 CAGAAGTTTGCTGCAGGAGTGGG + Intergenic
958006058 3:87812984-87813006 CAGAAGTCTGCTGCAGGGGTAGG + Intergenic
958257330 3:91340376-91340398 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
958261127 3:91382729-91382751 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
958434384 3:94079906-94079928 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
958522113 3:95203784-95203806 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
958586369 3:96092341-96092363 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
958622090 3:96575264-96575286 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
958996401 3:100910258-100910280 GGGAAGTCGGGGGCAGGAGGAGG + Intronic
959025784 3:101237884-101237906 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
959026712 3:101247948-101247970 TAGAAGTCTCCTGGAGGAGGGGG - Intronic
959030960 3:101299369-101299391 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
959091678 3:101910421-101910443 AAGAAGTAGGCTTCAGAAGGTGG - Intergenic
959119990 3:102222068-102222090 CAGAAGTAGGCTTCAGTAGGTGG - Intronic
959256345 3:104019725-104019747 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
959278332 3:104305465-104305487 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
959291757 3:104484171-104484193 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
959292025 3:104486109-104486131 CAGAAGTAGGCTTCAGGAGGTGG + Intergenic
959341340 3:105135366-105135388 TATAAGGAGGCTGGAGGAGGTGG - Intergenic
959390112 3:105762663-105762685 TAGAAGTTTGCTGCAGGGGCAGG + Intronic
959428549 3:106223366-106223388 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
959439725 3:106360605-106360627 TAGAAGTCTGCTACAGGGGAGGG + Intergenic
959506050 3:107157159-107157181 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
959508201 3:107178067-107178089 CAGAAGTCTGCTGCAGGGGCAGG - Intergenic
959534735 3:107471525-107471547 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
959617761 3:108367369-108367391 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
959624349 3:108432853-108432875 CAGAAGTTTGCTGCAGGAGCGGG + Intronic
959815936 3:110672722-110672744 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
959848212 3:111057826-111057848 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
959881074 3:111446080-111446102 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
959883404 3:111472869-111472891 CAGAAGTAGGCTTCAGAAGGAGG - Intronic
960177421 3:114533153-114533175 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
960278302 3:115752037-115752059 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
960579967 3:119268350-119268372 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
960764487 3:121111215-121111237 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
961156102 3:124681026-124681048 TAGATGTCAGCTGCAAGTGGAGG + Intronic
961257800 3:125571788-125571810 CAGAGGTCTGCTGCAGGAGCAGG + Intronic
961310719 3:125997714-125997736 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
961522985 3:127478677-127478699 TAGGAGTCCGCTGCATGAAGGGG + Intergenic
961998106 3:131268248-131268270 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
962180968 3:133206277-133206299 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
962512475 3:136115411-136115433 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
962576930 3:136763467-136763489 TAGAAGTTTGCTGCAGGGGTGGG + Intergenic
962640001 3:137376275-137376297 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
962765841 3:138561553-138561575 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
962913981 3:139882416-139882438 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
962984334 3:140521114-140521136 TAGAAGTAGGCATCAGAAGGTGG - Intronic
963027576 3:140934516-140934538 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
963401602 3:144805967-144805989 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
963481372 3:145879064-145879086 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
963898806 3:150713309-150713331 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
963980376 3:151529872-151529894 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
964007633 3:151851242-151851264 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
964377899 3:156068140-156068162 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
964648957 3:158990563-158990585 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
964904968 3:161708230-161708252 CAGAAGTCGGCTTCAGAAGGTGG + Intergenic
965089988 3:164149673-164149695 CAGAAGTCTGCTGCAGGGGTGGG - Intergenic
965090944 3:164162394-164162416 GAGAAGTAGGCTTCAGAAGGTGG - Intergenic
965324884 3:167290719-167290741 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
965342989 3:167512625-167512647 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
965497400 3:169414547-169414569 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
965880597 3:173383319-173383341 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
966251208 3:177866884-177866906 CAGAAGTAGGCTTCAGCAGGTGG + Intergenic
966291319 3:178362274-178362296 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
966309559 3:178577532-178577554 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
966325242 3:178746142-178746164 CAGAAGTTTGCTGCAGGAGTGGG - Intronic
966454893 3:180103267-180103289 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
966493859 3:180557466-180557488 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
966561319 3:181324213-181324235 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
966573682 3:181476365-181476387 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
966706301 3:182919132-182919154 TCTAAGTCGGCTGCAGAAAGAGG - Exonic
967638742 3:191835614-191835636 TAGAAGTAGACTTCAGAAGGTGG + Intergenic
967715737 3:192759226-192759248 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1202745073 3_GL000221v1_random:93119-93141 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
968892856 4:3380522-3380544 TAGAAGTTAGCTGCAGGGGTGGG - Intronic
969121918 4:4917077-4917099 CAGAAGTCTGCTGCAGAAGTGGG - Intergenic
969123260 4:4925296-4925318 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
969164685 4:5297759-5297781 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
969177029 4:5406502-5406524 TAGAAGTCTGCTGCAGGGGTGGG - Intronic
969869576 4:10096225-10096247 TAGAAGCCGGCTGTGGGTGGGGG - Intronic
969909058 4:10427088-10427110 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
969925335 4:10579934-10579956 TAGGAGGAGGCTGGAGGAGGTGG - Intronic
969970894 4:11047231-11047253 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
970157220 4:13153424-13153446 CAGAAGTTTGCTGCAGGGGGTGG - Intergenic
970214409 4:13744353-13744375 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
970288062 4:14540091-14540113 TAGAAGTAGGCTTCAGAAGATGG + Intergenic
970382108 4:15518616-15518638 CAGAAGTTTGCTGCAGGGGGAGG - Intronic
970679529 4:18490501-18490523 CAGAAGTAGGCTTCAGAAGGGGG + Intergenic
970685371 4:18560593-18560615 CAGAAGTAGGCTACAGAAGGTGG + Intergenic
971476539 4:27077839-27077861 AAGAAGTCAGTTGGAGGAGGAGG + Intergenic
971906558 4:32733179-32733201 AAGGAGTCGGCTTCAGAAGGTGG + Intergenic
971943078 4:33240612-33240634 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
971988838 4:33865097-33865119 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
972056177 4:34806082-34806104 CAGAAGTTTGCTGCAGGAGCGGG - Intergenic
972219452 4:36936782-36936804 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
972251285 4:37304970-37304992 AAGAAGTTTGCTGCAGGAGTGGG - Intronic
972500522 4:39674004-39674026 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
972783984 4:42310414-42310436 TATGAGTAGGCTGGAGGAGGTGG + Intergenic
972887494 4:43510248-43510270 CAGAAGTCTGCTGCAGGGGTGGG - Intergenic
972962881 4:44474877-44474899 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
972990058 4:44813879-44813901 TAGAAGTAGGCTTCAGAATGCGG - Intergenic
973081725 4:46002265-46002287 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
973562775 4:52152663-52152685 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
973629235 4:52803153-52803175 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
973661056 4:53106384-53106406 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
973679777 4:53304803-53304825 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
973715089 4:53668791-53668813 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
973837612 4:54825866-54825888 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
974263833 4:59559552-59559574 CAGAAGTAGGCTACAGAAGGTGG - Intergenic
974280154 4:59781280-59781302 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
974339944 4:60602836-60602858 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
974487580 4:62525013-62525035 TAGAAGTTTGCTGCAGGGGCGGG + Intergenic
974539662 4:63218309-63218331 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
974793138 4:66715068-66715090 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
974814087 4:66982903-66982925 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
974943960 4:68504103-68504125 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
975096778 4:70465413-70465435 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
975246005 4:72120912-72120934 CAGAAGTGGGCTTCAGAAGGTGG + Intronic
975424838 4:74214187-74214209 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
975489980 4:74977122-74977144 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
976065685 4:81184653-81184675 CAGAAGTAGGCTTCAGAAGGAGG + Intronic
976534209 4:86192751-86192773 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
976698414 4:87942631-87942653 CAGAAGTAGGCTACAGAAGGTGG + Intergenic
976716073 4:88123325-88123347 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
976852756 4:89567562-89567584 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
976861628 4:89672502-89672524 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
976903383 4:90207472-90207494 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
977047026 4:92080151-92080173 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
977154610 4:93556272-93556294 TAGAAGTAGGCTTCAGAAAGTGG + Intronic
977185523 4:93931787-93931809 TAGAAGTAGGCTTCAGCAGGTGG - Intergenic
977381958 4:96286866-96286888 GAAAAGTGGGCTGCAGCAGGAGG + Intergenic
977396567 4:96478787-96478809 CAGAAGTCTGCTGCAGGGGCAGG + Intergenic
977425681 4:96864028-96864050 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
977446081 4:97134656-97134678 GAGAAGTCCTCAGCAGGAGGTGG - Intergenic
977467613 4:97402328-97402350 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
977524199 4:98125151-98125173 TAGAAGTAGGCTTCAGAAGGTGG - Intronic
977561200 4:98536007-98536029 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
977632845 4:99262770-99262792 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
977657143 4:99535711-99535733 GAGAAGTAGGCTTCAGAAGGTGG - Intronic
977671525 4:99700236-99700258 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
977774549 4:100901593-100901615 CAGAAGTAGGCTTCAGGAGGTGG + Intergenic
977888020 4:102274112-102274134 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
977986316 4:103386545-103386567 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
977994594 4:103485917-103485939 TAGAAGTAGGCTTCGGAAGGTGG + Intergenic
978036653 4:104003159-104003181 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
978090426 4:104708017-104708039 CAGAAGTAGGCTTCAGGAAGTGG + Intergenic
978108412 4:104931723-104931745 AGGAAGTAGGCTTCAGGAGGTGG + Intergenic
978139207 4:105298215-105298237 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
978185930 4:105857425-105857447 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
978313400 4:107410437-107410459 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
978664424 4:111165199-111165221 CAGAAGTAGGCTTCAGAAGGAGG + Intergenic
978699636 4:111627431-111627453 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
979079144 4:116312173-116312195 CAGAAGTCTGCTGCAGTCGGGGG - Intergenic
979136140 4:117114796-117114818 TAGAAGTTTGCTGCAGGGGTGGG - Intergenic
979327858 4:119400082-119400104 CAGAAGTTTGCTGCAGGAGCGGG - Intergenic
979417584 4:120461819-120461841 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
979512364 4:121568454-121568476 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
979576240 4:122294779-122294801 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
979581501 4:122365963-122365985 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
979819242 4:125150834-125150856 CAGAAGTAGGCTTCAGAAGGAGG - Intergenic
979854173 4:125611234-125611256 CAGAAGTTTGCTGCAGGAGCAGG + Intergenic
979951327 4:126897243-126897265 TAGAAGTCTGCTGCAAGAGGTGG - Intergenic
979965847 4:127076311-127076333 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
980084449 4:128377182-128377204 CAGAAGTCTGCTGCAGGGGGTGG - Intergenic
980148872 4:129022307-129022329 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
980171155 4:129291913-129291935 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
980184773 4:129447229-129447251 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
980223175 4:129946940-129946962 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
980308891 4:131101152-131101174 CAGAAGTTTGCTGCAGGAGCAGG + Intergenic
980400395 4:132276797-132276819 TAGAAGTAGGCAACAGAAGGTGG + Intergenic
980407030 4:132366555-132366577 CAGAAGTCTGCTGCAAGGGGTGG - Intergenic
980477169 4:133333324-133333346 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
980513362 4:133822711-133822733 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
980733078 4:136847873-136847895 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
980861757 4:138507470-138507492 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
981237673 4:142436926-142436948 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
981273309 4:142868877-142868899 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
981290553 4:143070585-143070607 CAGAAGTAGGCTTCAGCAGGTGG - Intergenic
981352956 4:143753205-143753227 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
981395966 4:144249465-144249487 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
981671682 4:147293632-147293654 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
981750000 4:148083701-148083723 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
981787841 4:148501868-148501890 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
981789508 4:148520882-148520904 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
981794821 4:148584579-148584601 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
981846647 4:149177006-149177028 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
981872928 4:149508139-149508161 TAGAAGTTTGCTGCAGGGGTGGG + Intergenic
981885473 4:149667592-149667614 CAGAAGTAGGCTTCAGAAGGCGG + Intergenic
981940090 4:150272479-150272501 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
982060136 4:151597003-151597025 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
982298822 4:153858705-153858727 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
982372426 4:154648044-154648066 CAGAAGTAGGCTTCAGGAGGTGG + Intronic
982393757 4:154893123-154893145 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
982397119 4:154924940-154924962 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
982725458 4:158901965-158901987 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
982825863 4:160002821-160002843 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
983044372 4:162968839-162968861 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
983047347 4:163003695-163003717 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
983298900 4:165901216-165901238 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
983485765 4:168330345-168330367 TAGAAGTAGGCTTCAAAAGGTGG - Intergenic
983489195 4:168368454-168368476 CAGAAGTTTGCTGCAGGAGCAGG + Intronic
983543435 4:168936446-168936468 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
983596183 4:169471099-169471121 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
983602595 4:169547949-169547971 CAGAAGTAGGCTTCAGGAGGTGG - Intronic
983821105 4:172194000-172194022 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
983840987 4:172456364-172456386 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
983896095 4:173083805-173083827 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
983985178 4:174051072-174051094 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
984008948 4:174347586-174347608 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
984032326 4:174619299-174619321 CAGAACTCGGCTTCAGAAGGTGG + Intergenic
984493799 4:180469550-180469572 CAGAAGTAGGCTTCAGCAGGTGG + Intergenic
984498695 4:180531732-180531754 GAGAAGTTGCCAGCAGGAGGGGG - Intergenic
984618777 4:181928192-181928214 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
984854110 4:184178033-184178055 TAGAAGTAGGCTTCAGAAGGTGG + Intronic
984903093 4:184601844-184601866 TAGAAGTAGGCTTCAGAAAGTGG + Intergenic
985204605 4:187521642-187521664 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
985304325 4:188522101-188522123 CAGAAGTTGGCTGCAGGGGTGGG + Intergenic
1202756704 4_GL000008v2_random:70096-70118 CAGAAGTAGGCTTCAGAAGGCGG + Intergenic
985607717 5:867283-867305 CAGAAGTCTGCTGCAGGGGCAGG + Intronic
985793345 5:1944547-1944569 CAGCAGGAGGCTGCAGGAGGAGG + Intergenic
985794886 5:1954599-1954621 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
986005875 5:3668899-3668921 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
986322947 5:6648741-6648763 CAGAAGTAGGCTTCAGAAGGCGG - Intronic
986378700 5:7161793-7161815 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
986581800 5:9273021-9273043 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
986838696 5:11671756-11671778 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
986879719 5:12154662-12154684 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
986996645 5:13614457-13614479 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
987019390 5:13853534-13853556 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
987216567 5:15743750-15743772 TAGAAGTCTGCTGCAGAGGTGGG - Intronic
987228886 5:15871464-15871486 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
987423255 5:17745686-17745708 TTGATGTCTGCTGGAGGAGGTGG + Intergenic
987528071 5:19079657-19079679 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
987656663 5:20815768-20815790 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
987687715 5:21226424-21226446 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
987923955 5:24316946-24316968 GAGAAGTAGGCTTCAGAAGGTGG - Intergenic
988059622 5:26149683-26149705 TGGAAGTAGGCTTCAGAAGGTGG + Intergenic
988618354 5:32796170-32796192 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
988766888 5:34388176-34388198 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
988867576 5:35353033-35353055 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
988970930 5:36466398-36466420 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
989364073 5:40635620-40635642 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
989687484 5:44107506-44107528 TAGAAGTAGGCTTCAGAGGGTGG - Intergenic
989696439 5:44206592-44206614 CAGAAGTAGGCTTCAGGAGTTGG - Intergenic
989825458 5:45848932-45848954 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
990164209 5:52976885-52976907 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
990745719 5:58958062-58958084 TAGAAGTAGGCTTTAGAAGGTGG - Intergenic
990897461 5:60714892-60714914 AAGAAGTGGGCTTCAGAAGGTGG - Intergenic
991025594 5:62026240-62026262 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
991026532 5:62036636-62036658 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
991046647 5:62230250-62230272 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
991150320 5:63360345-63360367 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
991151599 5:63376981-63377003 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
991161511 5:63508421-63508443 CAGAAGTAGGCGTCAGGAGGTGG + Intergenic
991161516 5:63508459-63508481 CAGAAGTAGGCGTCAGGAGGTGG + Intergenic
991223705 5:64244254-64244276 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
991236824 5:64408052-64408074 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
991242466 5:64475220-64475242 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
991270149 5:64769435-64769457 CAGAAATCGGCTGCATGAGTTGG - Intronic
991283104 5:64939085-64939107 CAGAAGTAGGCTTCAGAAGGCGG - Intronic
991397633 5:66221874-66221896 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
991532517 5:67631692-67631714 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
991652205 5:68866434-68866456 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
991934887 5:71791232-71791254 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
992055161 5:72981925-72981947 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
992254738 5:74910745-74910767 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
992316841 5:75565359-75565381 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
992383712 5:76264411-76264433 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
992740490 5:79769274-79769296 CAGAAGTCGGCTTCAGAAGGTGG - Intronic
992976762 5:82129320-82129342 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
993105388 5:83594383-83594405 TTGAAGTCAGCTGCAGGAATTGG + Intergenic
993165944 5:84355459-84355481 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
993253488 5:85557184-85557206 CAGAAGTAGGCTTCAGGAGATGG + Intergenic
993402820 5:87473742-87473764 CGGAAGTAGGCTTCAGGAGGTGG + Intergenic
993455424 5:88121402-88121424 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
993494111 5:88587700-88587722 AAGCAGTAGGCTTCAGGAGGTGG + Intergenic
993589716 5:89778933-89778955 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
994137829 5:96308432-96308454 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
994142725 5:96360313-96360335 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
994350813 5:98743469-98743491 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
994437930 5:99762782-99762804 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
994553179 5:101262344-101262366 GAGAAGTTTGCTGCAGGAGTAGG + Intergenic
994609657 5:102019732-102019754 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
994721439 5:103385170-103385192 CAGAAGTAGGCTGCAGAAGGTGG - Intergenic
994802409 5:104395926-104395948 TAGAAGTAGACTTCAGAAGGGGG + Intergenic
995111982 5:108438345-108438367 CAGAAGTAGGCTTCAGAAGGGGG + Intergenic
995211011 5:109539150-109539172 AAGAAGTAGACTTCAGGAGGTGG + Intergenic
995263664 5:110135008-110135030 CAGAAGTGGGCTTCAGAAGGTGG - Intergenic
995398569 5:111716170-111716192 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
995464541 5:112437094-112437116 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
995480503 5:112587475-112587497 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
995578914 5:113573938-113573960 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
995694946 5:114867934-114867956 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
995695873 5:114877388-114877410 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
995808701 5:116081342-116081364 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
996005969 5:118420711-118420733 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
996130076 5:119770695-119770717 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
996323954 5:122251774-122251796 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
996527144 5:124491514-124491536 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
996953171 5:129152450-129152472 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
996987365 5:129583889-129583911 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
997004480 5:129802703-129802725 TTGAAGTAGGCTTCAGAAGGTGG - Intergenic
997004692 5:129804120-129804142 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
997295809 5:132767542-132767564 TAGATGTCGGCTGCAGGTTGGGG + Intronic
997800121 5:136852731-136852753 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
997809394 5:136953029-136953051 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
998625641 5:143842702-143842724 CAGAAGTGGGATGCGGGAGGAGG + Intergenic
998717850 5:144906244-144906266 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
998751962 5:145332745-145332767 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
998780012 5:145646512-145646534 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
998934322 5:147217507-147217529 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
998972642 5:147610158-147610180 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
999029936 5:148280262-148280284 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
999106274 5:149073985-149074007 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
999468790 5:151832313-151832335 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
999489704 5:152038316-152038338 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1000150153 5:158492260-158492282 TAGAGGGAGGCAGCAGGAGGAGG + Intergenic
1000194631 5:158946161-158946183 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1000286628 5:159832483-159832505 TAAAAGTCGGCTTCTGGAGGAGG + Intergenic
1000376003 5:160583057-160583079 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1000575054 5:162966690-162966712 CAGAAGTCTGCTGCAGCGGGGGG - Intergenic
1001372486 5:171219870-171219892 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1002521556 5:179795571-179795593 GAGAAGTAGGCTGGGGGAGGAGG - Exonic
1002673667 5:180890862-180890884 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1002677300 5:180927493-180927515 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1002944980 6:1752047-1752069 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1003248884 6:4406805-4406827 CAGAAGTAGGCTGCAGGAGATGG + Intergenic
1003902435 6:10667707-10667729 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1004028125 6:11838359-11838381 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1004337666 6:14779020-14779042 TAGAAATTTGCTGCTGGAGGAGG - Intergenic
1004346944 6:14857477-14857499 TAGAAGGTGGCTGCTGGAGTTGG - Intergenic
1004944342 6:20595651-20595673 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1005353937 6:24963995-24964017 TGGAAGGCGGAGGCAGGAGGAGG - Intronic
1005376160 6:25185011-25185033 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1005378413 6:25208402-25208424 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1005670422 6:28099888-28099910 CAGAAGTTGGCTTCAGAAGGTGG + Intergenic
1005785719 6:29243945-29243967 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1005795890 6:29360949-29360971 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1006198265 6:32262361-32262383 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1006725625 6:36197171-36197193 AAGATGGCGGCTGCGGGAGGGGG - Intronic
1007307283 6:40917060-40917082 GAGAAGGGAGCTGCAGGAGGTGG + Intergenic
1007858273 6:44880089-44880111 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1008083736 6:47221872-47221894 TATGAGTAGGCTGGAGGAGGTGG - Intergenic
1008561864 6:52731994-52732016 TATGAGTAGGCTGGAGGAGGTGG - Intergenic
1008719276 6:54328634-54328656 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1008758261 6:54823953-54823975 TAGAAGTAGGCTTCAGAAGGGGG - Intergenic
1008864117 6:56189130-56189152 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1008865551 6:56205146-56205168 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1008994035 6:57637420-57637442 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1009054447 6:58317596-58317618 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1009182641 6:60536511-60536533 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1009186461 6:60579985-60580007 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1009236689 6:61132979-61133001 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1009264247 6:61532954-61532976 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1009458892 6:63888802-63888824 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1009707008 6:67265548-67265570 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1009880636 6:69561626-69561648 CAGAAGTCGGGTTCAGAAGGTGG + Intergenic
1009945231 6:70335603-70335625 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1010039010 6:71360295-71360317 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1010282857 6:74040793-74040815 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1010459589 6:76098708-76098730 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1010521926 6:76848952-76848974 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1010594717 6:77749283-77749305 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1010681661 6:78806613-78806635 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1010821712 6:80422348-80422370 CAGAAGTCTGTTGCAGGAGTGGG + Intergenic
1010822547 6:80432656-80432678 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1010838008 6:80613273-80613295 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1011020563 6:82808470-82808492 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1011086619 6:83547631-83547653 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1011120222 6:83943629-83943651 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1011137275 6:84114554-84114576 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1011199721 6:84822546-84822568 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1011214271 6:84988129-84988151 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1011236925 6:85228311-85228333 CAGAAGTTTGCTGCAGGAGCAGG - Intergenic
1011333787 6:86237671-86237693 AAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1011340173 6:86305866-86305888 CAGAAGTAGGCTTCAGGAGGTGG - Intergenic
1011387548 6:86814612-86814634 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1011578344 6:88828555-88828577 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1011835084 6:91421549-91421571 TGGAAGTTTGCTGCAGGAGCGGG + Intergenic
1011916174 6:92509302-92509324 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1012161319 6:95888703-95888725 CAGAAGTCTGCTGCAGGGGCGGG - Intergenic
1012343332 6:98156117-98156139 CAGAAGTAGGCTTCAGGAGGTGG - Intergenic
1012498040 6:99856293-99856315 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1012644285 6:101660451-101660473 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1012871018 6:104672231-104672253 TAGAAGTAGCCTTCAGAAGGTGG + Intergenic
1013453136 6:110304331-110304353 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1013625519 6:111933942-111933964 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1013672739 6:112422527-112422549 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1013865456 6:114690922-114690944 TAGAAGTTTGCTGCAGGAGCGGG - Intergenic
1013932103 6:115546140-115546162 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1013964341 6:115936488-115936510 TAGAAGTAGGCCTCAGAAGGTGG + Exonic
1014058363 6:117043063-117043085 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1014223412 6:118822103-118822125 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1014369150 6:120583587-120583609 TAGAAGTAGGCTTCAGAAGATGG - Intergenic
1014386943 6:120815166-120815188 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1014484636 6:121984192-121984214 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1014589359 6:123244258-123244280 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1014968048 6:127781370-127781392 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1015109048 6:129570133-129570155 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1015211449 6:130702780-130702802 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1015387097 6:132636284-132636306 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1015433088 6:133154041-133154063 AAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1015623256 6:135155315-135155337 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1015659996 6:135565218-135565240 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1015902032 6:138077149-138077171 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1016108190 6:140188609-140188631 CAGAAGTTTGCTGCAGGAGCAGG + Intergenic
1016241996 6:141941252-141941274 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1016400077 6:143670819-143670841 TAGAAGTAGGCTTCAAAAGGTGG - Intronic
1016542301 6:145179113-145179135 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1016591016 6:145743095-145743117 CAGAAGTAGGCTTCAGAAGGCGG + Intergenic
1017411630 6:154173332-154173354 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1017503953 6:155050429-155050451 AAGAAGTCAGCAGCAGGATGTGG - Intronic
1018507711 6:164489935-164489957 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1018797529 6:167198865-167198887 CAGAAGTAGGCTTCAGTAGGTGG - Intergenic
1018805935 6:167259454-167259476 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1018834834 6:167474889-167474911 CTGAAGTCGGCTGCAGGCTGAGG - Intergenic
1018932309 6:168249104-168249126 CAGAAGTAGGCTTCAGGAGGTGG + Intergenic
1019071772 6:169352844-169352866 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1019085005 6:169467403-169467425 CAGAAGTTTGCTGCAGGAGTGGG - Intronic
1019204798 6:170350954-170350976 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1020042928 7:5017784-5017806 TAGAAGTCGGCTGGGTGTGGTGG + Intronic
1020333541 7:7043299-7043321 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1020358139 7:7300289-7300311 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1020397970 7:7738853-7738875 TAGACGACAGCTGCAGAAGGTGG + Intronic
1020428759 7:8097287-8097309 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1020525398 7:9251990-9252012 CAGAAGTAGGCTTCAGTAGGTGG + Intergenic
1020557855 7:9692118-9692140 AAGAAGTAGTCTTCAGGAGGTGG + Intergenic
1020619235 7:10497650-10497672 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1020636098 7:10697027-10697049 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1020640029 7:10743082-10743104 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1020780918 7:12516393-12516415 CAGAAGTTTGCTGCAGGAGCGGG + Intergenic
1021051805 7:15994804-15994826 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1021065182 7:16164485-16164507 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1021071795 7:16249893-16249915 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1021347547 7:19547226-19547248 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1021749216 7:23778811-23778833 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1021782173 7:24117300-24117322 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1022292056 7:29014256-29014278 TAGAAGGCGACTGCTGGTGGGGG + Intronic
1022615755 7:31927952-31927974 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1023051615 7:36257802-36257824 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1023666556 7:42528415-42528437 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1023897171 7:44443652-44443674 TAGAAGGAGGCTGCGGCAGGTGG - Intronic
1024017836 7:45334011-45334033 CAGAAGTAGGCTCCAGTAGGTGG + Intergenic
1024153094 7:46592110-46592132 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1024158279 7:46648293-46648315 TAGAAGTTTGCTGCAGGGGCAGG - Intergenic
1024372779 7:48606191-48606213 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1024409246 7:49020291-49020313 TAGGAGTGGGGAGCAGGAGGAGG + Intergenic
1024664770 7:51535731-51535753 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1024950386 7:54854996-54855018 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1024998375 7:55293899-55293921 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1027449804 7:78318135-78318157 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1027458609 7:78424376-78424398 TAGAAGTTTGCTGCAGGGGTGGG + Intronic
1027510215 7:79070922-79070944 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1027778074 7:82491722-82491744 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1027790531 7:82634545-82634567 GAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1027864430 7:83628762-83628784 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1028080441 7:86568339-86568361 TGGAAGTAGGCTTCAGAAGGTGG + Intergenic
1028144434 7:87305516-87305538 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1028301427 7:89205910-89205932 TAGAAGTTTGCTGCAGGGGTGGG - Intronic
1028337454 7:89674695-89674717 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1028518174 7:91700053-91700075 CAGAAGTAGGCTACAGAAGGTGG + Intronic
1028627836 7:92897739-92897761 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1028644282 7:93077523-93077545 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1028652716 7:93169408-93169430 CAGAAGTAGGCTTCAGCAGGTGG - Intergenic
1028788241 7:94821302-94821324 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1029004581 7:97195008-97195030 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1029810173 7:103038983-103039005 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1029850974 7:103461725-103461747 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1029854979 7:103505750-103505772 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1030202584 7:106919956-106919978 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1030256657 7:107517019-107517041 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1030325713 7:108216892-108216914 CAGAAGTGGGCTTCAGAAGGTGG - Intronic
1030455455 7:109767131-109767153 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1030692057 7:112546428-112546450 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1030736402 7:113054022-113054044 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1030770980 7:113474903-113474925 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1030784268 7:113640861-113640883 CAGAAGTCTGCTGCAGGAGCAGG - Intergenic
1030801465 7:113857431-113857453 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1031397608 7:121292494-121292516 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1031476033 7:122222912-122222934 TAGAAGTGGCCTGCAGAGGGGGG - Intergenic
1031545723 7:123049774-123049796 TAGAAGTTTGCTGCAGGGGTGGG - Intergenic
1031613636 7:123856178-123856200 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1031711137 7:125047462-125047484 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1031902576 7:127427735-127427757 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1032911202 7:136432372-136432394 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1033346711 7:140531017-140531039 TAGAAGTCGGCCGGATGTGGTGG - Intronic
1033680174 7:143585555-143585577 GAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1033691662 7:143743887-143743909 GAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1033977062 7:147115787-147115809 CAGAAGTAGGCTGCAGAAGGTGG - Intronic
1034097810 7:148425871-148425893 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1034320223 7:150173204-150173226 CAGAAGTTTGCTGCAGGAGCAGG - Intergenic
1034736165 7:153431342-153431364 TATGAGTAGGCTGAAGGAGGTGG - Intergenic
1034772526 7:153794017-153794039 CAGAAGTTTGCTGCAGGAGCAGG + Intergenic
1035710890 8:1713045-1713067 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1035746969 8:1968072-1968094 TCGACGTCAGCAGCAGGAGGTGG - Intergenic
1035998178 8:4573096-4573118 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1036553903 8:9839809-9839831 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1036558136 8:9877753-9877775 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1037285343 8:17293434-17293456 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1037664666 8:20957401-20957423 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1038083172 8:24163508-24163530 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1038211710 8:25524207-25524229 GAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1038298977 8:26324531-26324553 CAGAAGTCTGCTGCAGGGGCAGG + Intronic
1039133982 8:34298735-34298757 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1039284687 8:36027515-36027537 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1039302529 8:36224640-36224662 TAGAATTAGGCTTCAGAAGGTGG + Intergenic
1039658322 8:39434222-39434244 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1039801919 8:40965170-40965192 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1040473724 8:47759082-47759104 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1040519967 8:48168340-48168362 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1040578840 8:48678507-48678529 TAGGATTAGGCTGCTGGAGGGGG + Intergenic
1040763229 8:50875222-50875244 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1040841957 8:51793502-51793524 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1040942906 8:52851646-52851668 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1041021271 8:53641700-53641722 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1041155192 8:54978049-54978071 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1041341177 8:56847406-56847428 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1041743213 8:61178008-61178030 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1041836760 8:62224587-62224609 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1042195723 8:66229679-66229701 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1042327033 8:67539977-67539999 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1042478936 8:69281349-69281371 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1042622579 8:70723276-70723298 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1042627042 8:70769917-70769939 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1042644224 8:70968415-70968437 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1043025081 8:75056849-75056871 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1043036542 8:75207304-75207326 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1043223720 8:77698674-77698696 TAGAAGTAGGCTTCAGAAGATGG - Intergenic
1043253527 8:78105569-78105591 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1043304860 8:78782191-78782213 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1043363075 8:79498799-79498821 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1043680791 8:83022379-83022401 CAGAAGTTTGCTGCAGGAGTGGG - Intergenic
1044038521 8:87336674-87336696 TAGAAGTAGGCTTCAGAAGGTGG - Intronic
1044117116 8:88349513-88349535 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1044131229 8:88526356-88526378 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1044221981 8:89679525-89679547 TGGAAGTCAGCTCCAGAAGGTGG + Intergenic
1044267864 8:90204316-90204338 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1044447473 8:92296086-92296108 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1044505121 8:93007541-93007563 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1044610532 8:94087869-94087891 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1045390722 8:101711432-101711454 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1045797828 8:106066236-106066258 CAGAAGTAGGCTTCAGGAGGTGG + Intergenic
1046014750 8:108591232-108591254 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1046047842 8:108985540-108985562 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1046300168 8:112276705-112276727 CAGAAGTTTGCTGCAGGAGTGGG - Intronic
1046878042 8:119277729-119277751 TAGAAGTCTGCTGCAGGGGGTGG - Intergenic
1046950532 8:120015763-120015785 TATAAGTAGGCTGGCGGAGGTGG + Intronic
1047121441 8:121909093-121909115 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1047369441 8:124244522-124244544 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1047565594 8:126040578-126040600 TAGAAGTTTGCTGCAGGGGCAGG + Intergenic
1048046112 8:130774942-130774964 CAGAAGTTTGCTGCAGGAGTGGG + Intergenic
1048073561 8:131043885-131043907 GAGAAGTCGGCTGGGGGCGGTGG + Intergenic
1048467178 8:134675119-134675141 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1048895764 8:138990812-138990834 CAGAAGTTTGCTGCAGGAGTGGG - Intergenic
1049212875 8:141394821-141394843 TGGCTGTGGGCTGCAGGAGGAGG + Intronic
1049381810 8:142319924-142319946 CAGACGCCAGCTGCAGGAGGAGG - Intronic
1049441472 8:142611720-142611742 GAGGAGTCGGCTGCAGCAGAGGG - Exonic
1049764140 8:144345505-144345527 TAGAAGTTGGCAGCTGGAAGCGG + Intergenic
1049872243 8:144989772-144989794 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1049964742 9:767893-767915 CAGAAGTAGGCTACAGAAGGTGG + Intergenic
1050234252 9:3561868-3561890 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1050239774 9:3623310-3623332 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1050255365 9:3787587-3787609 CAGAAGTCTGCTGCAGGGGTGGG - Intergenic
1050300363 9:4252587-4252609 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1050404615 9:5294156-5294178 TAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1050630234 9:7550378-7550400 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1050637539 9:7627647-7627669 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1050943028 9:11484725-11484747 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1051297929 9:15617163-15617185 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1051354051 9:16224496-16224518 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1051447266 9:17154133-17154155 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1051489535 9:17646352-17646374 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1051571355 9:18562994-18563016 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1051703881 9:19856261-19856283 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1051814445 9:21088376-21088398 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1051863258 9:21650827-21650849 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1051940090 9:22495426-22495448 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1051983043 9:23046856-23046878 CAGAAGTTGGCTTCAGAAGGTGG + Intergenic
1051998600 9:23248902-23248924 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1052096454 9:24390455-24390477 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1052115617 9:24645802-24645824 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1052134210 9:24889926-24889948 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1052281088 9:26734545-26734567 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1052326621 9:27221902-27221924 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1052414222 9:28157158-28157180 CAGAAGTTTGCTGCAGGAGCGGG - Intronic
1052546778 9:29889773-29889795 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1052628457 9:31005897-31005919 CAGAAGTAGGCTTCAGAAGGCGG + Intergenic
1052752875 9:32509750-32509772 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1053039276 9:34856250-34856272 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1054719644 9:68592155-68592177 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1054889268 9:70233664-70233686 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1055338852 9:75260938-75260960 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1055390815 9:75820726-75820748 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1055628887 9:78202088-78202110 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1055713324 9:79088971-79088993 CAGAAGTTTGCTGCAGGAGTGGG - Intergenic
1055823762 9:80300254-80300276 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1056001106 9:82217079-82217101 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1056095775 9:83251530-83251552 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1056123862 9:83515129-83515151 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1056176654 9:84043055-84043077 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1056302502 9:85257127-85257149 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1056385012 9:86089733-86089755 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1056997638 9:91478620-91478642 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1057460446 9:95255711-95255733 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1058029396 9:100178292-100178314 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1058093144 9:100828725-100828747 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1058176364 9:101739823-101739845 TAGTAGTGGGCTGAATGAGGAGG + Intergenic
1058492485 9:105516837-105516859 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1058819168 9:108713179-108713201 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1059262578 9:112993045-112993067 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1059513492 9:114870846-114870868 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1059596418 9:115724991-115725013 TAGAAGTAGGCTTCAGAAGATGG + Intergenic
1059954723 9:119503341-119503363 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1060043744 9:120324101-120324123 GAGAAGTGGGCTGTAAGAGGGGG - Intergenic
1060340257 9:122768750-122768772 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1060449397 9:123722790-123722812 CAGAAGTTTGCTGCAGGAGTGGG + Intronic
1061630797 9:131870959-131870981 TACAAGGCGGCTGCATCAGGTGG + Intronic
1061680020 9:132238349-132238371 TAGGGGTGGGGTGCAGGAGGCGG + Intronic
1061747748 9:132752753-132752775 AAGGAGCCAGCTGCAGGAGGAGG - Intronic
1062297747 9:135842011-135842033 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1062315095 9:135963200-135963222 TTGAAGTAGGAGGCAGGAGGAGG + Intergenic
1062709240 9:137964673-137964695 TAGAAGTAGGCTTCAGAAGGTGG - Intronic
1203688303 Un_GL000214v1:17156-17178 CAGAAGTAGGCTTCAGAAGGCGG + Intergenic
1203754310 Un_GL000218v1:110563-110585 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1203459900 Un_GL000220v1:25397-25419 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1203713698 Un_KI270742v1:123069-123091 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1203537498 Un_KI270743v1:54952-54974 CAGAAGTAGGCTTCAGAAGGCGG + Intergenic
1203647972 Un_KI270751v1:86897-86919 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1186055141 X:5642218-5642240 TATAAGGAGGCTGGAGGAGGCGG - Intergenic
1186369881 X:8936375-8936397 CAGAAGTAGGCTTCAGGAGGTGG - Intergenic
1186740875 X:12517183-12517205 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1186774722 X:12853760-12853782 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1186810469 X:13182771-13182793 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1186960818 X:14735209-14735231 CAGAAGTAGGCTTCAGAAGGCGG - Intergenic
1187728926 X:22233790-22233812 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1187729664 X:22239402-22239424 CAGAAGTAGGCTTCAGAAGGCGG + Intronic
1187784448 X:22867827-22867849 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1188099794 X:26070505-26070527 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1188193354 X:27198149-27198171 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1188221492 X:27546549-27546571 TAGAAGTCTGCTGGAGGAGCAGG - Intergenic
1188893158 X:35635351-35635373 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1188900947 X:35733005-35733027 CAGAAGTAGGCTGCAGAAGGTGG - Intergenic
1188921791 X:35986585-35986607 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1189189766 X:39089972-39089994 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1189228781 X:39435682-39435704 TAAAAGTTTGCTGCAGGAGCAGG - Intergenic
1189574969 X:42342345-42342367 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1189590769 X:42508179-42508201 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1189618963 X:42815650-42815672 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1189702473 X:43726652-43726674 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1189721726 X:43926773-43926795 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1189754263 X:44254284-44254306 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1189861299 X:45275450-45275472 GAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1189937898 X:46088286-46088308 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1190341320 X:49298983-49299005 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1190420254 X:50223241-50223263 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1190506020 X:51126383-51126405 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191024399 X:55897536-55897558 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191037583 X:56043780-56043802 CAGAAGTAGGCTGCAGAAGGTGG - Intergenic
1191071902 X:56409997-56410019 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1191080986 X:56509096-56509118 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191088594 X:56596647-56596669 AAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1191113816 X:56831576-56831598 CAGAAGTAGGCTCCAGAAGGTGG - Intergenic
1191119856 X:56891785-56891807 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191153376 X:57243910-57243932 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191206836 X:57843240-57843262 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191238017 X:58151780-58151802 AAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191601647 X:63015881-63015903 TGGAAGTGGGCTTCAGAAGGTGG - Intergenic
1191606381 X:63066798-63066820 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191701708 X:64048866-64048888 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191705243 X:64086780-64086802 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191788632 X:64945056-64945078 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1191793912 X:65000598-65000620 GAGAAGTAGGCTTCAGAAGGTGG + Intronic
1191832253 X:65428730-65428752 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1191848463 X:65568300-65568322 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1191872808 X:65764372-65764394 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1191947892 X:66555031-66555053 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191969788 X:66800201-66800223 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191984961 X:66969620-66969642 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1191987109 X:66994143-66994165 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1191998947 X:67127353-67127375 CAGAAGTCTGTTGCAGGAGTGGG + Intergenic
1192000867 X:67150092-67150114 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1192018581 X:67358907-67358929 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1192020698 X:67387409-67387431 CAGAAGTTGGCTTCAGTAGGTGG + Intergenic
1192277356 X:69647666-69647688 TGGAAGTGGGCTTCAGAAGGTGG - Intronic
1192294741 X:69835692-69835714 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1192403838 X:70863741-70863763 CAGAAGTAGGCTCCAGAAGGTGG + Intronic
1192674706 X:73183543-73183565 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1192686140 X:73306930-73306952 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1192692240 X:73375841-73375863 CAGAAGTAGGCTTCAGTAGGTGG + Intergenic
1192694871 X:73402512-73402534 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1192703051 X:73497015-73497037 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1192707546 X:73542054-73542076 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1192718502 X:73668337-73668359 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1192759071 X:74077032-74077054 CAGAAGTAGGCTACAGAAGGTGG - Intergenic
1192897715 X:75460952-75460974 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1192922615 X:75723572-75723594 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1192932816 X:75825833-75825855 CAGAAGTTTGCTGCAGGAGTGGG - Intergenic
1192937895 X:75880620-75880642 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1192953053 X:76038581-76038603 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1192977526 X:76302391-76302413 CAGAAGTAGGCTGCAGAAAGTGG - Intergenic
1193040331 X:76997963-76997985 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1193055448 X:77144577-77144599 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1193062497 X:77221102-77221124 CAGAAGAAGGCTTCAGGAGGTGG + Intergenic
1193068725 X:77283991-77284013 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1193075308 X:77348653-77348675 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1193081455 X:77411012-77411034 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1193227355 X:78999166-78999188 TAGAAGTAGGCTTCGGAAGGTGG + Intergenic
1193270835 X:79529388-79529410 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1193279118 X:79626521-79626543 TAGAAGTTTGCTGCAGGGGCAGG - Intergenic
1193284497 X:79696260-79696282 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1193355853 X:80520177-80520199 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1193404604 X:81085083-81085105 CAGAAGTAGGCTCCAGAAGGTGG + Intergenic
1193528203 X:82619538-82619560 GAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1193645839 X:84067289-84067311 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1193647533 X:84088135-84088157 CAGAAGTGGGCTTCAGAAGGTGG - Intronic
1193835386 X:86336738-86336760 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1193878866 X:86897020-86897042 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1193897395 X:87129755-87129777 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1193949462 X:87779577-87779599 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1194029953 X:88800799-88800821 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1194118858 X:89936795-89936817 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1194139992 X:90197123-90197145 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1194158656 X:90423593-90423615 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1194193656 X:90866134-90866156 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1194203670 X:90984697-90984719 CAAAAGTAGGCTTCAGGAGGTGG + Intergenic
1194207379 X:91028418-91028440 TATGAGTAGGCTGGAGGAGGTGG + Intergenic
1194330957 X:92582544-92582566 TAGAAGTTTGCTTCAGGAGCAGG + Intronic
1194346749 X:92774215-92774237 TAGAAGCCTGCTGCACTAGGGGG - Intergenic
1194420061 X:93661851-93661873 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1194624915 X:96215691-96215713 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1194643253 X:96428551-96428573 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1194708265 X:97201330-97201352 CAGAAGTAGACTGCAGAAGGTGG + Intronic
1194771935 X:97916411-97916433 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1194783005 X:98048331-98048353 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1194901337 X:99515092-99515114 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1194954284 X:100161565-100161587 CAGAAGTCGGCTTCAGAAGGTGG - Intergenic
1194958927 X:100213752-100213774 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1195127302 X:101821515-101821537 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1195153550 X:102098235-102098257 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1195232874 X:102869159-102869181 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1195367842 X:104143264-104143286 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1195414919 X:104609828-104609850 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1195469171 X:105213140-105213162 CAGAAGCAGGCTTCAGGAGGTGG + Intronic
1195519112 X:105811415-105811437 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1195622168 X:106967479-106967501 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1195730135 X:107958863-107958885 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1195774689 X:108390708-108390730 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1195812794 X:108852356-108852378 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1195882281 X:109604552-109604574 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1195948328 X:110239211-110239233 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1195985712 X:110627482-110627504 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1196269667 X:113696889-113696911 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1196273037 X:113734979-113735001 CAGAAGTGGGCTTCAGAAGGTGG - Intergenic
1196307927 X:114126804-114126826 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1196367683 X:114942194-114942216 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1196435738 X:115672750-115672772 CAGAGGTAGGCTTCAGGAGGTGG + Intergenic
1196467193 X:115984152-115984174 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1196513684 X:116545509-116545531 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1196517139 X:116627733-116627755 TAGAAGTAGGCTCCAGAAGATGG - Intergenic
1196555741 X:117083115-117083137 CAGAAGTAGGCTACAGAAGGTGG - Intergenic
1196589296 X:117467187-117467209 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1196946461 X:120832034-120832056 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1197049427 X:122041682-122041704 TAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1197051321 X:122062212-122062234 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1197114845 X:122819303-122819325 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1197142326 X:123130807-123130829 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1197184871 X:123574658-123574680 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1197191223 X:123649468-123649490 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1197319239 X:125007040-125007062 AAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1197341035 X:125266598-125266620 TAGAAGTTTGCTGCAGGAGTAGG + Intergenic
1197395463 X:125922314-125922336 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1197570867 X:128148780-128148802 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1197847176 X:130814909-130814931 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1198002141 X:132450643-132450665 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1198042190 X:132864264-132864286 CAGAAGTAGGCTTCAGAAGGTGG + Intronic
1198085769 X:133280098-133280120 GAGAAGTAGGCTCCAGAAGGTGG + Intergenic
1198312588 X:135436430-135436452 TTGGACTGGGCTGCAGGAGGTGG + Intergenic
1198490074 X:137130599-137130621 CAGAAGTGGGCTTCAGAAGGTGG + Intergenic
1198555938 X:137793200-137793222 TTGAAGTAGGCTTCAGAAGGTGG + Intergenic
1198569786 X:137942465-137942487 TAGAAGTTTGCTGCAGGGGTGGG + Intergenic
1198758155 X:140002063-140002085 CAGAAGTGGGCTTCAGAAGGTGG + Intergenic
1199012009 X:142769444-142769466 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1199094608 X:143724633-143724655 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1199401752 X:147406436-147406458 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1199436749 X:147820552-147820574 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1200040074 X:153358627-153358649 CAGAAGTTTGCTGCAGGAGTGGG + Intronic
1200471733 Y:3594349-3594371 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1200485738 Y:3766092-3766114 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1200504971 Y:4000561-4000583 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1200540266 Y:4448516-4448538 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1200549503 Y:4560136-4560158 CAAAAGTAGGCTTCAGGAGGTGG + Intergenic
1200553179 Y:4603468-4603490 TATGAGTAGGCTGGAGGAGGTGG + Intergenic
1200639660 Y:5701610-5701632 TAGAAGTTTGCTTCAGGAGCAGG + Intronic
1200655082 Y:5890859-5890881 TAGAAGCCTGCTGCACTAGGGGG - Intergenic
1201167941 Y:11228210-11228232 CAGAAGTAGGCTTCAGAAGGAGG - Intergenic
1201312944 Y:12613193-12613215 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1201371355 Y:13268504-13268526 CAGAAGTAGGCTTCAGAAGGTGG - Intronic
1201390053 Y:13488400-13488422 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1201394636 Y:13535815-13535837 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1201465026 Y:14270758-14270780 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1201608823 Y:15817291-15817313 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1201689879 Y:16752004-16752026 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1201752128 Y:17444704-17444726 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1201892426 Y:18957157-18957179 CAGAAGTAGGCTTCAGAAGGTGG + Intergenic
1201922302 Y:19246402-19246424 TAGAAGTAGACTTCAGAAGGTGG + Intergenic
1201979228 Y:19889936-19889958 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic
1202096168 Y:21250262-21250284 TAGAAGTAGACTTCAGAAGGTGG - Intergenic
1202522766 Y:25714685-25714707 CAGAAGTAGGCTTCAGAAGGTGG - Intergenic