ID: 916091903

View in Genome Browser
Species Human (GRCh38)
Location 1:161314199-161314221
Sequence AAGTCGGCTGCAGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916091896_916091903 2 Left 916091896 1:161314174-161314196 CCGAAATCCTGGCAAATTCCGGT 0: 1
1: 0
2: 0
3: 9
4: 93
Right 916091903 1:161314199-161314221 AAGTCGGCTGCAGGAGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 218
916091893_916091903 17 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091903 1:161314199-161314221 AAGTCGGCTGCAGGAGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 218
916091897_916091903 -5 Left 916091897 1:161314181-161314203 CCTGGCAAATTCCGGTAGAAGTC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 916091903 1:161314199-161314221 AAGTCGGCTGCAGGAGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091903 Original CRISPR AAGTCGGCTGCAGGAGGCGG AGG Intergenic
900649495 1:3723961-3723983 AGGTGGCCTGCAGGAGGCTGAGG + Intronic
901429139 1:9201808-9201830 GAGTCAGCTGGAGGAGGAGGAGG - Intergenic
902510822 1:16966082-16966104 CAGGCAGCTGCAGAAGGCGGTGG + Exonic
903331120 1:22597688-22597710 AAGTCTGCTACGGGAGGCTGCGG + Exonic
904738150 1:32651025-32651047 AAGTCGGCTCGGGGAGGCGTGGG + Intergenic
905318076 1:37096254-37096276 AAGACAGCAGCAGGAGACGGTGG + Intergenic
905873211 1:41416564-41416586 AGGGCGGCCGCAGGAGGCAGAGG - Intergenic
906365464 1:45206161-45206183 AATCCGGCTGCAGGTGGGGGCGG + Exonic
907178881 1:52552993-52553015 GCGGCGGCAGCAGGAGGCGGAGG - Intronic
908353223 1:63306691-63306713 AAATCGGTTGCGGGAGGCTGAGG - Intergenic
911041859 1:93597727-93597749 AGGTCTGATGCAGGAGGCTGAGG + Intronic
912631132 1:111247695-111247717 AAGAAGGCTGCAAGAGACGGAGG - Intergenic
914243901 1:145872146-145872168 GGGTCGGCTGCGGGAGGCGGTGG - Exonic
915974895 1:160378918-160378940 AAGTCAGCTGCAAGAAGCTGAGG + Intergenic
916091903 1:161314199-161314221 AAGTCGGCTGCAGGAGGCGGAGG + Intergenic
916814423 1:168337700-168337722 AAGTTTGCTGCAGGTGGAGGGGG - Intergenic
917971005 1:180207706-180207728 GAGCCGGCTGCAGGAGGTGCTGG + Intergenic
920914688 1:210250805-210250827 TAATCGGCTAAAGGAGGCGGGGG - Intergenic
921138833 1:212286029-212286051 GAGACGGCAGGAGGAGGCGGGGG - Exonic
922074775 1:222232689-222232711 AAGTGGGCTGGAGAAGGCAGGGG + Intergenic
922239327 1:223745269-223745291 AGGTGGGCTGCAGGAGGAGCTGG - Intronic
924134891 1:240955300-240955322 AAGTTGGCTTTAGGAGGCCGAGG + Intronic
924268324 1:242305673-242305695 AAGTAGGCTACAGGAGGCTGAGG - Intronic
1063695649 10:8332635-8332657 AAGCCGGCTGCAGCAGGCACGGG - Intergenic
1064553067 10:16521484-16521506 AAGTCGATCGCAGGCGGCGGCGG - Exonic
1065394564 10:25220323-25220345 AAGTTGGCTGGAGGAAGTGGAGG + Intronic
1066716582 10:38293073-38293095 AAGTAGGCTACAGGAGGCTGAGG + Intergenic
1067753248 10:48985593-48985615 GAGTCCGCTGCTGGAGGCGAGGG + Intergenic
1069069263 10:63976963-63976985 AAGTGGGCTGGTGGAGGCTGGGG - Intergenic
1070653667 10:78255944-78255966 AAGTCACCTGCAAGAGGCAGTGG + Intergenic
1070833601 10:79434891-79434913 GATTGGGCTGCAGTAGGCGGGGG - Intronic
1071456496 10:85855289-85855311 AAGGAGGCAGCAGGAGGCTGAGG + Intronic
1072950944 10:99846316-99846338 AACTGGGCTGCAGTGGGCGGAGG - Intronic
1076146453 10:128126158-128126180 AAGTCCGCCGCAGGAGGAGCCGG + Exonic
1080300290 11:30776789-30776811 AAGGCTGAGGCAGGAGGCGGAGG - Intergenic
1081400373 11:42636077-42636099 AAGTCTGCTGCAGGGTGTGGGGG + Intergenic
1081645201 11:44785525-44785547 AAGCCTGCTTCAGGGGGCGGTGG - Intronic
1081856214 11:46305355-46305377 GAGGCGGGTGGAGGAGGCGGCGG - Intronic
1083307882 11:61770317-61770339 AAGTGGGCTGGAGGTGGGGGCGG - Exonic
1083398955 11:62410968-62410990 AACTCGGCTGCTGAAGGCTGAGG - Intronic
1083610178 11:64000641-64000663 AGGGCGGCTCCGGGAGGCGGGGG + Intronic
1085514494 11:77104458-77104480 AAGTGGGCTGCAGGCGGCAGTGG + Intronic
1086322340 11:85664292-85664314 AAGTCCCCAGGAGGAGGCGGCGG - Exonic
1091558682 12:1594456-1594478 GCGGCGGCGGCAGGAGGCGGAGG - Intronic
1095538941 12:43285957-43285979 AAGTCGGTTGCAGAAGGAGGTGG + Intergenic
1097170780 12:57111432-57111454 AAGTGGGCTGGAGGAGGAAGAGG + Exonic
1097492130 12:60283095-60283117 ACGCCAGCTGCAGGAGGGGGAGG - Intergenic
1101337771 12:103811395-103811417 GAGACGGCTGGAGGAGGCTGGGG + Intronic
1102428157 12:112860892-112860914 AAGTGGGCTCATGGAGGCGGGGG - Intronic
1103108617 12:118253969-118253991 AACTGGGATCCAGGAGGCGGAGG + Intronic
1103557789 12:121776403-121776425 AGGTGGGCTGCAGGATGGGGGGG - Exonic
1103719168 12:122964300-122964322 AAATAGGCTTCTGGAGGCGGGGG - Intronic
1104030914 12:125065403-125065425 AAGCGGCCCGCAGGAGGCGGCGG + Exonic
1106478026 13:30114794-30114816 CGGGCGGCTGCGGGAGGCGGCGG + Intergenic
1113484042 13:110641780-110641802 AAGGCACCTGCAGGAGGTGGCGG + Intronic
1113860029 13:113475920-113475942 AGGACGGCTCCAGTAGGCGGTGG - Intronic
1113907522 13:113826679-113826701 AGGCCGGCGCCAGGAGGCGGGGG - Intronic
1116019161 14:39440887-39440909 AAGGCCGCTGCAGTAGGAGGGGG + Intergenic
1117507278 14:56416256-56416278 AAGTAGGCTGCACGAGCAGGTGG + Intergenic
1117533731 14:56684656-56684678 AAGTAGTCTGCTGGAGGAGGTGG + Intronic
1121192166 14:92040260-92040282 AACGCAGCTGCAGGAGGCCGAGG - Exonic
1122607246 14:102955015-102955037 AAGGAGGCTGCAGGAGGGGGCGG - Intronic
1122984897 14:105207514-105207536 GAGCAGGCAGCAGGAGGCGGCGG + Intergenic
1123219807 14:106844814-106844836 GAGACGGCTGCAGGAGGGGCCGG - Intergenic
1123917809 15:25050131-25050153 AAGTTGGCTGCAGGATGGGATGG + Intergenic
1125721378 15:41846760-41846782 GAGTGGGCTGCAGGAGGGGCAGG - Exonic
1125722730 15:41852952-41852974 AGGGCGGCTGCAGGAGCTGGAGG - Exonic
1125729222 15:41883377-41883399 GAGCCTGCTGCAGGAGGTGGAGG - Exonic
1130053891 15:80506390-80506412 AAGGTGGCAGCAGGAGGCAGTGG + Intronic
1131693860 15:94855471-94855493 AAGATGGCGGCAGGAGGCAGTGG + Intergenic
1133090633 16:3401273-3401295 GAGTCGGCTGCAGGTGGGTGCGG + Intronic
1133386925 16:5377275-5377297 AAGGAAGCTGCAGGATGCGGAGG + Intergenic
1133692854 16:8233256-8233278 AAAAAGGCTCCAGGAGGCGGAGG + Intergenic
1135046899 16:19163352-19163374 AGGTGTGCTGCAGGAGGAGGAGG - Intronic
1135525672 16:23212100-23212122 TAGTTGGCTGCAGGAGGTAGAGG - Exonic
1136427812 16:30180912-30180934 AAGTGGGCTGCAGCAGGGGAAGG - Intergenic
1137617276 16:49855536-49855558 AAGCCGGGAGCAGGAGGCGGAGG - Intronic
1140192826 16:72832767-72832789 CAGCTGGCTGCAGGAGGCAGAGG + Intronic
1141165471 16:81657850-81657872 TTGTAGGCTCCAGGAGGCGGAGG - Intronic
1141553188 16:84819834-84819856 CAGCGGGCTGAAGGAGGCGGGGG - Intergenic
1142720336 17:1771629-1771651 AAGTGGGCTGCAGGAGACGGTGG + Intronic
1142862539 17:2771575-2771597 GAATCGCCTCCAGGAGGCGGAGG - Intergenic
1142903355 17:3026831-3026853 AAGTGGGGAGCAGGAGGCAGCGG + Intronic
1144948520 17:18981955-18981977 CAGGAGCCTGCAGGAGGCGGTGG - Intronic
1147162069 17:38574122-38574144 TATTCAGCTGTAGGAGGCGGAGG - Intronic
1148431950 17:47650017-47650039 AAATGGGCTGCTGGCGGCGGGGG - Exonic
1150578038 17:66447312-66447334 AAGTCGCATGCAAGAGGCTGAGG - Intronic
1151810936 17:76441442-76441464 AGGTGGGCTGCAGGAGGGGCAGG - Intronic
1152319689 17:79601443-79601465 AAGTCTGCTGCAGGGGAAGGGGG - Intergenic
1157568194 18:48694306-48694328 AGGAGGGCTGCAGGAGGCAGAGG + Intronic
1157796523 18:50580171-50580193 GAGTAGGCTGGAGGAGGAGGAGG + Intronic
1160403431 18:78628419-78628441 AAGTGGGCTGCTAGAGGCTGTGG - Intergenic
1161107463 19:2451754-2451776 AACTCGGCTGGAGGAGGCCACGG + Intronic
1161427128 19:4209911-4209933 AAGTAAGCGGCAGGAGGCAGGGG + Intronic
1161768312 19:6218624-6218646 AGGACAGCTGCAGGAGGAGGAGG - Intronic
1162152589 19:8656503-8656525 AGGTGGGCTGCAGGAGAAGGTGG - Intergenic
1162331358 19:10031767-10031789 AAGGCGGCTGCCGGGCGCGGTGG + Intergenic
1162654410 19:12117682-12117704 AAGTCGCCTGCAGGGGGCCTGGG - Intronic
1165837702 19:38769867-38769889 AAGGCGGATGCAGGAAGCTGGGG - Intronic
1165840752 19:38788104-38788126 AAGTAGACTGGGGGAGGCGGGGG - Intergenic
1165841860 19:38792832-38792854 AAGGCGGATGCAGGAAGCTGGGG + Intergenic
1165993070 19:39826945-39826967 ACGGCGGCTGCAGGAGGTGCTGG - Exonic
1166043938 19:40218458-40218480 GAGTCGGCTGCCGGAGGTGAGGG - Intergenic
1166091643 19:40513087-40513109 GCGGCGGCTGCAGGAGGCGCGGG + Exonic
1166099042 19:40560161-40560183 ACGGCAGCTGCAGGAGGGGGCGG + Exonic
1166142137 19:40810901-40810923 AAGCCGGCCGCAGGAGTCGGAGG - Intronic
1166185383 19:41135893-41135915 AAGCCGGCCGCAGGAGTCGGAGG + Intergenic
1167157103 19:47745557-47745579 AAGATGGCGGCAGGAGGCAGTGG + Exonic
1167469189 19:49666029-49666051 AAGTTGAGTGGAGGAGGCGGCGG + Exonic
1168041753 19:53764601-53764623 GAATCGCCTCCAGGAGGCGGAGG - Intergenic
925977297 2:9150230-9150252 ACGTAGGCTCCATGAGGCGGTGG + Intergenic
926078660 2:9965271-9965293 TAGTCAGCTACAGGAAGCGGTGG - Exonic
926090029 2:10043629-10043651 ACGTGGGCTGCGGGCGGCGGCGG - Exonic
927680013 2:25132887-25132909 AAGGAGCCTGCAGGAGGTGGCGG - Exonic
927827151 2:26316843-26316865 AAGCTGGCTGCAGGAGGCCCGGG + Intronic
928763280 2:34610039-34610061 AAGTCTGCTGCAAGAGGTGTTGG + Intergenic
928898826 2:36295961-36295983 AAATTGGCTGTAGGAGACGGGGG + Intergenic
929115593 2:38441351-38441373 AGGTGGGCTGCAGGAGACGGAGG + Intergenic
930476863 2:51892478-51892500 AAGTAGGGTTCAGGAGGGGGTGG + Intergenic
932281677 2:70498375-70498397 AAATAGGCTGCAGGAAGAGGAGG + Intronic
934924920 2:98375462-98375484 AGGTTGGTTGCAGGAGGAGGTGG - Intronic
935070021 2:99685936-99685958 CAGTAGGCTGTGGGAGGCGGAGG + Intronic
937288140 2:120765860-120765882 AAGGCGGCTGCAGGAGACTCAGG + Intronic
938644562 2:133317645-133317667 AAGTCGGCTACAGCTGGCGAAGG - Intronic
940005144 2:149003340-149003362 AAGCCCGCTGCAGGAGACAGTGG + Intronic
940833019 2:158489562-158489584 AAGGCAGCTGCAGGGGGCAGAGG - Intronic
942681022 2:178478654-178478676 GAGCCCGCTGCGGGAGGCGGAGG - Intergenic
944573784 2:201071641-201071663 CAGGCTGCTGCGGGAGGCGGCGG - Exonic
946182962 2:217959991-217960013 AAGCCGGCAGGAGGAGGAGGAGG + Intronic
946767332 2:223052871-223052893 CAGGGGGCTGCTGGAGGCGGCGG - Exonic
1172447118 20:34999068-34999090 ACTGCGGCTGCAGGAGGCAGAGG + Exonic
1172694617 20:36813667-36813689 AAGGCGGAGACAGGAGGCGGAGG + Intronic
1173916972 20:46714920-46714942 AACTGGGGTGCAGGAGGCAGAGG - Intronic
1175653180 20:60746622-60746644 AAGTCAGCTGGAGGAGGGTGGGG + Intergenic
1176131749 20:63499265-63499287 AAGACGGACGCGGGAGGCGGGGG + Exonic
1176240527 20:64073808-64073830 GAGTCGGCCGTAGGAGGCGGCGG + Exonic
1179727019 21:43346477-43346499 ATGTCTTCTGCAGGAGGAGGGGG - Intergenic
1179887815 21:44321947-44321969 AGGCCGGCTGCTGGAGGTGGAGG + Intronic
1179919135 21:44497996-44498018 AAGCCGGCTGGAGGGGGCAGAGG + Exonic
1179966527 21:44810001-44810023 AAGAAGGCTGCATGAGGCCGGGG + Intronic
1180797169 22:18611572-18611594 ACATCCGCGGCAGGAGGCGGGGG - Exonic
1181224554 22:21383699-21383721 ACATCCGCGGCAGGAGGCGGGGG + Exonic
1181254078 22:21551114-21551136 ACATCCGCGGCAGGAGGCGGGGG - Exonic
1181698778 22:24608372-24608394 AAGTAGGCTGCTGGAGGAGCAGG - Intronic
1182550186 22:31096755-31096777 ACGGCGGCTGCAGGAGGCACGGG + Exonic
1184032633 22:41903981-41904003 GAGTGGGCTCCAGGAGGCAGGGG - Intronic
1184861457 22:47175313-47175335 AAGGAGGCGGCAGGAGGAGGAGG - Exonic
1185148163 22:49150333-49150355 AGGCCAGCTGCAGGAGGCCGGGG + Intergenic
1185325108 22:50221703-50221725 CAGGGGGCTGCAGCAGGCGGAGG - Exonic
953326176 3:42013923-42013945 AGGCGGGCAGCAGGAGGCGGCGG + Intronic
954016841 3:47700600-47700622 AAGGAGGTTGCAGGAGGCGGAGG - Intronic
955997071 3:64688208-64688230 CTGCCGGCTGCAAGAGGCGGAGG + Intergenic
957486658 3:80870815-80870837 AAGTAGGCTGAGGGAGGCTGAGG + Intergenic
959026711 3:101247945-101247967 AAGTCTCCTGGAGGAGGGGGAGG - Intronic
965513218 3:169592357-169592379 AAGTAGGCTGCAGTTGGCTGAGG - Intronic
967979771 3:195058811-195058833 CAGTGGGATGCAAGAGGCGGTGG + Intergenic
967995776 3:195165285-195165307 TAGTTGGCTGGAGGAGGCTGAGG - Intronic
968446015 4:652395-652417 AAGGGGGTTGCAGGAGGCCGGGG + Intronic
969349731 4:6591473-6591495 ACGTCCTCTGCAGGAGTCGGAGG - Intronic
969657949 4:8508870-8508892 AAGTAGGCGGCGGGAGGAGGAGG - Intergenic
973184613 4:47311104-47311126 AAGTCCGCTGGAGGACGCGGTGG + Intronic
978130181 4:105186557-105186579 GAATCGCCTCCAGGAGGCGGAGG - Intronic
984645007 4:182209881-182209903 AAGTCATCTGCAGGGGGAGGTGG + Intronic
984801833 4:183723081-183723103 AAGGCGGGTGCTGGCGGCGGCGG - Intergenic
985086999 4:186324311-186324333 AAGTCATATGCAGGAGGCTGAGG + Intergenic
987423256 5:17745689-17745711 ATGTCTGCTGGAGGAGGTGGTGG + Intergenic
987540989 5:19255671-19255693 AAATCTGCTGCAGGAGGTGAGGG + Intergenic
988544988 5:32147348-32147370 AATCCTGGTGCAGGAGGCGGAGG + Intronic
989067791 5:37481334-37481356 AAGTTTGCTGCAGGGAGCGGGGG - Intronic
992393627 5:76351923-76351945 AAATCGGCTGCTGGACGCGGTGG + Intronic
992399993 5:76403285-76403307 AAACCTGCTGCGGGAGGCGGCGG + Exonic
993105389 5:83594386-83594408 AAGTCAGCTGCAGGAATTGGTGG + Intergenic
997210503 5:132074231-132074253 CAGCTGGCTGCAGGAGGAGGGGG + Intronic
997295810 5:132767545-132767567 ATGTCGGCTGCAGGTTGGGGAGG + Intronic
999727157 5:154446407-154446429 AAGGGGGCTTCCGGAGGCGGAGG + Exonic
1002521553 5:179795568-179795590 AAGTAGGCTGGGGGAGGAGGGGG - Exonic
1003172735 6:3733003-3733025 CAGTCCCCTGCAGGAGGCTGAGG + Intronic
1006334054 6:33411218-33411240 AAGGAGGCGGCAGGAGGCGCTGG + Intronic
1007029289 6:38613521-38613543 AGGTGGGGTGCAGGAGGTGGAGG + Intronic
1008092775 6:47309461-47309483 GATGCGGCTGCAGGAGGCGAGGG + Exonic
1009896569 6:69758458-69758480 AAGTAGGCTGCAGTAGGAAGGGG - Intronic
1011441421 6:87391263-87391285 GAGCCGGGTGCAGGAGGAGGTGG - Intronic
1012281178 6:97329446-97329468 AAGTCGGTGGCAGGGCGCGGTGG - Intergenic
1013239553 6:108231186-108231208 AAGGCTGAGGCAGGAGGCGGAGG - Intronic
1013442917 6:110189876-110189898 AAGCCAGCTGCAAGAGGCAGAGG - Intronic
1015266189 6:131294361-131294383 AAGCCGGCTGCAGGAGAAAGAGG - Intergenic
1016588484 6:145716597-145716619 ATGGCAGCTGCAGGAGGCTGTGG - Intronic
1016880285 6:148904905-148904927 AGGGCAGCTGCAGGAGGTGGAGG - Intronic
1017006176 6:150029303-150029325 ATGTCTGGTGCGGGAGGCGGGGG + Intergenic
1018867908 6:167759775-167759797 AAGTCCGCTGCAAGAGGATGTGG + Intergenic
1020106253 7:5423555-5423577 GAGGCGGCTGCGGGTGGCGGAGG - Intronic
1022103345 7:27182132-27182154 AGGTGGGCTGTAGGAGGCGGTGG + Exonic
1022819385 7:33944247-33944269 CACTTGGATGCAGGAGGCGGAGG - Intronic
1023189012 7:37559304-37559326 AAGACGGCTGCAGGAGCCTGGGG - Intergenic
1023255835 7:38311465-38311487 GGGGCGGCTGCCGGAGGCGGTGG - Intergenic
1023881946 7:44325689-44325711 AAGGCGCGTGCAGGGGGCGGCGG - Intronic
1023905971 7:44521758-44521780 AAGGCGGCAGCAGGAGGACGGGG + Exonic
1024134482 7:46392562-46392584 AAGTTGGCTGCAGGAGTGGAAGG - Intergenic
1029424822 7:100488880-100488902 AGGTTGGCAGCAGGAGGTGGAGG - Exonic
1029443506 7:100600846-100600868 CAGAGGGCTGAAGGAGGCGGGGG + Exonic
1029510700 7:100993115-100993137 TGGTCGGCTGCGGGAGGTGGTGG - Exonic
1029537216 7:101163778-101163800 TCGGGGGCTGCAGGAGGCGGCGG - Exonic
1031341733 7:120611077-120611099 AAGAGGGCTGCTGGAGGCTGTGG - Intronic
1032440809 7:131941585-131941607 AAATCAGCTGCAGGGGGCTGAGG - Intergenic
1032735833 7:134692066-134692088 AAGGCGGGGGCGGGAGGCGGTGG + Intergenic
1034895042 7:154871131-154871153 GAGTGGGCTGGAGGAGGAGGAGG - Intronic
1035004444 7:155644753-155644775 GAGGGGGCTGCAGGAGGCAGAGG - Exonic
1038644033 8:29348854-29348876 AATGCGGCGGCGGGAGGCGGAGG + Intronic
1039554957 8:38468693-38468715 CAGGCAGCTGCAGGGGGCGGAGG - Intronic
1042374437 8:68032914-68032936 AGGTGGTCTGCAGGAGGCTGTGG - Intronic
1045575468 8:103415367-103415389 AAGTCGCCTGTGGGAGGAGGTGG + Exonic
1046659963 8:116938471-116938493 GAGGCGCGTGCAGGAGGCGGCGG + Exonic
1046878041 8:119277726-119277748 AAGTCTGCTGCAGGGGGTGGAGG - Intergenic
1049381809 8:142319921-142319943 ACGCCAGCTGCAGGAGGAGGCGG - Intronic
1049989415 9:977359-977381 AACTCGGCAGCAGGGCGCGGCGG - Exonic
1055549562 9:77419432-77419454 AAGACTGCTGCAGGAGGCACCGG + Exonic
1056604703 9:88076856-88076878 AGCTGGGCTGCAGGAGACGGAGG - Intergenic
1056990468 9:91405888-91405910 GAGTCGGCGGCCGGGGGCGGGGG - Intergenic
1057168638 9:92947580-92947602 CAGTGGGCAGCAGGAGGCTGGGG - Exonic
1059235727 9:112759258-112759280 AACTAGGCAGCAGGAGGCTGAGG - Intronic
1060493567 9:124102029-124102051 AAGTTGGCTGTGGGAGGCTGCGG - Intergenic
1060794131 9:126503327-126503349 GAGGCGGCAGGAGGAGGCGGGGG - Exonic
1061200687 9:129136789-129136811 TGGTGGGCTGGAGGAGGCGGAGG + Intronic
1061275622 9:129568315-129568337 AACCCGGCTGGAGGTGGCGGTGG - Intergenic
1061680861 9:132241860-132241882 ACGTTGGCTGCAGGCGGAGGGGG - Exonic
1062127135 9:134869925-134869947 CAGATGGCTGCAGGAGGGGGGGG + Intergenic
1203790709 EBV:150234-150256 CAGTGGGCCGCAGGCGGCGGAGG + Intergenic
1185893237 X:3838125-3838147 GAGTGGCCTGCAGGTGGCGGAGG + Intronic
1185898349 X:3876547-3876569 GAGTGGCCTGCAGGTGGCGGAGG + Intergenic
1185903464 X:3914976-3914998 GAGTGGCCTGCAGGTGGCGGAGG + Intergenic
1187514867 X:19959882-19959904 AGGTTGGCTTCAGGAGGCAGAGG - Intronic
1187708791 X:22033126-22033148 AAGTGGAGTGCAGGAGGCCGGGG + Intronic
1192709259 X:73563106-73563128 GGGGCGGCTGCTGGAGGCGGGGG - Intergenic
1194880940 X:99251632-99251654 TAGTAGGTTGCAGGAGGGGGTGG - Intergenic
1195997865 X:110749380-110749402 AAGCTGTCTGCAGGAGGGGGAGG - Intronic
1196886442 X:120250818-120250840 GCGTTGGCGGCAGGAGGCGGCGG + Exonic
1197765226 X:130055804-130055826 AAGGAGGCTGGAGGAAGCGGTGG - Intronic