ID: 916091904

View in Genome Browser
Species Human (GRCh38)
Location 1:161314202-161314224
Sequence TCGGCTGCAGGAGGCGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 623}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916091896_916091904 5 Left 916091896 1:161314174-161314196 CCGAAATCCTGGCAAATTCCGGT 0: 1
1: 0
2: 0
3: 9
4: 93
Right 916091904 1:161314202-161314224 TCGGCTGCAGGAGGCGGAGGAGG 0: 1
1: 0
2: 3
3: 77
4: 623
916091897_916091904 -2 Left 916091897 1:161314181-161314203 CCTGGCAAATTCCGGTAGAAGTC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 916091904 1:161314202-161314224 TCGGCTGCAGGAGGCGGAGGAGG 0: 1
1: 0
2: 3
3: 77
4: 623
916091893_916091904 20 Left 916091893 1:161314159-161314181 CCAGCGGCGTTTCTGCCGAAATC 0: 1
1: 0
2: 1
3: 0
4: 23
Right 916091904 1:161314202-161314224 TCGGCTGCAGGAGGCGGAGGAGG 0: 1
1: 0
2: 3
3: 77
4: 623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916091904 Original CRISPR TCGGCTGCAGGAGGCGGAGG AGG Intergenic
900270937 1:1788311-1788333 GTGGCTGCAGGAGGTGGAGGAGG - Intronic
900333984 1:2151910-2151932 GAGGCTGCAGGAGGAGGTGGAGG - Intronic
900474332 1:2869179-2869201 CCGGCTGCAGGTGGAGGAGTGGG + Intergenic
901086217 1:6613803-6613825 GTGGCTGCAGGGGGCGGCGGCGG - Exonic
901138624 1:7013629-7013651 CTGGCTGCAGGTGGCAGAGGTGG + Intronic
901414643 1:9108264-9108286 TGAGCTGGAGGAGGAGGAGGAGG - Intronic
901421129 1:9151869-9151891 AAGGATGCAGGAGGCCGAGGTGG + Intergenic
901429138 1:9201805-9201827 TCAGCTGGAGGAGGAGGAGGAGG - Intergenic
901458630 1:9378163-9378185 ACGGCTGCAGGAGACCCAGGAGG - Intergenic
901629743 1:10642277-10642299 GCGGCCGCAGGAGGAGGAAGAGG + Intronic
901758435 1:11455486-11455508 TCGGCTGCACCGGGCGGTGGTGG + Intergenic
902090073 1:13896102-13896124 TAGGTAGCAGGAGGCAGAGGTGG - Intergenic
902241680 1:15094247-15094269 CCGGCTGCAGCAGGTGGAGCTGG + Exonic
902596734 1:17514845-17514867 TTGGCTGGAGGTGGGGGAGGAGG + Intergenic
902685354 1:18073245-18073267 TCCTCTGCAGGAGTAGGAGGCGG + Intergenic
903072145 1:20731854-20731876 TCCGCTGCAGGGGACGGAGGAGG + Intronic
903097559 1:20992536-20992558 TCAGCAGGAGGAGGAGGAGGAGG - Intronic
904014600 1:27409910-27409932 TCAGCTGCTGGTGGTGGAGGAGG + Exonic
904430756 1:30462583-30462605 TGGGCTGCGGGAGGGGGAAGGGG + Intergenic
904705118 1:32384135-32384157 GGGGCTGCAGGAGAGGGAGGAGG + Intronic
904766172 1:32849255-32849277 TCGACTCCAGGGGGCTGAGGTGG - Intronic
905553142 1:38859742-38859764 GCGGCTGCCGGGGGCGGTGGCGG - Exonic
906775585 1:48526518-48526540 GCAGCGGCAGGAGGAGGAGGAGG + Intergenic
906988567 1:50713045-50713067 CCAGCTACAGGAGGCTGAGGTGG + Intronic
908128741 1:61054011-61054033 GAGGCTGCAGGAGGCGGCTGTGG - Intronic
908816737 1:68042957-68042979 TGGGCAGCAGGAGGTGGGGGTGG - Intergenic
908951526 1:69568063-69568085 GCAACTGCAGGAGGCGGTGGCGG - Intergenic
909496035 1:76279654-76279676 GCAGCTGCCGGAGGCGGAAGTGG + Intronic
910205871 1:84748236-84748258 CAGGCTGCAGGGGGCGGAGGGGG - Intergenic
911871853 1:103108659-103108681 TGGGCTGAGGGAGGCGGGGGCGG - Intergenic
912382459 1:109254842-109254864 TCCCCTCCAGGAGGCGGAAGAGG + Intronic
912401574 1:109397814-109397836 GCAGCTGCAGGAGGAGGAGGAGG + Exonic
912486665 1:110034701-110034723 GCGGCTGCCGGCGGCGGAGGTGG - Exonic
912560100 1:110544974-110544996 GCGGCTGCAGGGGGTGGAAGTGG + Intergenic
912718939 1:112003534-112003556 TTGGCTTCAGGAGCAGGAGGAGG + Intergenic
912927889 1:113929673-113929695 ACGGCAGCAGGAGGCCGAGGCGG + Intronic
913556808 1:119975563-119975585 TTGAATCCAGGAGGCGGAGGTGG + Intronic
913720514 1:121588095-121588117 TTTGCTGCTGGAGGTGGAGGTGG - Intergenic
914950601 1:152110483-152110505 GCTGCTGCAGGAGGAGGAGGAGG - Exonic
914993106 1:152515484-152515506 GCCGCAGCAGGAGGAGGAGGAGG - Exonic
915235803 1:154480558-154480580 TCTGCCGCAGGATGGGGAGGTGG - Exonic
916091904 1:161314202-161314224 TCGGCTGCAGGAGGCGGAGGAGG + Intergenic
916491578 1:165306886-165306908 TGGGCAGGGGGAGGCGGAGGAGG - Intronic
917202600 1:172533164-172533186 GCGGCTGCAGGAGGCGGGCGTGG + Exonic
918190573 1:182170179-182170201 CCAGCTACAGGAGGCTGAGGTGG + Intergenic
918282856 1:183023241-183023263 GCGACTCCAGGAGGCGGCGGGGG - Intergenic
919004491 1:191878538-191878560 TCAGCTTCGGGAGGCTGAGGAGG - Intergenic
919740649 1:200979483-200979505 TCGGCTGCAGCAGGCTGTGTTGG - Intronic
921394483 1:214654075-214654097 ACAGCAGCAGGAGGAGGAGGGGG - Intronic
922196454 1:223364086-223364108 GCGGGGGGAGGAGGCGGAGGAGG - Intronic
922239326 1:223745266-223745288 TGGGCTGCAGGAGGAGCTGGTGG - Intronic
922398048 1:225223031-225223053 TGGGCTGAAGGAGAAGGAGGAGG - Intronic
922526676 1:226309348-226309370 TCGGCCGGAGGCGGCGGCGGAGG - Exonic
923855097 1:237837838-237837860 TCTGGTGCAGGAAGCAGAGGTGG + Intergenic
924134892 1:240955303-240955325 TTGGCTTTAGGAGGCCGAGGCGG + Intronic
924329121 1:242924806-242924828 CAGACTCCAGGAGGCGGAGGTGG - Intergenic
1062846639 10:712189-712211 GGGGTTGCAGGAGGCTGAGGTGG + Intergenic
1062846663 10:712285-712307 GGGGCTGCAGGAGGCTGACGTGG + Intergenic
1064222806 10:13455969-13455991 GGAGCTGCAGGAGACGGAGGTGG - Intronic
1065356353 10:24845869-24845891 TCAGCTTCAGGGGGCTGAGGTGG - Intergenic
1065712739 10:28533170-28533192 GCGGCGGCGGGAGGAGGAGGAGG + Intronic
1066038572 10:31521007-31521029 TCTGCTGCAGGGAGTGGAGGAGG - Exonic
1066602844 10:37126030-37126052 GGGGCTGCAGGAGGAGGTGGGGG + Intronic
1067318715 10:45198062-45198084 GGGGCTGCAGGAGGAGGAGGCGG - Intergenic
1067344176 10:45426023-45426045 TTGGGTGCAGGAGGAGGAGGAGG - Intronic
1067416662 10:46107824-46107846 TCGGCTTTGGGAGGCCGAGGCGG + Intergenic
1069595103 10:69665201-69665223 GAGGCTGGAGGAGGAGGAGGGGG + Intergenic
1070039098 10:72757273-72757295 TCAGCTGGAGGAGGTGGTGGTGG - Intronic
1070162480 10:73874435-73874457 ACGGGTGCAGGTGGCGGTGGTGG + Exonic
1070843877 10:79506615-79506637 CCAGCTGCAGGAGGTGGATGAGG + Intergenic
1070843939 10:79506933-79506955 ACAGCTGCAGGAGGTGGATGAGG + Intergenic
1070843952 10:79507002-79507024 ACAGCTGCAGGAGGTGGATGAGG + Intergenic
1070843966 10:79507071-79507093 CCAGCTGCAGGAGGTGGATGAGG + Intergenic
1070843980 10:79507140-79507162 ACAGCTGCAGGAGGTGGATGAGG + Intergenic
1070844036 10:79507416-79507438 ACAGCTGCAGGAGGTGGATGAGG + Intergenic
1070844043 10:79507452-79507474 ACAGCTGCAGGAGGTGGATGAGG + Intergenic
1070844057 10:79507521-79507543 CCAGCTGCAGGAGGTGGATGAGG + Intergenic
1070844068 10:79507590-79507612 ACAGCTGCAGGAGGTGGATGAGG + Intergenic
1070929739 10:80252758-80252780 ACAGCTGCAGGAGGTGGATGAGG - Intergenic
1070929763 10:80252866-80252888 CCAGCTGCAGGAGGTGGATGAGG - Intergenic
1070929793 10:80253010-80253032 ACAGCTGCAGGAGGTGGATGAGG - Intergenic
1070930364 10:80256694-80256716 GAGCCTGCAGGAGGTGGAGGGGG + Intergenic
1072506155 10:96069401-96069423 TCGGGATCAGGAGGCTGAGGTGG + Intergenic
1072950943 10:99846313-99846335 TGGGCTGCAGTGGGCGGAGGAGG - Intronic
1073094672 10:100972347-100972369 TCTGATGCAGGAGGCTGGGGTGG - Intronic
1073251129 10:102120804-102120826 GCGGCTGGGGGAGGCGGAGCCGG + Intergenic
1073336517 10:102714296-102714318 GAGGCAGCAGGAGGAGGAGGAGG - Exonic
1074040312 10:109781656-109781678 TTGGTGGGAGGAGGCGGAGGAGG - Intergenic
1075207015 10:120456988-120457010 GCGGGCCCAGGAGGCGGAGGCGG + Exonic
1076383177 10:130038839-130038861 TAAGCTGGAGGAGGCGGAGACGG + Intergenic
1076683179 10:132185756-132185778 CGGGCGGCAGGAGGCGGGGGGGG + Intergenic
1076916387 10:133424725-133424747 TGTGATGCAGGAGACGGAGGGGG - Intergenic
1076936494 10:133569520-133569542 TGTGATGCAGGAGACGGAGGGGG - Intronic
1077085235 11:746990-747012 GCGGGTGCAGGAGGCAGAGCAGG - Intergenic
1077199726 11:1299915-1299937 TCGGGGGACGGAGGCGGAGGCGG + Intronic
1077281776 11:1749269-1749291 CTGGCAGGAGGAGGCGGAGGCGG - Intronic
1077571071 11:3339030-3339052 ACAGCTGCAGGAGGTGGATGAGG + Intergenic
1077571076 11:3339066-3339088 GCAGCTGCAGGAGGTGGATGAGG + Intergenic
1077571084 11:3339102-3339124 GCAGCTGCAGGAGGTGGATGAGG + Intergenic
1078553287 11:12294827-12294849 CCCGCTGTAGGAGGAGGAGGAGG - Exonic
1078759571 11:14241585-14241607 TGGGCTGCTGGAGGAGGAGCAGG + Intronic
1079208894 11:18442908-18442930 GTGGCTTCAGGAGGCTGAGGCGG - Intronic
1079210365 11:18455749-18455771 CCGGCTGCAGAAGGCGCACGAGG - Intergenic
1079600277 11:22303681-22303703 TCGGAAGCAGGAGGAGAAGGAGG + Intergenic
1080668797 11:34357919-34357941 GCGGCGGCAGAAGGAGGAGGCGG + Exonic
1080767513 11:35310250-35310272 GCAGCTGCAGGAGGCTGAGCTGG - Intronic
1081747903 11:45485898-45485920 CAGGCTGCTGGAGGTGGAGGAGG - Intergenic
1081856213 11:46305352-46305374 GCGGGTGGAGGAGGCGGCGGTGG - Intronic
1082843927 11:57712067-57712089 CCGCCCGCAGGAGGCGGTGGCGG + Exonic
1083398952 11:62410965-62410987 TCGGCTGCTGAAGGCTGAGGGGG - Intronic
1083430454 11:62611528-62611550 TCGGGTGCAGGAGCAGGAGATGG - Exonic
1083445955 11:62708154-62708176 TCCACTGGAGGAGGAGGAGGAGG + Intronic
1083448547 11:62727168-62727190 GAGGCGGCGGGAGGCGGAGGAGG - Exonic
1083477545 11:62923808-62923830 GCGGCTGCAGGCGGCGCACGTGG + Intergenic
1083672109 11:64305525-64305547 TCAGCTGGAGGAAGCGGAGTAGG + Intergenic
1083679574 11:64344914-64344936 CCGGCTGCGGGAGGCAGTGGAGG + Exonic
1083763053 11:64829137-64829159 TTGACCCCAGGAGGCGGAGGTGG + Intronic
1083887253 11:65578944-65578966 TCTTCTGGAGGAGGGGGAGGTGG + Intronic
1084263283 11:67992009-67992031 TCGCCTGCAGGAGGCGGTCCAGG - Intronic
1084681508 11:70669149-70669171 TCGGCTGCTGCTGGCTGAGGAGG + Intronic
1084717224 11:70881849-70881871 CTGGGTGCAGGAGGCTGAGGTGG - Intronic
1084810118 11:71607118-71607140 TCGCCTGCAGGAGGCGGTCCAGG + Intergenic
1085076727 11:73598132-73598154 TCGGCTGCGGGCGAGGGAGGAGG + Exonic
1085236962 11:75022778-75022800 TCAGCTCCAGGAGACAGAGGGGG - Intergenic
1088346118 11:108827712-108827734 TCGGCTGGAGGATGGGGAGCAGG - Intronic
1088697284 11:112378956-112378978 TTGAATCCAGGAGGCGGAGGTGG - Intergenic
1089302889 11:117509269-117509291 TGGGGTGAAGGAGACGGAGGAGG + Intronic
1090680946 11:129057025-129057047 CCGGCTGCAGAACACGGAGGAGG - Intronic
1090808447 11:130217414-130217436 TTGGCTGCAGGAGGCTGTGCGGG - Intergenic
1091454516 12:596807-596829 CCAGCTACAGGAGGCTGAGGTGG + Intronic
1091916754 12:4275415-4275437 TCGGCAGCTGGAGTCGGAGCAGG - Intronic
1092030358 12:5278606-5278628 TGGGCGGGAGGAAGCGGAGGTGG - Intergenic
1092162621 12:6324297-6324319 GAGGCTGGAGGAGGCGGCGGGGG - Intronic
1092176029 12:6407859-6407881 TTGACCCCAGGAGGCGGAGGAGG - Intergenic
1093490583 12:19700349-19700371 TGGGCTGAAGGAGGAGGAGCTGG + Intronic
1093884408 12:24443030-24443052 TTGAATCCAGGAGGCGGAGGTGG - Intergenic
1094129904 12:27063595-27063617 GCAGCAGCAGGAGGAGGAGGAGG - Intronic
1094653431 12:32399390-32399412 CCGGCCGGAGGAGGCGGCGGCGG + Intergenic
1095335088 12:41014245-41014267 TCAGATGTAGGAGGTGGAGGTGG + Exonic
1095433754 12:42164940-42164962 GCGCCTGTAGGAGGCTGAGGTGG + Intronic
1096241384 12:49961947-49961969 TGGGTCGCAGGCGGCGGAGGAGG - Exonic
1096495494 12:52037261-52037283 GCGGCTGCAGGAGCGCGAGGAGG + Intronic
1097173411 12:57129417-57129439 TCGGCTGCAAAAGGGGGTGGGGG + Intronic
1097242661 12:57586431-57586453 TGGGGAGCAGGAGGAGGAGGAGG - Exonic
1097334787 12:58370088-58370110 TTTGCGGCAGGAGGCAGAGGTGG + Intergenic
1101337772 12:103811398-103811420 ACGGCTGGAGGAGGCTGGGGAGG + Intronic
1102441383 12:112966405-112966427 TCTGCAGCAGGTGGAGGAGGTGG - Intronic
1102786739 12:115611197-115611219 GCTGCTCCAGGAGGCTGAGGTGG + Intergenic
1103500446 12:121397748-121397770 AAGGCTTCAGGAGGCGGAGGCGG - Intronic
1103645118 12:122385698-122385720 TCGGCTGCAGGAGGGGTAACAGG + Intronic
1103954270 12:124567629-124567651 GCGGCGGCGGGAGGGGGAGGAGG + Intergenic
1104877269 12:132044251-132044273 GCGGCTGGAGCAGGAGGAGGCGG + Exonic
1105016390 12:132788467-132788489 TCGGCTGCAGGTAGCAGAGCAGG - Intronic
1105223847 13:18409092-18409114 GGGGCTGCAGGAGGAGGAGGAGG + Intergenic
1105389116 13:19958913-19958935 TCCGGAGGAGGAGGCGGAGGCGG + Intronic
1105578912 13:21675577-21675599 GCTGCTGCCGGAGGAGGAGGAGG - Intronic
1106433390 13:29703508-29703530 GGGTCTGCAGGAGGCAGAGGAGG - Intergenic
1106478027 13:30114797-30114819 GCGGCTGCGGGAGGCGGCGGCGG + Intergenic
1106689320 13:32096720-32096742 TTGAATGCAGGAGGCAGAGGCGG + Intronic
1107512941 13:41103229-41103251 CCAGCTACAGGAGGCTGAGGTGG + Intergenic
1108385602 13:49896705-49896727 TTGCCTCCGGGAGGCGGAGGTGG - Intergenic
1108541804 13:51452738-51452760 CAGGCAGGAGGAGGCGGAGGCGG - Exonic
1108689156 13:52846813-52846835 CCGGCTGCTGGAGGCCGAGGTGG - Exonic
1108727909 13:53201604-53201626 CCGGCTGCTGGAGGCCGAGGTGG + Intergenic
1109693418 13:65923190-65923212 TTGAATCCAGGAGGCGGAGGTGG + Intergenic
1109699649 13:66009332-66009354 TCGGCTGCAGAGGCCGGAGCAGG + Intergenic
1110069546 13:71156722-71156744 TCAGCTCCAGGAGGAGGAGGAGG - Intergenic
1111356026 13:87103457-87103479 TCCACTTCAGGAGGCTGAGGTGG + Intergenic
1112054528 13:95677570-95677592 CGGGCCGCAGGAGTCGGAGGAGG + Intronic
1112438373 13:99407854-99407876 TGGGGTGGAGGAGGAGGAGGAGG + Intergenic
1113146058 13:107208884-107208906 TCTGCTGGAGGGGGAGGAGGGGG - Intronic
1113231079 13:108215159-108215181 GTGGCGGCAGGAGGCGGGGGAGG - Intronic
1113740671 13:112710552-112710574 AGGGCTCCAGGAGGCGGCGGAGG + Intronic
1113814875 13:113162990-113163012 CCGCCTGCAGGAGGAGGATGGGG - Exonic
1114007995 14:18333918-18333940 GGGGCTGCAGGAGGAGGAGGCGG + Intergenic
1114529737 14:23388301-23388323 GCGGCTGCAGGATGCCGAGGAGG - Exonic
1114535091 14:23417649-23417671 GCGGCTGCAGGAAGCTGAGGAGG - Exonic
1115986978 14:39112355-39112377 TTGAATCCAGGAGGCGGAGGTGG - Intergenic
1117400391 14:55354038-55354060 TCGGCTGCAGGCTGTGGAGAAGG + Intronic
1118333652 14:64833593-64833615 TCCCCTGCAGTAGGTGGAGGTGG + Intronic
1119003941 14:70907678-70907700 GCTGCTGCAGGAGGAGGAGGAGG - Exonic
1119421485 14:74510246-74510268 GGGGCTGCAGGATGGGGAGGAGG - Intronic
1120589265 14:86355964-86355986 TTGGGAGAAGGAGGCGGAGGCGG - Intergenic
1121404122 14:93708594-93708616 TCGGTTCCTGGAGGAGGAGGAGG + Intergenic
1121421813 14:93821209-93821231 CCAGCTGCAGGAGGTGGAGCGGG - Intergenic
1121742710 14:96265325-96265347 TCAGCTACAGGAGGCTGAGGTGG - Intronic
1122174752 14:99908691-99908713 TGGGCTGAAGGTGGCGGAGGTGG + Intronic
1122552190 14:102556165-102556187 CCAGATGCTGGAGGCGGAGGCGG - Intergenic
1122648249 14:103209302-103209324 TCTGCTCCAGCAGGAGGAGGGGG - Intergenic
1122786483 14:104166520-104166542 GCGGCTGCAGGTGGGGGATGAGG + Intronic
1122869696 14:104632257-104632279 TTGAATCCAGGAGGCGGAGGTGG + Intergenic
1122889082 14:104724330-104724352 GCGGCTGCAGCAGGAGGCGGCGG + Intronic
1122906036 14:104801939-104801961 TTGGCTGCAGGAACAGGAGGTGG - Exonic
1122972617 14:105158553-105158575 TGGGCTGCACTAGGCGGAGCAGG - Intronic
1122979372 14:105184757-105184779 GCAGGTGCAGGAGGAGGAGGAGG + Intergenic
1122984898 14:105207517-105207539 CAGGCAGCAGGAGGCGGCGGTGG + Intergenic
1123091793 14:105745258-105745280 TGGGGTGCAGGAGGAGCAGGGGG - Intergenic
1123125325 14:105941827-105941849 TCTGGTGCAGGATGAGGAGGTGG + Intergenic
1123691958 15:22845676-22845698 TGGGTTGCAGGAGGAGGAGGAGG + Intronic
1123991603 15:25687622-25687644 TCGCCTGAATGAGGCGAAGGAGG - Intronic
1124157139 15:27235919-27235941 TCTGCAGCAGGAAGAGGAGGAGG - Intronic
1125511882 15:40296590-40296612 TGAGCTGGAGGAGGAGGAGGTGG - Exonic
1125579704 15:40776490-40776512 CCACCTGCAGGAGGAGGAGGTGG - Intronic
1125722729 15:41852949-41852971 GCGGCTGCAGGAGCTGGAGGAGG - Exonic
1125723473 15:41856406-41856428 TCTGCTGCAGCAGGCTCAGGAGG - Exonic
1125852812 15:42920709-42920731 GCGGCGGCAGGAGGGGGAGCAGG - Intronic
1126183647 15:45810261-45810283 GCGGCCGCTGGAGGTGGAGGAGG - Intergenic
1127117577 15:55743159-55743181 GCGGCTGCAGAGGGCGGGGGCGG + Intergenic
1127466727 15:59250938-59250960 TGGGCTGCAGAAGACTGAGGGGG + Intronic
1128154162 15:65382274-65382296 CTGGCTGAAGGAGGGGGAGGAGG + Exonic
1128507329 15:68283535-68283557 TAGTATGCAGGAGGCTGAGGTGG + Intronic
1128645981 15:69379348-69379370 TGGGCTGCAGGAAGAGGAGGTGG - Intronic
1128994808 15:72288612-72288634 TAGGCTGCTGGAGACAGAGGTGG + Exonic
1129144327 15:73633353-73633375 GCGGCGGCAGGAGGAGGACGGGG - Exonic
1129683601 15:77672022-77672044 TTGGCCTCAGGAGGAGGAGGAGG - Intronic
1130076591 15:80695278-80695300 GCGGCAGGAGGAGGCGGAGGCGG - Intronic
1130076592 15:80695281-80695303 CCGGCGGCAGGAGGAGGCGGAGG - Exonic
1130884877 15:88084412-88084434 CAGGCTGCAGGAGGGAGAGGAGG + Intronic
1131180269 15:90234284-90234306 TCGGCTGCAGTAGGTGGTGGCGG + Intronic
1131830840 15:96353869-96353891 TCGTGTGCAGGAGGGGGAGGGGG - Intergenic
1132483395 16:177462-177484 ACGGGTGCAGGAAGGGGAGGAGG - Exonic
1132490117 16:223917-223939 TCGGGAGGAGGAGGAGGAGGCGG - Intronic
1132556455 16:574875-574897 CGGGCTGCAGGAGTGGGAGGGGG - Intronic
1132616184 16:842149-842171 GCTGCCGCAGGAGGCTGAGGGGG + Intergenic
1132698402 16:1212065-1212087 GCAGCACCAGGAGGCGGAGGAGG + Exonic
1132700081 16:1218602-1218624 CCCGCTGCAGGAGGTGGAGATGG + Exonic
1132787399 16:1665289-1665311 TGGGCTGCAGGCTGCGGTGGCGG + Intronic
1133619762 16:7514912-7514934 TCTTCTGCTGGAGGTGGAGGAGG + Intronic
1134624667 16:15715021-15715043 GCAGCTGGAGGAGGCAGAGGAGG - Exonic
1136396483 16:29995302-29995324 TGGGCCGCGGGAGGCGGAGGCGG - Exonic
1136788239 16:32947922-32947944 TGGGATGCAGGAGGTGGAGTGGG - Intergenic
1137594583 16:49715271-49715293 GCTGCTGCAGGAGACGGGGGAGG + Intronic
1137617274 16:49855533-49855555 CCGGGAGCAGGAGGCGGAGGCGG - Intronic
1138071300 16:53995685-53995707 TGGGGTGAAGGAGGCGGAGTAGG - Intronic
1138210330 16:55157811-55157833 GGGGCTGCAGGAGGCGGGGTGGG - Intergenic
1138239004 16:55411440-55411462 TCCCCTGCAGGAGAGGGAGGAGG - Intronic
1138328083 16:56191795-56191817 GCGGCTGCCGGAGGAGGAGGAGG - Intronic
1138420022 16:56892934-56892956 TCCACTGCAGGAGGTGGGGGCGG - Exonic
1138514546 16:57528931-57528953 GCGGCTGCGGGAGCTGGAGGAGG - Exonic
1138969581 16:62128713-62128735 TCAGCAGGAGGAGGAGGAGGAGG - Intergenic
1139260386 16:65587588-65587610 TCGTCTGTGGGAGGCTGAGGTGG - Intergenic
1139470726 16:67176831-67176853 CCGGCTGGATGAGGCGGAGCTGG - Exonic
1140187606 16:72788626-72788648 TGGGCTGCTGGCGGCGGGGGAGG + Exonic
1140252708 16:73308388-73308410 ACTGAGGCAGGAGGCGGAGGTGG - Intergenic
1140272319 16:73478183-73478205 TTGAATCCAGGAGGCGGAGGTGG + Intergenic
1140442620 16:74999256-74999278 CCCGCGGGAGGAGGCGGAGGAGG - Exonic
1140874398 16:79137681-79137703 TCGGGGGAAGGAGACGGAGGAGG - Intronic
1141149825 16:81556262-81556284 TCTGCTGCAGAAGGAGGTGGCGG + Intronic
1141165470 16:81657847-81657869 TAGGCTCCAGGAGGCGGAGGTGG - Intronic
1141327957 16:83080436-83080458 GCAGATGCAGGAGGAGGAGGAGG - Intronic
1141683025 16:85555109-85555131 GCGGCTGAAGGCGGCGGCGGCGG - Intergenic
1141745931 16:85926257-85926279 TCGGCTACAGGTGGCGGAACTGG - Intergenic
1142125968 16:88410900-88410922 GGGGCTGGAGGAGGAGGAGGTGG - Intergenic
1142194692 16:88733975-88733997 GCAGCAGCAGGAGGAGGAGGAGG - Exonic
1142240180 16:88941380-88941402 CGGGGGGCAGGAGGCGGAGGCGG - Intronic
1142256311 16:89015379-89015401 TCGGCAGGAGGACGAGGAGGGGG + Intergenic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1142810236 17:2392765-2392787 TTGGCTGCAGCGGGCGGGGGCGG - Intronic
1143340732 17:6208776-6208798 TCTGGTGGAGGAGGAGGAGGAGG + Intergenic
1143572712 17:7770438-7770460 TGTGCTCCAGGAGGCGCAGGAGG - Intronic
1143670495 17:8392892-8392914 TCGGCAGCAGAAGGCGCGGGCGG + Exonic
1143781591 17:9232169-9232191 TCGGAGGCAGGAGAAGGAGGCGG + Intronic
1144701182 17:17341673-17341695 TGGGCTCCAGGAGGCTCAGGGGG + Intronic
1144720626 17:17467208-17467230 TCTTCTGCAGGAGGCTGAGCTGG + Intergenic
1144840822 17:18184465-18184487 GCAGCTGCAGAAGGAGGAGGAGG + Exonic
1145403705 17:22568680-22568702 CAGGCTGCAGGAGGAGAAGGAGG - Intergenic
1145721637 17:27078500-27078522 TGGGGTGCAGGAGGGAGAGGAGG - Intergenic
1145996885 17:29109994-29110016 TCGGCGGGAGGAGGCGGAACGGG + Exonic
1146283349 17:31559187-31559209 TCGGCTCCGGGAGGCGGTGCGGG + Intergenic
1146356950 17:32142511-32142533 TGGGCCGGAGGAGGCGGAGCTGG + Exonic
1146660744 17:34663713-34663735 TGGGCTGCAGCAGGGGGAGGTGG - Intergenic
1146764928 17:35511634-35511656 TCAGGAGCAGGAGGCTGAGGTGG + Intronic
1146943455 17:36859388-36859410 GAGGCTGCAGGTGGGGGAGGCGG - Intergenic
1147000975 17:37361783-37361805 ACGTCTGTAAGAGGCGGAGGAGG + Intronic
1147042095 17:37727105-37727127 TTGGCTCGAGGAGGAGGAGGAGG - Intronic
1147162068 17:38574119-38574141 TCAGCTGTAGGAGGCGGAGGAGG - Intronic
1147612695 17:41811257-41811279 CCGGCTGGAGAAGGCGGTGGCGG - Exonic
1147987642 17:44315523-44315545 TCAGCTGCAGCTGGAGGAGGCGG + Exonic
1148114860 17:45169614-45169636 GCGGCTGTCGCAGGCGGAGGAGG + Exonic
1148431949 17:47650014-47650036 TGGGCTGCTGGCGGCGGGGGAGG - Exonic
1148646086 17:49220251-49220273 ACGGCTGCTGGTGGAGGAGGTGG - Exonic
1149905840 17:60525952-60525974 TCGGGAGGAGGAGGCGGAGGAGG - Exonic
1151225456 17:72644715-72644737 ACCGCTGGAGGAGGAGGAGGAGG - Intergenic
1151383817 17:73743183-73743205 AGGGCGGGAGGAGGCGGAGGTGG - Intergenic
1151757190 17:76081726-76081748 TGGGTTGCAGGAGGAGGAGCTGG - Exonic
1151761784 17:76108259-76108281 CCAGCTACAGGAGGCTGAGGTGG - Intronic
1152072884 17:78142764-78142786 TCTGATTCAGGAGGCTGAGGTGG - Exonic
1152103179 17:78314468-78314490 TCGGCTGGAGGAGGTGCTGGGGG + Intergenic
1152175245 17:78782562-78782584 TCGGCCCCAGGAGGCGGACCGGG - Intergenic
1152320997 17:79608863-79608885 TCGCCCGCAGGAGGCGGAGAAGG + Intergenic
1152570773 17:81120446-81120468 CCGGCCGGAGGAGGAGGAGGAGG - Exonic
1154475274 18:14748662-14748684 GGGGCTGCAGGAGGAGGAGGCGG + Intronic
1154529458 18:15330022-15330044 GGGGCTGCAGGAGGAGGAGGAGG - Intergenic
1155257876 18:24014499-24014521 GGGGCTGCAGGAAGTGGAGGCGG + Intronic
1156008514 18:32470687-32470709 GCGGCTGCGGGCGGCGGCGGCGG + Intergenic
1156179766 18:34589359-34589381 TCCACTTCAGGAGGCCGAGGCGG + Intronic
1156205699 18:34883422-34883444 CCAGCTACAGGAGGCTGAGGTGG - Intronic
1156460360 18:37318277-37318299 TAAGCGGCAGGAGGAGGAGGGGG - Intronic
1156491748 18:37500435-37500457 TCAGCTGCAGGAGTCGGAAGAGG - Intronic
1156752540 18:40476745-40476767 CCAGCTACAGGAGGCTGAGGTGG - Intergenic
1158505607 18:58044196-58044218 CCGGTGGGAGGAGGCGGAGGAGG + Intergenic
1159082090 18:63746302-63746324 TCAGTTGTAGGAGGGGGAGGAGG + Intergenic
1159812069 18:73027614-73027636 GCGGAAGCAGGAGGTGGAGGTGG - Intergenic
1160024736 18:75208547-75208569 TCGGGAGCGGGAGGGGGAGGAGG + Intronic
1160167960 18:76530422-76530444 TCAAGAGCAGGAGGCGGAGGTGG + Intergenic
1160189942 18:76707635-76707657 CAGGCTGGAGGAGGAGGAGGAGG + Intergenic
1160432284 18:78819922-78819944 CCCTCTGCAGGAGGGGGAGGAGG + Intergenic
1160497119 18:79382235-79382257 TCAGCTGCAGGTGGGAGAGGAGG - Intergenic
1160770784 19:829839-829861 TGTGCTTCAGGAGGCCGAGGCGG + Intronic
1160826864 19:1084312-1084334 CCCGCTGCAGGAGGCGGCGGCGG + Exonic
1160975117 19:1789293-1789315 GCGGCTGACGGAGGCGGTGGTGG - Intronic
1160991912 19:1863574-1863596 TCGAGTGCGGGAGGCGGAGGAGG + Intergenic
1161055905 19:2190547-2190569 CCAGCTGCAGCAGGCTGAGGTGG - Intronic
1161107464 19:2451757-2451779 TCGGCTGGAGGAGGCCACGGTGG + Intronic
1161428559 19:4217623-4217645 CCGGCTGCTGGCGGAGGAGGAGG + Exonic
1161469073 19:4447478-4447500 TGGCCTGCAGGAGCCGGTGGTGG - Intronic
1161477340 19:4493963-4493985 TCCGCTACAGGAAGAGGAGGAGG - Exonic
1161630129 19:5350060-5350082 AGGGCTCCAGGAGGCTGAGGAGG - Intergenic
1161729626 19:5951424-5951446 TGGGCTTCAGGAGCGGGAGGCGG + Exonic
1161768311 19:6218621-6218643 ACAGCTGCAGGAGGAGGAGGCGG - Intronic
1161772455 19:6238476-6238498 GCGGCTGTGGGAGCCGGAGGTGG + Intronic
1162516160 19:11149122-11149144 TGGGCTTCAGGAGGCTGGGGAGG - Exonic
1162849080 19:13416732-13416754 TTGAATCCAGGAGGCGGAGGTGG + Intronic
1162954278 19:14089895-14089917 GGGGCTGCTGGAGGAGGAGGCGG - Exonic
1163115470 19:15186483-15186505 TTGACCTCAGGAGGCGGAGGCGG - Intronic
1163696851 19:18768578-18768600 GCGGGTGGAGGAGGCGGCGGGGG - Exonic
1164594852 19:29526127-29526149 GCGGCTGCGGGAGCCGAAGGAGG + Intergenic
1164769889 19:30800397-30800419 TCGGCTGAAGGAGGTGGAAGGGG - Intergenic
1165106174 19:33470839-33470861 TGGGCTGCTGGAGCCTGAGGAGG - Intronic
1165242939 19:34481921-34481943 GCGGCGGCGGGAAGCGGAGGCGG + Exonic
1165300322 19:34964252-34964274 AGGGCTGCAGGCGGCGGCGGTGG - Intergenic
1165468119 19:35987118-35987140 TCGGATGGGGGAGGCGGAGATGG - Intergenic
1165797834 19:38528956-38528978 TGGGGAGCAGGAGGAGGAGGAGG + Exonic
1165850899 19:38849839-38849861 GCGGCGGCGGGCGGCGGAGGCGG - Exonic
1166073009 19:40397613-40397635 GCGGCTGCCAGGGGCGGAGGTGG - Exonic
1166091564 19:40512733-40512755 GCTGCTGCAGGAGCTGGAGGAGG + Exonic
1166205131 19:41264596-41264618 GCGGCTGCAGGCGGCGTTGGAGG + Exonic
1166601019 19:44094673-44094695 TGGGGTGCAGGGGGCGGAGTGGG - Intronic
1166999307 19:46736616-46736638 CCCGCTGCAGGAGGCAGACGTGG - Intronic
1167001163 19:46746377-46746399 ACGGCAGGAGGAGGCGGCGGCGG + Exonic
1167019071 19:46861018-46861040 GCGGCGGCAGGAGGAGGTGGAGG + Intergenic
1167019072 19:46861021-46861043 GCGGCAGGAGGAGGTGGAGGAGG + Intergenic
1167097001 19:47379895-47379917 GCAGCTGGAGGAGGAGGAGGAGG + Exonic
1167235992 19:48315645-48315667 TCGACTGCAGGAAGAGGATGAGG - Intronic
1167323516 19:48810847-48810869 TCCGCTGCAGGGCGCGGAGGAGG - Intronic
1167384984 19:49157834-49157856 TGGGCTGCAGGAGGTTGCGGCGG + Exonic
1167573993 19:50309043-50309065 GCAGCTGGAGGAGGCCGAGGAGG + Exonic
1167589944 19:50398995-50399017 CAGGCTGCAGGAGCAGGAGGAGG + Exonic
1167786979 19:51645073-51645095 TCGGTGGCAGGAGGGGGAAGTGG + Intronic
1167906883 19:52668541-52668563 GCAGCTGTAGGAGGTGGAGGAGG - Intronic
1168063871 19:53908693-53908715 ACGGCTGCAGGAAGCGGGAGGGG - Intergenic
1168294031 19:55370146-55370168 TCGGAGACAGGAGGCGGCGGAGG - Intronic
1168645403 19:58056162-58056184 TTGGCTGCAGGATGGGGATGGGG - Intergenic
925329333 2:3046580-3046602 GCGGCTGCAGGATGAGGAGCTGG - Intergenic
925642522 2:5999543-5999565 TCTGCTGGAGGAGGCTGAGCTGG - Intergenic
925730831 2:6918281-6918303 TCGGCGGCCGGAGGCTGGGGTGG - Intronic
925984527 2:9205941-9205963 GGGGGTGCAGGAGGAGGAGGAGG - Intergenic
926035176 2:9630696-9630718 GCGGCTGGAGGAGGCGGGGGCGG + Intronic
926055842 2:9773478-9773500 GCGGGTGCAGGAGCTGGAGGGGG - Intergenic
926090028 2:10043626-10043648 TGGGCTGCGGGCGGCGGCGGCGG - Exonic
926596185 2:14791721-14791743 TTGAATCCAGGAGGCGGAGGTGG + Intergenic
928206910 2:29290929-29290951 TCTGCAGCAGGAGGTGGTGGTGG + Intronic
928683772 2:33727874-33727896 CCAGCTGCAGCAGGCGGAGGAGG + Intergenic
930052524 2:47227813-47227835 ATGGCTGCAGAAGGAGGAGGGGG - Intergenic
930322020 2:49867363-49867385 TTGGCTGCTGAAGGTGGAGGTGG + Intergenic
931395965 2:61888629-61888651 GCGTCGGGAGGAGGCGGAGGCGG + Exonic
931671713 2:64653815-64653837 GCGGCGGCAGGCAGCGGAGGAGG + Exonic
931681326 2:64751600-64751622 CCGGCAGGAGGAGGCGGCGGCGG + Intergenic
932607619 2:73175631-73175653 TGGGCTGCAGCCGGCGGAAGGGG + Intergenic
932629537 2:73327440-73327462 CCAGCTACAGGAGGCTGAGGTGG - Intergenic
933302643 2:80559827-80559849 GTTGCTGCAGGAGGCTGAGGAGG + Intronic
933666773 2:84971023-84971045 GCGGCGGAAGGAGGCGGAGGAGG + Intergenic
933772777 2:85754565-85754587 TGGGGCGCAGGAGGCGGCGGCGG - Exonic
934069836 2:88373741-88373763 GAGGCTGAAGGAGGCTGAGGCGG + Intergenic
934993563 2:98937335-98937357 TCGGCTGTCGGAGGCCGAGAGGG + Intergenic
935070022 2:99685939-99685961 TAGGCTGTGGGAGGCGGAGGCGG + Intronic
935463060 2:103361904-103361926 GAGGCGGGAGGAGGCGGAGGCGG - Intergenic
935463066 2:103361920-103361942 GAGGCGGGAGGAGGCGGAGGCGG - Intergenic
935639895 2:105280648-105280670 CCGGGTGAAGGAGGAGGAGGTGG + Exonic
936408519 2:112232060-112232082 ATGCCTGTAGGAGGCGGAGGTGG + Intronic
936948361 2:117951875-117951897 AGGGCTGCAGGAGGAGAAGGAGG - Intronic
937119464 2:119431789-119431811 GCGGCTGCTGGAGGCGGGCGGGG - Intronic
937543702 2:122989346-122989368 GGGGCTGGAGGAGGCTGAGGGGG + Intergenic
938528556 2:132161444-132161466 GGGGCTGCAGGAGGAGGAGGAGG - Intronic
940945699 2:159615622-159615644 AGGGCAGCAGGAGGCGGACGGGG + Intronic
941819185 2:169827730-169827752 GCGGCGGCCGGAGGCGGGGGCGG + Exonic
943342185 2:186694344-186694366 GCAGCTGGAGGAGGCTGAGGAGG + Exonic
943890269 2:193277300-193277322 GCGGCAGCACCAGGCGGAGGGGG - Intergenic
944221809 2:197310746-197310768 TCGGCGGGAGGAGGCGGCGGCGG - Exonic
944573783 2:201071638-201071660 GCTGCTGCGGGAGGCGGCGGCGG - Exonic
944703995 2:202270650-202270672 GCTGCTGCAGGAGGCTGAGGTGG + Intronic
944819623 2:203416967-203416989 TCTTCTGGAGGAGGAGGAGGTGG - Exonic
945251459 2:207769112-207769134 TTGGTTACAGGAGGCGGAGCGGG - Intronic
946144324 2:217717665-217717687 TGGGCTGATGGAGGGGGAGGTGG - Intronic
946182964 2:217959994-217960016 CCGGCAGGAGGAGGAGGAGGAGG + Intronic
946295728 2:218782193-218782215 TGGGCTGCGCGAGGCTGAGGTGG + Exonic
947655269 2:231821313-231821335 TTGAATCCAGGAGGCGGAGGTGG - Intergenic
948329883 2:237156455-237156477 GCGGCTGCAGGTAGGGGAGGAGG + Intergenic
948661722 2:239511195-239511217 TAGGCTGCAGGACAGGGAGGGGG - Intergenic
948824741 2:240568703-240568725 CCAGCTGCAGGTGGCGGAGGCGG - Exonic
948903738 2:240968253-240968275 GCGGCTGCAGGTGGGGCAGGCGG + Intronic
1169661433 20:7982562-7982584 ACAGTTGCAGGATGCGGAGGAGG - Exonic
1171199672 20:23231175-23231197 TCGGATGCAGGGAGCGCAGGTGG - Intergenic
1171240184 20:23561233-23561255 TTGAATGCAGGAGGCAGAGGTGG - Intergenic
1171487418 20:25494677-25494699 GCGGCTGCAGGAGGTGCAGCGGG + Intronic
1172446345 20:34995428-34995450 GCGGCTGGAGGATGAGGAGGAGG + Exonic
1172447119 20:34999071-34999093 GCGGCTGCAGGAGGCAGAGGAGG + Exonic
1172507963 20:35478005-35478027 TCAGCTGCAGAAAGCTGAGGAGG + Exonic
1173916971 20:46714917-46714939 TGGGGTGCAGGAGGCAGAGGTGG - Intronic
1174287759 20:49484179-49484201 GCGGGAGCAGGAGGAGGAGGAGG - Intergenic
1174346390 20:49933206-49933228 TCAGCAGGAGGAGGCTGAGGCGG - Intergenic
1174482000 20:50837842-50837864 TCGGCTGGAGGAAGGGGAGTCGG + Intronic
1174804671 20:53594431-53594453 TCGGCGGCGGGGGGCGGAGCAGG - Intronic
1175125093 20:56745460-56745482 TGGGCTGGAGAAGGAGGAGGTGG - Intergenic
1175818592 20:61896409-61896431 GCAGCTGCACCAGGCGGAGGTGG + Intronic
1176032968 20:63022633-63022655 GCGGCTGCAGGGGGTGGGGGAGG + Intergenic
1176051986 20:63124735-63124757 TGGGGGGCAGGAGGCAGAGGAGG + Intergenic
1176062746 20:63179375-63179397 GCGGCTGCAGATGGCGGCGGGGG - Intergenic
1176064473 20:63187547-63187569 TGGGGTGCAGGAGGTGGGGGTGG - Intergenic
1176206555 20:63891775-63891797 TGAGCCCCAGGAGGCGGAGGAGG + Intergenic
1176767940 21:13038446-13038468 GGGGCTGCAGGAGGAGGAGGAGG + Intergenic
1176853263 21:13937485-13937507 TGGGCTGGAGGAAGCGGAGCTGG - Intergenic
1178453704 21:32727963-32727985 GCGGCTGCGGGAGAAGGAGGAGG - Exonic
1178627057 21:34227148-34227170 TCGGAGGCAGGAGGGAGAGGGGG + Intergenic
1179290376 21:40013199-40013221 TCTCGTGGAGGAGGCGGAGGAGG + Exonic
1179727018 21:43346474-43346496 TCTTCTGCAGGAGGAGGGGGTGG - Intergenic
1179880928 21:44293089-44293111 GGGGCTGCAGAAGGCGGAGCCGG - Exonic
1179953821 21:44727033-44727055 TCAGCTGCAGGAGCAGGAGCAGG - Intergenic
1180144496 21:45911733-45911755 TGGGCTGCAGGAGGGGCTGGAGG - Intronic
1180432502 22:15264728-15264750 GGGGCTGCAGGAGGAGGAGGCGG + Intergenic
1180515074 22:16132708-16132730 GGGGCTGCAGGAGGAGGAGGCGG + Intergenic
1180619255 22:17149184-17149206 AGGGCTGCAGGTGGCTGAGGAGG + Intronic
1180858893 22:19065576-19065598 TCGGCTGTGGGAGGCAGGGGCGG - Intronic
1180926578 22:19559365-19559387 TGAGCTGCAGGAGGAGGAGCTGG - Intergenic
1180946152 22:19694775-19694797 CCAGCTTCAGGAGGCTGAGGTGG - Intergenic
1180951728 22:19723521-19723543 TCTGCAGCGGGAGGCGTAGGCGG - Exonic
1182153254 22:28045881-28045903 TTGAATGCAGGAGGCGGAGCTGG + Intronic
1182294357 22:29304522-29304544 AGGGCTGCTGGAGGTGGAGGAGG - Intergenic
1182486802 22:30643946-30643968 TGGGCTGCAGGGAGGGGAGGTGG + Intronic
1182505924 22:30782306-30782328 TTGTCTGCAGGAGGTGGAAGGGG - Intronic
1182799636 22:33021161-33021183 TGAGCTGCAAGAGGCAGAGGTGG - Intronic
1182834344 22:33329619-33329641 AAGGCTGGAGGAGGTGGAGGGGG - Intronic
1183186286 22:36293373-36293395 GCAGCTGGAGGAGGAGGAGGAGG - Exonic
1183301412 22:37060849-37060871 GCAGCAGCAGGAGGAGGAGGTGG + Exonic
1184068304 22:42132728-42132750 GTGGCTGCAGAAGGCGGATGTGG + Intergenic
1184241662 22:43214270-43214292 GAGGCTGCTGGAGGCAGAGGTGG + Intronic
1184340720 22:43884436-43884458 TCATCTGCAGAAGGTGGAGGGGG - Intronic
1184693908 22:46129484-46129506 CTTGCTGCAGGAGGAGGAGGAGG + Intergenic
1184805631 22:46793292-46793314 TCAGTGGCAGGAGGGGGAGGGGG - Intronic
1185064306 22:48623089-48623111 TGGGCTGCAGGGGGTGGCGGCGG + Intronic
1185325105 22:50221700-50221722 GGGGCTGCAGCAGGCGGAGGGGG - Exonic
949514700 3:4796460-4796482 TCAGCTGGCGGCGGCGGAGGAGG + Intronic
951709252 3:25572805-25572827 CCACCTGGAGGAGGCGGAGGGGG - Intronic
952240987 3:31531944-31531966 GCGGCCGCAGAAGCCGGAGGCGG + Intergenic
952970852 3:38649464-38649486 TGGGCGGCGGCAGGCGGAGGGGG + Intronic
953026316 3:39147302-39147324 TGTGCTGGAGGAGGAGGAGGAGG - Intronic
953920885 3:46950422-46950444 TCCTATGCAGGAGGCTGAGGTGG - Intronic
954526001 3:51271768-51271790 TCGAACCCAGGAGGCGGAGGTGG + Intronic
954714468 3:52520259-52520281 TCGGCTGCAGGAGAAAGAGATGG - Exonic
955383837 3:58462958-58462980 TGGGCTGGAGGAGGCCTAGGCGG - Intergenic
955818748 3:62874690-62874712 GCGGCTGCAGAAAGAGGAGGAGG - Exonic
956118448 3:65941902-65941924 CCAGCTTCAGGAGGCTGAGGTGG - Intronic
956133475 3:66076030-66076052 TGGGTTACAGCAGGCGGAGGTGG - Intergenic
956162624 3:66371305-66371327 TCGGCATCAGGATGAGGAGGTGG - Intronic
957078721 3:75619951-75619973 TCGCCTGCAGGAGGCGGTCCAGG - Intergenic
959026710 3:101247942-101247964 TCTCCTGGAGGAGGGGGAGGAGG - Intronic
960101219 3:113745781-113745803 TCGGCTCCCGGAGGGGGCGGAGG - Intronic
961078362 3:124002990-124003012 TCTGCTGAAGGAGGTGGGGGCGG - Intergenic
961508014 3:127384222-127384244 TCTGGAGCAGGAGGAGGAGGTGG + Intergenic
961785407 3:129344160-129344182 TCTGCTGCAGGTGGGGGTGGGGG + Intergenic
962002582 3:131314234-131314256 TCGACAGCAGGAGCTGGAGGTGG + Intronic
963063257 3:141241848-141241870 TCTGCTGCTGGAGGCTGAGTAGG + Intronic
967877296 3:194275957-194275979 TCGGCTACAGGGAGAGGAGGAGG + Intergenic
968319186 3:197750285-197750307 TCGGCCGCGGCAGTCGGAGGAGG + Intronic
968903591 4:3442058-3442080 GCAGCAGCAGGAGGAGGAGGAGG - Exonic
969021798 4:4143919-4143941 TCGCCTGCAGGAGGCGGTCCAGG - Intergenic
969271423 4:6105928-6105950 GCGGCTGCAGGAGGCGAAGCTGG - Exonic
969479937 4:7442076-7442098 TGGGCTGAAGGAGGGGGTGGAGG - Intronic
969479992 4:7442221-7442243 TGGGCTGAAGGAGGGGGTGGAGG - Intronic
969613702 4:8240532-8240554 TCAGCTGCAGGAGGTGGAGACGG - Intronic
969644531 4:8419798-8419820 TGGGGTGCAGGAGGCGAAGCTGG - Intronic
969657948 4:8508867-8508889 TAGGCGGCGGGAGGAGGAGGAGG - Intergenic
969696517 4:8738142-8738164 TCTGCTGCAGGTGGGGTAGGGGG - Intergenic
969713558 4:8857950-8857972 TCGGGGAGAGGAGGCGGAGGAGG + Intronic
969732070 4:8963496-8963518 TCGCCTGCAGGAGGCGGTCCAGG + Intergenic
969791663 4:9497581-9497603 TCGCCTGCAGGAGGCGGTCCAGG + Intergenic
970296754 4:14638999-14639021 TCAGCTACAGGAGGCAGGGGTGG + Intergenic
970332852 4:15003119-15003141 GCAGCAGGAGGAGGCGGAGGAGG - Exonic
970708764 4:18837078-18837100 ACAGCAGCAGGAGGAGGAGGAGG - Intergenic
971654531 4:29326114-29326136 TGGGCTGGAGGAGGCGTTGGAGG - Intergenic
972426174 4:38935162-38935184 TCAGCTGTGGGAGGCCGAGGTGG - Intronic
975089929 4:70389786-70389808 TAGGGTGCGGGAGGAGGAGGTGG - Exonic
975226587 4:71879804-71879826 TTAGCTTCAGGAGGCCGAGGCGG + Intergenic
975539149 4:75486722-75486744 TCAGCTTCAGGAGGCCAAGGAGG + Intronic
976207600 4:82637680-82637702 TAGGCTGCGGGAGGCCAAGGAGG - Intronic
977255408 4:94735032-94735054 TTGAATCCAGGAGGCGGAGGAGG - Intergenic
977937877 4:102827254-102827276 TCTCCTGCTGGAGGAGGAGGGGG - Intronic
978233009 4:106423702-106423724 TCAGCCTCAGGAGGCTGAGGTGG + Intergenic
979475876 4:121157090-121157112 CCGGCTGCAGCGGGAGGAGGTGG - Exonic
980130559 4:128812295-128812317 TCGGGAGGAGGAGGAGGAGGAGG + Intronic
980930224 4:139177278-139177300 GAGGCGGCAGGAGGCCGAGGGGG - Intergenic
980943346 4:139295643-139295665 ACGGGTGCAGGAGGCGGCAGCGG - Intronic
981550596 4:145937725-145937747 GCGGCTGGAGCAGGAGGAGGCGG - Intronic
982745765 4:159103257-159103279 TCGTCTGCGCGGGGCGGAGGAGG - Intergenic
983936838 4:173508313-173508335 GCTTCTGCAGGAGGTGGAGGTGG + Intergenic
984778673 4:183505150-183505172 GCGGCTGCTGGATGCGGAGGCGG + Exonic
985393361 4:189514917-189514939 CCTGCTGCAGGAGGGGGGGGGGG - Intergenic
985472253 5:53540-53562 TCGGCGGCGGGAGGAGGGGGCGG + Intergenic
985531915 5:438825-438847 TGGGCTGCAGGGTGCGAAGGAGG - Intergenic
985781030 5:1872005-1872027 GCAGCTGCAGCAGGCAGAGGCGG - Intergenic
985984781 5:3505598-3505620 TCGGCTGAAGCAGGCTGAGCTGG + Intergenic
986325972 5:6674760-6674782 TTGGCTGCAGGAAGCTCAGGTGG + Intergenic
987050796 5:14144884-14144906 GCAGCAGCAGGAGGAGGAGGAGG + Intronic
987358909 5:17088989-17089011 TCAGCCTCAGGAGGCTGAGGTGG - Intronic
992529177 5:77638851-77638873 CCGCCTGAAGGAGGCGGCGGCGG + Exonic
995759344 5:115546786-115546808 TGGCATGCAGGAGGCTGAGGTGG + Intergenic
996044465 5:118854941-118854963 TCAGCAGCAGGAGGCCGAGGTGG + Intronic
996759156 5:126969776-126969798 TCTGCTACAGGAGGCTGGGGTGG + Intronic
997013371 5:129904514-129904536 GGAGCTGCAGGAGGAGGAGGAGG - Exonic
997141417 5:131385049-131385071 TCAGCTGGAGGGGGTGGAGGTGG - Intronic
997694689 5:135851865-135851887 CAGGCTGCAGGAGGCTGAGGAGG - Intronic
997980930 5:138466991-138467013 TGGGCTCTGGGAGGCGGAGGCGG - Exonic
998157655 5:139795764-139795786 TGAGCTGGAGGAGGAGGAGGAGG - Intergenic
998200418 5:140114075-140114097 GCGGCGGCAGCAGGCGGAGCCGG + Intronic
998263319 5:140647669-140647691 TAGGCTGCATGAGGCAGGGGCGG + Exonic
998771630 5:145552309-145552331 TAGGCTGCAGGGGGAGAAGGTGG - Intronic
999720218 5:154394025-154394047 TCTGCTCCAAGAGGCAGAGGTGG + Intronic
1001556556 5:172641218-172641240 GCGCCTGCGGGAGGAGGAGGCGG - Intergenic
1001819936 5:174702566-174702588 CCAGCTACAGGAGGCTGAGGTGG - Intergenic
1002051853 5:176575797-176575819 GCAGCTGCTGGAGGCGGATGAGG + Exonic
1002204709 5:177554444-177554466 GCGGCGGCATGACGCGGAGGCGG - Exonic
1003426885 6:6003582-6003604 GCGGCGGGAGGAGGAGGAGGAGG + Intronic
1003577604 6:7312702-7312724 TCGGCTGCAGGAGGAGGCGCTGG - Intronic
1003892618 6:10576963-10576985 TCAGCTACAGGAGGCTGAAGTGG + Intronic
1004420518 6:15465336-15465358 CCAGCTACAGGAGGCTGAGGTGG + Intronic
1006160677 6:32039075-32039097 TTGTCTGCAGGAGGAGGTGGGGG - Exonic
1006333981 6:33411010-33411032 GCAGCGGCAGGAGGAGGAGGCGG - Exonic
1006614688 6:35318381-35318403 GCGGCTGCTGCAGGAGGAGGAGG + Exonic
1006793311 6:36717366-36717388 CCGCCTGCAGGAGGCCCAGGCGG + Exonic
1007582222 6:42966396-42966418 TGGGCTGCAGGAGGTGAAGAAGG - Exonic
1007844336 6:44741193-44741215 TCTGCTGCAAGAGGGGCAGGTGG - Intergenic
1007902216 6:45422738-45422760 GCAGCAGCAGGAGGCGGCGGCGG + Exonic
1008092776 6:47309464-47309486 GCGGCTGCAGGAGGCGAGGGCGG + Exonic
1010196725 6:73247433-73247455 ACAGCTGCAGGAGGAAGAGGTGG - Intronic
1012623733 6:101380485-101380507 TAGGCTGCAGGAGGGGCAGAAGG - Intergenic
1012930241 6:105309071-105309093 GCGGCTGCAGCAGGCGGGTGAGG + Intronic
1013693961 6:112678224-112678246 TTGAATCCAGGAGGCGGAGGTGG + Intergenic
1014098265 6:117482871-117482893 CCGGCTGCAGGCGGAGGAGCTGG + Exonic
1015024919 6:128520700-128520722 TCTCCGGCAGGAGGCGGTGGCGG - Intergenic
1016731353 6:147431676-147431698 GAGGCTGCAGGAAGCGGAAGAGG - Intergenic
1017164117 6:151391386-151391408 CCGGCCCCGGGAGGCGGAGGCGG + Intronic
1017164208 6:151391741-151391763 AGAGCAGCAGGAGGCGGAGGCGG - Intergenic
1017174911 6:151493954-151493976 CCGGCCGCAGGAGGCCGGGGTGG - Intergenic
1017672317 6:156778971-156778993 GCAGCAGCAGGAGGCGGCGGCGG + Exonic
1018106443 6:160491896-160491918 TTGGCTGCTGAGGGCGGAGGTGG + Intergenic
1018268893 6:162055079-162055101 TTGAATGCAGGAGGCAGAGGTGG + Intronic
1018471354 6:164101152-164101174 TGGCCTGCAGGTGGAGGAGGGGG - Intergenic
1018471383 6:164101234-164101256 TGGCCTGCAGGTGGAGGAGGGGG - Intergenic
1018953642 6:168394072-168394094 GCGGCAGCAGGAGGGGCAGGGGG - Intergenic
1019254521 7:40791-40813 GCAGCTCCAGGAGGCGGGGGAGG - Intergenic
1019282215 7:206248-206270 GCAGCTGCAGGAGACGGTGGTGG - Intronic
1019466284 7:1191226-1191248 GCGGCTGCAGGAGGCGGCTCTGG - Intergenic
1019473237 7:1232269-1232291 CCGGCTGCAGGCGGCGGGAGAGG - Intergenic
1019658102 7:2208766-2208788 TCGGGCACAGGAGGGGGAGGAGG - Intronic
1019828330 7:3301608-3301630 TCGGCGGCCGGTGGCGGCGGCGG + Exonic
1020081407 7:5287909-5287931 CCAGCTGGAGGAGGCGGCGGAGG + Exonic
1020309219 7:6855949-6855971 TCGCCTGCAGGAGGCGGTCCAGG - Intergenic
1021827923 7:24573289-24573311 GCGGCGGCTGGAGGAGGAGGAGG + Intronic
1021827924 7:24573292-24573314 GCGGCTGGAGGAGGAGGAGGAGG + Intronic
1021868323 7:24980016-24980038 CCGGCCGCAGGAGTCGGGGGCGG + Exonic
1022424092 7:30251554-30251576 TCAGCAGGAGGAGGAGGAGGAGG - Intergenic
1023382603 7:39623655-39623677 GCGGCTGGAGGAGGAGGAGGAGG - Exonic
1023382604 7:39623658-39623680 TGGGCGGCTGGAGGAGGAGGAGG - Exonic
1023760815 7:43463736-43463758 CCAGCAGGAGGAGGCGGAGGTGG + Exonic
1024048671 7:45602353-45602375 CAGGCTGCAGGCAGCGGAGGAGG - Intronic
1024471715 7:49773606-49773628 GCGGCTGCGGCAGGGGGAGGCGG + Intergenic
1024613228 7:51084905-51084927 ACGGCTGCAGGAGCCGGGAGAGG - Intronic
1024660557 7:51489145-51489167 TGGGCTGCAGGAGGAAGAGCTGG + Intergenic
1025069705 7:55887689-55887711 GCGCCGGGAGGAGGCGGAGGCGG + Intronic
1025069711 7:55887702-55887724 GCGGAGGCGGGAGGCGGAGGCGG + Intronic
1025197506 7:56944239-56944261 CCAGCTGGAGGAGGCGGCGGAGG - Intergenic
1025674441 7:63632700-63632722 CCAGCTGGAGGAGGCGGCGGAGG + Intergenic
1025970031 7:66314398-66314420 CCAGCTGCAGGAGGCTGAGGTGG + Intronic
1026150013 7:67779972-67779994 CCAGCTACAGGAGGCTGAGGTGG + Intergenic
1026465385 7:70649317-70649339 TGGACCGCAGGAGGTGGAGGTGG + Intronic
1026472423 7:70705627-70705649 TGGGGTGGAGGAGGCGAAGGGGG - Intronic
1026794730 7:73359130-73359152 TGGGGTGCAGGAGGGTGAGGTGG - Intergenic
1027242935 7:76345024-76345046 TTGGCTGCAAGAGTGGGAGGAGG - Intronic
1028888133 7:95957442-95957464 GCAGCAGCAGGAGGAGGAGGAGG - Intronic
1029167227 7:98600926-98600948 TTGAATCCAGGAGGCGGAGGTGG + Intergenic
1029281581 7:99439030-99439052 AAGGCTGCAGGAGACCGAGGGGG + Intronic
1029312692 7:99682047-99682069 TTGGACCCAGGAGGCGGAGGTGG - Intergenic
1029424821 7:100488877-100488899 TTGGCAGCAGGAGGTGGAGGCGG - Exonic
1029443507 7:100600849-100600871 AGGGCTGAAGGAGGCGGGGGTGG + Exonic
1029537215 7:101163775-101163797 GGGGCTGCAGGAGGCGGCGGAGG - Exonic
1030068265 7:105677052-105677074 CTGGCTGCAGGAGGCAGAGCAGG + Intronic
1033099800 7:138460464-138460486 GCAGCCGCAGGAGGAGGAGGAGG + Exonic
1033300005 7:140177004-140177026 GCTGCTGCAGGAGGCGGCGCTGG - Exonic
1033300026 7:140177069-140177091 GCGGCTGGCGGAGGGGGAGGAGG + Intergenic
1034285650 7:149881611-149881633 GAGGCTGCAGGAGGCAGAGTTGG + Intergenic
1034348069 7:150399083-150399105 TTGGGGGCAGGAGGCCGAGGAGG - Intronic
1034436830 7:151066520-151066542 CCAGGTGGAGGAGGCGGAGGCGG + Exonic
1035019742 7:155793906-155793928 CAGGCTGCAGGAGGGGCAGGAGG + Intergenic
1035182286 7:157098047-157098069 TCCCATGCAGGAGGCTGAGGTGG - Intergenic
1035374808 7:158400997-158401019 TTGGCCACAGGAGGCGGAGCAGG - Intronic
1035733460 8:1869914-1869936 TGGGCCGCAGGAGGCAGAGCGGG + Intronic
1036763837 8:11533577-11533599 TCTGCCGGAGGAGGAGGAGGAGG + Intronic
1037529192 8:19757276-19757298 GCGGCTGCCGGAGCGGGAGGTGG - Intronic
1038187873 8:25292038-25292060 TCTGCTGCAGCTGGCGGAAGAGG - Exonic
1039445315 8:37626389-37626411 TGGTCTGCAGGAGGCAGTGGTGG + Intergenic
1039554956 8:38468690-38468712 GCAGCTGCAGGGGGCGGAGGCGG - Intronic
1039568061 8:38565132-38565154 CCGACTGCAGGAGTGGGAGGAGG - Intergenic
1039853997 8:41397070-41397092 TCGAACCCAGGAGGCGGAGGTGG + Intergenic
1039967393 8:42293260-42293282 TTGGCCGGAGGAGGAGGAGGAGG - Intronic
1041131966 8:54710718-54710740 GCGGCTGGATGAGGCAGAGGTGG - Intergenic
1042040115 8:64581025-64581047 CCGCCTGGAGGAGGCGGCGGCGG + Exonic
1042197305 8:66242237-66242259 GCTGAGGCAGGAGGCGGAGGTGG - Intergenic
1042202636 8:66294708-66294730 GCAGCAGCAGGAGGAGGAGGAGG - Intergenic
1042251904 8:66764581-66764603 CCAGCTACAGGAGGCTGAGGTGG - Intronic
1042871131 8:73400740-73400762 TCAGCTACAGGAGGCAGAGATGG - Intergenic
1042987957 8:74604450-74604472 TGGGGTGGAGGAGGAGGAGGAGG + Intronic
1043502765 8:80873733-80873755 GCGGGAGCAGGCGGCGGAGGGGG - Intronic
1045159013 8:99515414-99515436 GCAGCAGCAGGAGGAGGAGGAGG - Intronic
1045231378 8:100310098-100310120 GGGGCTGCGGGAGGGGGAGGTGG - Intronic
1045500106 8:102738417-102738439 TCGGGAGCGGGAGGGGGAGGTGG + Intergenic
1045638654 8:104223258-104223280 TCAGCGGCCGGAGGGGGAGGTGG - Intronic
1046659964 8:116938474-116938496 GCGCGTGCAGGAGGCGGCGGCGG + Exonic
1046770367 8:118111689-118111711 CCGGCTGGAGGCGGCGGCGGCGG + Exonic
1047754915 8:127911184-127911206 TAGGCTGCAAGTGGCAGAGGAGG - Intergenic
1049007399 8:139864079-139864101 CGGGCTGCAGGAGAGGGAGGGGG - Intronic
1049240466 8:141535214-141535236 TAGGCAGCACGAGGGGGAGGGGG + Intergenic
1049421357 8:142517982-142518004 TCGTCTGCAGGGGGCGGGTGGGG + Intronic
1049642915 8:143723439-143723461 AAGGTTGGAGGAGGCGGAGGAGG + Intergenic
1049681796 8:143922128-143922150 GCGGCAGCATGAGGCCGAGGAGG - Exonic
1049682119 8:143923991-143924013 GCGGCAGCTGGCGGCGGAGGAGG - Exonic
1049682316 8:143924975-143924997 GCGGCTGCAGGCGGAGGAGGTGG - Exonic
1049682373 8:143925284-143925306 GCGGCTGCAGGCGGAGGAGGCGG - Exonic
1049682454 8:143925701-143925723 GCGGCGGGAGGAGGCGGCGGTGG - Exonic
1049778020 8:144415377-144415399 GCTGCTGGAGGAGGCGGTGGGGG - Exonic
1049778023 8:144415380-144415402 TCAGCTGCTGGAGGAGGCGGTGG - Exonic
1049812723 8:144582677-144582699 CTGGCTGCAGGAGGAGGATGAGG + Intronic
1050305251 9:4299654-4299676 GCGGCGGCAGGGGGAGGAGGAGG + Exonic
1050879113 9:10676810-10676832 TCACCTGCAGGAAGCTGAGGAGG - Intergenic
1051170580 9:14315410-14315432 GGGGCTGCAGGAGGAGGAGGAGG - Intronic
1051787151 9:20757711-20757733 GCGGTAGCAGGAGGAGGAGGTGG + Intronic
1052491528 9:29175770-29175792 TCGGCTTTGGGAGGCTGAGGTGG - Intergenic
1053707174 9:40767784-40767806 GGGGCTGCAGGAGGAGGAGGCGG - Intergenic
1054417087 9:64888552-64888574 GGGGCTGCAGGAGGAGGAGGCGG - Intergenic
1055018817 9:71647364-71647386 TCCTCTGCAGGAGGAGGAAGTGG - Intergenic
1056357746 9:85819874-85819896 CCAGCTGCTGGAGGCTGAGGCGG + Intergenic
1056960590 9:91118801-91118823 TCGGCTGCAAGAGGTGGGGTGGG - Intergenic
1056990467 9:91405885-91405907 TCGGCGGCCGGGGGCGGGGGTGG - Intergenic
1057194714 9:93110609-93110631 TCCGCTGCAGGTGGCTCAGGAGG - Exonic
1057616627 9:96596744-96596766 CCAGCTACAGGAGGCTGAGGTGG + Intronic
1057881560 9:98796392-98796414 GCGGCTGCTGGAGCCGGGGGCGG - Exonic
1058160328 9:101563768-101563790 TTGGACCCAGGAGGCGGAGGTGG - Intergenic
1059438953 9:114292032-114292054 AAGGCAGGAGGAGGCGGAGGGGG - Intronic
1060081439 9:120650547-120650569 TTGGCTGCAGGAGCCAGATGTGG - Intronic
1060196009 9:121623766-121623788 TTGGACCCAGGAGGCGGAGGTGG - Intronic
1060200962 9:121651602-121651624 GAGGGGGCAGGAGGCGGAGGAGG + Intronic
1060793624 9:126501100-126501122 CCGGCTCCGGGAGGCTGAGGAGG - Intronic
1060811677 9:126614085-126614107 GCGGCGGCAGGCGGGGGAGGGGG - Intergenic
1061037950 9:128123887-128123909 TCGGCCACAGGGGACGGAGGGGG - Intronic
1061275617 9:129568312-129568334 CCGGCTGGAGGTGGCGGTGGGGG - Intergenic
1061517279 9:131097041-131097063 CCGGAGGCGGGAGGCGGAGGCGG - Intronic
1061561650 9:131408048-131408070 TCAGCTGCAGGAGGCGGATTAGG - Intronic
1061654479 9:132078615-132078637 TAGGATGGAGGAGGAGGAGGAGG - Intronic
1061680860 9:132241857-132241879 TTGGCTGCAGGCGGAGGGGGCGG - Exonic
1061865643 9:133490694-133490716 AAGGCTGCAGGAGGAGGATGGGG + Intergenic
1061883475 9:133579277-133579299 CTGGCTGAAGGAGGTGGAGGCGG + Exonic
1061961330 9:133990773-133990795 TCAGGTGCAGGTGGCGGGGGTGG - Intronic
1062200712 9:135301329-135301351 GCAGGTGCAGGAGGCGGTGGAGG - Intergenic
1062333102 9:136053111-136053133 CTGGCAGCAGGATGCGGAGGAGG + Intronic
1062460096 9:136659404-136659426 CGGGCTGCAGGAGGTGCAGGAGG - Exonic
1062473621 9:136717347-136717369 GGGGCTGCAGGGGCCGGAGGTGG - Intronic
1062574225 9:137199118-137199140 TCGGCCACGGGAGGCCGAGGAGG - Exonic
1062745878 9:138211762-138211784 GCAGCTCCAGGAGGCGGGGGAGG + Intergenic
1185550699 X:980898-980920 TGGGATGGAGGAGGAGGAGGAGG + Intergenic
1185550827 X:981303-981325 TAGGATGGAGGAGGAGGAGGAGG + Intergenic
1185550859 X:981404-981426 TGGGATGGAGGAGGAGGAGGAGG + Intergenic
1185783910 X:2873545-2873567 ACAGCAGCAGGAGGAGGAGGAGG - Intronic
1185872022 X:3672620-3672642 CCTGCTCCAGGAGGCGCAGGGGG + Intronic
1187200346 X:17128393-17128415 TAGGCTGCTGGAGGTGGGGGTGG + Intronic
1190296426 X:49030292-49030314 TCTGATGGAGGAGGAGGAGGGGG - Exonic
1190988640 X:55522869-55522891 TCCTCTGCAGGAGTCAGAGGTGG - Intergenic
1192193932 X:69016210-69016232 TCTGGGGCAGGAGGAGGAGGGGG + Intergenic
1192502678 X:71664074-71664096 TGGGGTGCAGAAGGTGGAGGCGG + Intergenic
1192533931 X:71911836-71911858 GCGGCGGCAGGAGCCGGCGGTGG + Intergenic
1192606950 X:72528387-72528409 GTGGCTGCAGGAGGCAGAAGAGG + Intronic
1193160031 X:78217431-78217453 AGGGCTGAAGGAGGAGGAGGAGG + Intergenic
1195891067 X:109695609-109695631 TCAGGAGCGGGAGGCGGAGGTGG + Intronic
1195954836 X:110317967-110317989 TCCGCTGCAGTGGGAGGAGGAGG + Exonic
1197782481 X:130171847-130171869 TGCGCTGGAGGAGGAGGAGGGGG + Exonic
1198245466 X:134827206-134827228 TCGGGAGGGGGAGGCGGAGGCGG - Intronic
1198312316 X:135435011-135435033 CCGGCTGCGGCAGGCGGAGCAGG + Intergenic
1198762440 X:140046805-140046827 AGGGATACAGGAGGCGGAGGTGG + Intergenic
1199371552 X:147055846-147055868 CCAGCTACAGGAGGCTGAGGTGG + Intergenic
1199527208 X:148805936-148805958 TCTGCTCCAGGAGGAGGGGGCGG + Intronic
1199851873 X:151729625-151729647 TGAGCTGCAGGAGCTGGAGGTGG - Intergenic
1200237210 X:154473420-154473442 GCGGCTGAAGGAGTCGGAGCAGG - Exonic
1200282642 X:154790979-154791001 TCAGCTGCAGAAGGCGATGGTGG - Exonic
1201226497 Y:11823917-11823939 CAGACTCCAGGAGGCGGAGGTGG - Intergenic
1201739735 Y:17311110-17311132 GCAGCAGCAGGAGGAGGAGGAGG - Intergenic
1202581834 Y:26389828-26389850 TAGGCTGCAGGAGGCAGTTGAGG + Intergenic