ID: 916093260

View in Genome Browser
Species Human (GRCh38)
Location 1:161325903-161325925
Sequence AGAAAGCAGAGTTATCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916093252_916093260 27 Left 916093252 1:161325853-161325875 CCAACAAGAAGTTGTGCTTTCAT 0: 1
1: 0
2: 1
3: 14
4: 197
Right 916093260 1:161325903-161325925 AGAAAGCAGAGTTATCGGCCTGG 0: 1
1: 0
2: 3
3: 25
4: 222
916093251_916093260 28 Left 916093251 1:161325852-161325874 CCCAACAAGAAGTTGTGCTTTCA 0: 1
1: 0
2: 1
3: 22
4: 216
Right 916093260 1:161325903-161325925 AGAAAGCAGAGTTATCGGCCTGG 0: 1
1: 0
2: 3
3: 25
4: 222
916093258_916093260 -3 Left 916093258 1:161325883-161325905 CCTGTGTATTGGGTGGGTTTAGA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 916093260 1:161325903-161325925 AGAAAGCAGAGTTATCGGCCTGG 0: 1
1: 0
2: 3
3: 25
4: 222
916093257_916093260 2 Left 916093257 1:161325878-161325900 CCAGACCTGTGTATTGGGTGGGT 0: 1
1: 0
2: 2
3: 8
4: 102
Right 916093260 1:161325903-161325925 AGAAAGCAGAGTTATCGGCCTGG 0: 1
1: 0
2: 3
3: 25
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916093260 Original CRISPR AGAAAGCAGAGTTATCGGCC TGG Intronic
901271533 1:7955601-7955623 TGAAAACAGAGTTTTTGGCCAGG + Intronic
901740850 1:11340745-11340767 ATAAAGCACAGTTATAGGCCAGG + Intergenic
902252233 1:15161641-15161663 AGAAAAGAGATTTATTGGCCGGG + Intronic
905073781 1:35251461-35251483 AGAAAGTATATTTCTCGGCCGGG - Intergenic
906069525 1:43007100-43007122 AAAAAGCAGTCTTGTCGGCCGGG - Intergenic
906709340 1:47917423-47917445 AGAAACCAGAGTTCTTGGCCAGG + Intronic
906813860 1:48857425-48857447 AGAGAGCATAGGTATGGGCCGGG + Intronic
909056741 1:70829877-70829899 AGAAGTCAGAGTTATCAGCCTGG - Intergenic
909853200 1:80495584-80495606 AAAAAGCAGATTTTTGGGCCGGG - Intergenic
910679621 1:89848991-89849013 ATAAAACAGGGTTATTGGCCAGG - Intronic
913176146 1:116274818-116274840 AGAAAGCTCAGGTATAGGCCTGG - Intergenic
916093260 1:161325903-161325925 AGAAAGCAGAGTTATCGGCCTGG + Intronic
916854929 1:168739490-168739512 AGAAAGTACAGTTTTTGGCCAGG + Intergenic
917958147 1:180121483-180121505 AGAAAATAGAGTTACAGGCCGGG - Intergenic
918055278 1:181015952-181015974 AGAAAACAGATTTGTGGGCCAGG - Intronic
919147159 1:193650779-193650801 AGAAAGCATAGTTTTCTACCTGG + Intergenic
919757160 1:201073430-201073452 AGGTAGGAGAGTTATCAGCCAGG - Intronic
919787981 1:201272227-201272249 ACAAAGCAGAGTTATGGGCCTGG - Intergenic
921940660 1:220835389-220835411 AGGAAGCAGAGTTAAGGGTCTGG + Intergenic
923402940 1:233632786-233632808 AGAAAGCAGAGTTGCCAGTCAGG - Intronic
923412077 1:233720622-233720644 AGAAAGCAAAAATATGGGCCAGG + Intergenic
1064224435 10:13470174-13470196 AGAAAGCAGTGTTTTCTGCGTGG - Intronic
1065109755 10:22428007-22428029 AGAAAGGAGAGCTATCGGCCAGG - Intronic
1065597130 10:27325212-27325234 AGAATGCAGATTTAATGGCCGGG - Intergenic
1069941860 10:71962144-71962166 AGAAAGAGGAGTTGTCGGCTGGG + Intergenic
1072977861 10:100074710-100074732 AAAAGGCAGGGTTTTCGGCCGGG - Intronic
1073606348 10:104899690-104899712 AGCAAGTACAGTTATCTGCCTGG - Intronic
1076785509 10:132747751-132747773 AAAAAACAGATTTATAGGCCAGG + Intronic
1077209488 11:1362312-1362334 AGGAAGCTGAGATATCGGCTGGG + Intergenic
1077512424 11:2975435-2975457 AGAAAGCAAAGGTGTCAGCCAGG + Intronic
1082129395 11:48470623-48470645 AGATAGCAAGGTTATCTGCCTGG - Intergenic
1082562929 11:54641517-54641539 AGACAGCAAGGTTATCTGCCTGG - Intergenic
1083691944 11:64414785-64414807 AGAAAGTAGAGGAATAGGCCAGG - Intergenic
1083946577 11:65926793-65926815 AGAAAACAGAGGTAGAGGCCAGG - Intergenic
1084297476 11:68222280-68222302 GAAAAGCACAGTTATTGGCCGGG + Intergenic
1085089579 11:73699146-73699168 AAAAAACAGCATTATCGGCCTGG - Intronic
1086885135 11:92197187-92197209 AGTAAGCAGAGTTATAGACAAGG - Intergenic
1087296185 11:96376983-96377005 AGAAAGCAGAGATAGTGTCCAGG - Intronic
1088025786 11:105180763-105180785 AGAAATCAGGATTGTCGGCCGGG + Intergenic
1088302322 11:108372486-108372508 AGAAATAAGAATTATTGGCCAGG - Intronic
1088311056 11:108461018-108461040 AAAAAGCAGACTTTTTGGCCGGG - Intronic
1088359647 11:108977088-108977110 AGAAAGCAGAGTCAAGGGCTTGG + Intergenic
1089230444 11:116969978-116970000 TGAAAGCAGAGGTATCAGCTGGG + Intronic
1091930826 12:4393995-4394017 ATAAAACAGATTTATCAGCCAGG - Intergenic
1093963281 12:25298899-25298921 AGAAATAAGAGTTTTTGGCCAGG - Intergenic
1095572545 12:43699711-43699733 AGGAAGAAGAGTTATGGGACAGG - Intergenic
1096055210 12:48645149-48645171 AGAAACCAGAGCTCTTGGCCGGG + Intergenic
1097055483 12:56246624-56246646 ACAAAGCACAGATATTGGCCAGG + Intronic
1097147506 12:56951858-56951880 AGAGAGCAGAATTATCTCCCAGG + Exonic
1097496860 12:60350654-60350676 AGAAAGAAGACATATAGGCCGGG + Intergenic
1098094340 12:66938661-66938683 AGAAAGCAGAGTTTCAGGCCAGG + Intergenic
1100253781 12:92860408-92860430 AGAAAGCAGTGTTTTTGGCGGGG + Intronic
1100676557 12:96874910-96874932 AAAAAGCAGAGATCCCGGCCGGG - Intronic
1101462724 12:104913261-104913283 TGAAAACTGAGTTCTCGGCCAGG + Intronic
1103818614 12:123679090-123679112 AGAAAGCTGAATTATCGGCCAGG - Intronic
1104285258 12:127418913-127418935 AGTAAGCAGGGTTACAGGCCCGG - Intergenic
1104466578 12:128995327-128995349 AGAAAGCAAAGGAATAGGCCGGG + Intergenic
1104540744 12:129662497-129662519 AGAAATACGAGTTATTGGCCAGG + Intronic
1104605006 12:130181412-130181434 AGAAAGCAGAGTGATTGCCAGGG - Intergenic
1105868900 13:24486964-24486986 AGAAAAGAAAGTTATCGGCCGGG + Intronic
1109305680 13:60638212-60638234 TAAAAGTAGAGTTTTCGGCCAGG + Intergenic
1109925126 13:69127028-69127050 AGAATGCAGATGAATCGGCCTGG - Intergenic
1110361731 13:74633266-74633288 AGAAAGGAGAGTTATCAGTATGG - Intergenic
1113493324 13:110709387-110709409 AGAAAACAGAATTAGCTGCCGGG - Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1115649006 14:35389882-35389904 AGAAAGGAGATTTGTGGGCCAGG - Intergenic
1120872183 14:89347656-89347678 AGAAAACAGAGGCATGGGCCGGG + Intronic
1124565255 15:30806748-30806770 AAAAAAAAGAGTTATTGGCCGGG + Intergenic
1124604833 15:31162266-31162288 AGAAAGCAGAGAGAAAGGCCGGG + Intergenic
1124938820 15:34199141-34199163 AGAAAACAGATTTACCGGCCAGG + Intronic
1124942865 15:34234665-34234687 AGAAAGAAGAGGTTTAGGCCAGG - Intronic
1125250087 15:37691456-37691478 AAAAAGCTGAGTTTTTGGCCAGG + Intergenic
1126598768 15:50407811-50407833 AAAAATCAGAGGGATCGGCCGGG + Intergenic
1126762412 15:51981176-51981198 AAAATTCAGACTTATCGGCCGGG + Intronic
1127003183 15:54534241-54534263 AGAAAACAAAGTAATGGGCCTGG + Intronic
1129274904 15:74438599-74438621 AGAAAGCAGAGATGTAGGCATGG - Intergenic
1131593307 15:93772262-93772284 AGAAAGGAGAGGTATGGGCCGGG + Intergenic
1132160776 15:99539813-99539835 AAAAAGCAAAAATATCGGCCGGG + Intergenic
1133533510 16:6676969-6676991 AGAAAGTTGAGTTAACGGCTGGG - Intronic
1133794007 16:9031816-9031838 AGAAAGTATAGACATCGGCCGGG - Intergenic
1135470441 16:22724624-22724646 AGAAGGCAGAGTTACTGGACGGG - Intergenic
1135497385 16:22964355-22964377 AGAAAACTGAGTCTTCGGCCGGG - Intergenic
1136585065 16:31179520-31179542 AGACAGCAGGGATTTCGGCCGGG - Intergenic
1136987499 16:35123790-35123812 AGAGAACACAGTTATGGGCCTGG - Intergenic
1138316488 16:56074287-56074309 AAGAAGCAGAGTTATTGGCTGGG - Intergenic
1140353673 16:74286409-74286431 AGAAATTAGAGTTCTCGGCTGGG + Intergenic
1140358732 16:74327397-74327419 AAAAAATAGAATTATCGGCCGGG + Intergenic
1143233471 17:5377819-5377841 AAAAAGACGAGTTTTCGGCCAGG - Intronic
1143472395 17:7184124-7184146 TGAAAGCAGAGTTGTGGGCGAGG + Intergenic
1143797497 17:9349290-9349312 AGAAAATAAATTTATCGGCCGGG - Intronic
1144817771 17:18048194-18048216 AAAAAAAAAAGTTATCGGCCAGG - Intronic
1146110201 17:30082685-30082707 AGAAATCAAAGTTATAGGCCAGG - Intronic
1146196078 17:30814356-30814378 AATAAGAATAGTTATCGGCCAGG + Intronic
1146520022 17:33519113-33519135 AAAAAGAGTAGTTATCGGCCCGG - Intronic
1147460404 17:40564649-40564671 AAAGAGTAGAGTTATCTGCCGGG + Intronic
1149004963 17:51795963-51795985 AGAAAGCAGAGCTATTGATCAGG + Intronic
1149013379 17:51880939-51880961 AGAAAAAAGTTTTATCGGCCGGG + Intronic
1150563662 17:66318512-66318534 ATAAAGCTGAGTTGTCGGGCTGG + Intronic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1156377345 18:36526696-36526718 AGAAAGCTGAATTATGGGCCAGG - Intronic
1158578616 18:58661734-58661756 AGAAATCAGAGTCATGGGGCTGG - Intergenic
1160735098 19:658768-658790 AGAAGGCAGAGTTCGGGGCCTGG - Intronic
1160829968 19:1099282-1099304 AGAAAGCAGTCTGGTCGGCCAGG + Intergenic
1163984235 19:20929823-20929845 AGAAATCAAAGTTTTGGGCCAGG + Intronic
1164010146 19:21194922-21194944 AGAAAGCAGAGTTATCAGGGAGG + Exonic
1164595747 19:29529791-29529813 AGAGAGCAGGGTTAGAGGCCGGG - Intronic
1166362715 19:42261208-42261230 AGAAAACAGGGTTTTCAGCCAGG - Intergenic
1166643079 19:44511312-44511334 AAAAAGGAGAGTTCTGGGCCAGG - Intronic
1166816064 19:45546962-45546984 AAGAAGCAGAGTTTTAGGCCAGG - Intronic
925931767 2:8713879-8713901 AGAAACCAAAATTATTGGCCAGG - Intergenic
927584742 2:24291781-24291803 ATAAAGCAGAAATATGGGCCGGG - Intronic
930546699 2:52776490-52776512 AGAAAGCAGAGACAAGGGCCAGG + Intergenic
932683442 2:73847391-73847413 AGGAAGCAGAGGAATTGGCCCGG + Exonic
933724280 2:85417947-85417969 TTAAAGCAGAGTTGTAGGCCAGG + Intronic
933728227 2:85438233-85438255 GGAAGACACAGTTATCGGCCAGG + Intergenic
937352684 2:121176161-121176183 AGAAAACTGAGTTGTTGGCCGGG - Intergenic
937467921 2:122151243-122151265 AGGAAGCAGAGTTAATGTCCTGG + Intergenic
938867017 2:135433175-135433197 AGAAATCAGAGTTCCCAGCCTGG + Intronic
941371658 2:164672903-164672925 AGAAATCTGGGTTATGGGCCTGG - Intronic
944692860 2:202173272-202173294 AGAAAGGAAAATTATAGGCCGGG + Intronic
947114952 2:226759877-226759899 AGAAAGAAGAGTTATGCGCTGGG + Intronic
947339024 2:229117521-229117543 AGACAGGAGCATTATCGGCCTGG - Intronic
947548074 2:231026058-231026080 AGAAAGAATTGTCATCGGCCAGG - Intergenic
947638317 2:231691927-231691949 AGAAAGAAAAATTAGCGGCCAGG - Intergenic
1170634495 20:18092789-18092811 AGAAAGCCGCGTTATCCCCCGGG - Intergenic
1171007880 20:21485427-21485449 AGAAAGCAGACTAGTGGGCCAGG + Intergenic
1171287078 20:23949187-23949209 AGAAATCAGAGATGACGGCCGGG - Intergenic
1172776423 20:37409893-37409915 AGAAAGGAAAGATGTCGGCCAGG - Intergenic
1172826101 20:37787637-37787659 AAAAAACACAGTTATGGGCCGGG - Intronic
1175476025 20:59275161-59275183 AGAAATCAGAGGAATTGGCCAGG - Intergenic
1181654317 22:24283071-24283093 AAAAAACAAAGTTATCGGCCAGG - Intronic
1182100322 22:27653050-27653072 AGAAAGCAGAGGTGAAGGCCTGG + Intergenic
1183158935 22:36097509-36097531 AGAAAGCAGAGTAGTGGGCTGGG - Intergenic
1183681722 22:39334798-39334820 AGAAAGTAGAGGAATGGGCCGGG + Intergenic
1183836140 22:40455093-40455115 AGAAAGTGGAGTTTTAGGCCAGG - Intronic
1184956321 22:47889109-47889131 AGAAATCCGAGTTATCGACATGG - Intergenic
949713239 3:6896783-6896805 AGAAAGAAGAGTTATTTTCCAGG - Intronic
950387476 3:12671570-12671592 AGAAAGCTGATCTATAGGCCAGG + Intergenic
951589974 3:24254066-24254088 AAAAATCAGATTTACCGGCCGGG + Intronic
953071045 3:39520106-39520128 AAAAATCAGAGTTAGCAGCCAGG - Intronic
953425385 3:42792682-42792704 AAAAAGTAGAGTTTTAGGCCAGG + Intronic
953635835 3:44663411-44663433 AGAAGGCAGAGTTATTAGCTGGG - Intergenic
956020500 3:64928464-64928486 AGAAATCACAGGTATAGGCCAGG - Intergenic
956826902 3:73005551-73005573 AAAAAGCAGTGTTACGGGCCGGG + Intronic
960165480 3:114396588-114396610 GCAAAGCAGAGTTAAGGGCCAGG + Intronic
960724406 3:120655566-120655588 AGAAAGCAGAGATTTTGGTCAGG + Intronic
962521556 3:136201742-136201764 AGAAATTTGAGTTATAGGCCAGG - Intergenic
962585949 3:136843026-136843048 AAAAATCAGAGTTCTGGGCCAGG + Intronic
962676570 3:137762534-137762556 AGAAAGCAGGGTTACAGGGCTGG + Intergenic
966357489 3:179096436-179096458 AGAAAGAAAAGTTGTGGGCCAGG - Intergenic
966898510 3:184463711-184463733 TGTAAGCAGAGTTTTTGGCCAGG - Intronic
969256429 4:6005194-6005216 AGAAAGCAGGGTTGTAGCCCAGG - Intergenic
969565199 4:7973213-7973235 AGAAAGCTGAGGTGTCGGCTGGG + Intronic
969626591 4:8308793-8308815 AGAAAACAACATTATCGGCCAGG - Intergenic
970825332 4:20266206-20266228 AGAAAGCAGATTTTTCAGACTGG - Intronic
971388570 4:26163896-26163918 AGGAAGCAGTGTTACCGGTCTGG - Intronic
973232607 4:47859545-47859567 AAAAAGCAGAAATACCGGCCAGG + Intronic
973815571 4:54616254-54616276 AGAAAGCTTATTTACCGGCCGGG + Intergenic
973843559 4:54887564-54887586 AGAAACCTGAGTTCTAGGCCAGG - Intergenic
976551071 4:86396048-86396070 AGAAAGTAGTGTTTCCGGCCGGG + Intronic
978978320 4:114909363-114909385 AGAAAGCTAAATTATTGGCCGGG + Intronic
980070199 4:128235559-128235581 TGAAAGCAGAGGCTTCGGCCGGG - Intergenic
981475780 4:145185257-145185279 AGAAAAAAGAATTATGGGCCAGG - Intergenic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
986278085 5:6298485-6298507 AGAAAACAGAGATATCGACCTGG - Intergenic
986503650 5:8427753-8427775 ATAAAGAGGAGTTCTCGGCCAGG - Intergenic
986693949 5:10335508-10335530 AGTAAGAAGAGTTATAGGCCGGG - Intergenic
987375199 5:17227697-17227719 AGAAAAATGAGTTATTGGCCGGG - Intronic
992062162 5:73063841-73063863 AGAAAGAGGAGTTGTGGGCCTGG - Exonic
992430531 5:76706642-76706664 AGAAAGCAGTGTTTTCTGGCTGG - Intronic
992921324 5:81524850-81524872 GGAAGGCAGAGTTAGAGGCCTGG - Intronic
994800124 5:104362420-104362442 AGAAAGCCAAGTTATCTGCCAGG + Intergenic
995474567 5:112534676-112534698 AGAAAGCACAATTATCAGGCTGG + Intergenic
997446534 5:133944287-133944309 AGAAAGCATGATTATCGGCCAGG - Intergenic
997744343 5:136285930-136285952 AGAAAGCAGGGTTAGAGGACAGG - Intronic
998052995 5:139051988-139052010 AGAAAGCAGAGTCAAAGTCCAGG - Intronic
998387748 5:141767777-141767799 GGAACGCAGAGTTGGCGGCCAGG + Intergenic
999913466 5:156231672-156231694 AGAAAGTAGAGCTATAGGACAGG + Intronic
1001291951 5:170470006-170470028 TGAGGGCAGAGTTATCAGCCAGG + Intronic
1001323505 5:170702104-170702126 ATAGAGCAGAGTTATGGGACTGG - Intronic
1003822342 6:9912882-9912904 AGAAAACACAGTTATCGGTGAGG - Intronic
1003918295 6:10807766-10807788 AGAAAGACATGTTATCGGCCGGG + Intronic
1004085527 6:12444625-12444647 ATAAAGAAGAGCTTTCGGCCGGG + Intergenic
1004250848 6:14022057-14022079 AGAAATCAGACTTAACGGCTGGG - Intergenic
1005738399 6:28769860-28769882 AGAAAGCTGACTCAGCGGCCCGG - Intergenic
1006631520 6:35433588-35433610 ATAAAGAATAGTTATAGGCCGGG + Intergenic
1008440920 6:51531029-51531051 AGAAATCAGAGTGATAGGCCTGG + Intergenic
1008669702 6:53754692-53754714 AGAATGGAGAGTTATCTGCCTGG - Intergenic
1009908716 6:69901033-69901055 AGAAAGCTGAGTTATCAGGCAGG + Intronic
1011448858 6:87472347-87472369 AAAAATCAGATGTATCGGCCGGG - Intronic
1011976216 6:93302753-93302775 AGAAGGCAGAGTTACTGGACAGG + Intronic
1015579626 6:134709708-134709730 AGAAATCACAGTTTCCGGCCGGG + Intergenic
1016026211 6:139289456-139289478 AGGAAGCAGTTTAATCGGCCGGG - Intronic
1016467416 6:144339870-144339892 ATAAAGAAGAGTTCTAGGCCAGG + Intronic
1018010670 6:159667099-159667121 AGGACGCAGAGTGATCAGCCTGG + Intergenic
1018213254 6:161502699-161502721 AGAACACAGTGTTATCGGCTAGG + Intronic
1019699846 7:2469249-2469271 TTAAAGCAGAGGTTTCGGCCGGG + Intergenic
1020553590 7:9640343-9640365 AGAGACCAGAGCTATCAGCCTGG - Intergenic
1020788678 7:12598595-12598617 TAAAAACAGTGTTATCGGCCTGG + Intronic
1024329897 7:48145179-48145201 AAAAAGCAGAGTTTATGGCCAGG - Intergenic
1030185498 7:106757961-106757983 AGAAAGCAGGGTCATCAGCTGGG - Intergenic
1030655558 7:112163387-112163409 AGAAAGGAGATTTATAGCCCAGG - Intronic
1030679473 7:112419766-112419788 AAAAAGAAAAGTTATCAGCCGGG + Intergenic
1032305930 7:130732999-130733021 AGAAAGCAGGGACAACGGCCTGG + Exonic
1033195697 7:139325562-139325584 TGAAAGCAGTGATTTCGGCCGGG - Intergenic
1034059826 7:148076736-148076758 AGAAGTCAGAGCTATCGGCCGGG - Intronic
1035591159 8:815011-815033 AGAAAGCACAGTTAACGGAGCGG + Intergenic
1035754016 8:2017765-2017787 TGAAAGGAGAGTTCTAGGCCTGG - Intergenic
1036451929 8:8876437-8876459 AGAAACCACTGTTGTCGGCCGGG + Intronic
1036505449 8:9350687-9350709 AGAAAGCACAGCTATAGGCCAGG + Intergenic
1038455250 8:27668562-27668584 AGAAATCACAGATATAGGCCAGG + Intronic
1039441797 8:37600180-37600202 AGAAACCAGAGTCATCAGCGAGG + Intergenic
1040966399 8:53085316-53085338 AGAATGCAGAGTAATAAGCCAGG + Intergenic
1041074791 8:54159608-54159630 AGAAAGCAGATTAATAGGCTGGG - Intergenic
1041448872 8:57985780-57985802 AGAAAGCAGAGTTATCTGTGAGG + Intergenic
1042031153 8:64477428-64477450 AGAATGCAAAGTTGCCGGCCGGG + Intergenic
1042978897 8:74503338-74503360 AGAAAGCAGGGTGATCCCCCAGG - Intergenic
1045287675 8:100806038-100806060 AGAATGCAGAATTATAGGACAGG - Intergenic
1045414527 8:101952829-101952851 TGAGAGCAGAGTTCTCTGCCCGG + Intronic
1046325227 8:112634531-112634553 AGAAAGCAAAGTTATTGCCATGG - Intronic
1047970962 8:130084086-130084108 AAAAAGTGGTGTTATCGGCCTGG - Intronic
1048623610 8:136160965-136160987 AGAAAGAAGAGTTAGAGGCCGGG + Intergenic
1049566298 8:143340900-143340922 AGAAAGGAGAGTTACGGGCCAGG - Intronic
1051712725 9:19948559-19948581 AGAAAACAGAGCTAACGGGCCGG + Intergenic
1052935823 9:34092390-34092412 AGAAAGTAGGGCTCTCGGCCAGG + Intronic
1057074425 9:92129153-92129175 GGAAAGTAGAGATATTGGCCGGG - Intergenic
1057649272 9:96905877-96905899 AGAAAGTAGAGGAATAGGCCGGG - Intronic
1059958266 9:119540963-119540985 GGAAAGCAGAGTCATCAGCAGGG + Intergenic
1061109688 9:128560028-128560050 AAAAATCAAAATTATCGGCCAGG - Intronic
1061390961 9:130316805-130316827 AGAAAGCAGAGATAAGGCCCTGG + Intronic
1187520138 X:20005807-20005829 AGAAAGCACAATTATGGGCCGGG - Intergenic
1187539190 X:20174640-20174662 TGAAAGTAGAGTTTTAGGCCAGG - Intronic
1188533554 X:31169035-31169057 AGAAAGTAGGGTTATTGGCTTGG - Intronic
1188886839 X:35561137-35561159 AGAGAGCAAAGCTATGGGCCTGG + Intergenic
1189966430 X:46378326-46378348 TGAAAGAAAAGTTATTGGCCGGG - Intergenic
1192780476 X:74289096-74289118 ACAAAACAAAGATATCGGCCAGG + Intergenic
1193561568 X:83023373-83023395 AGAGAGCAGGGTTCTCTGCCTGG + Intergenic
1194253204 X:91603250-91603272 TGAAAGGAGAGTTACAGGCCAGG + Intergenic
1194974110 X:100375939-100375961 AGAAAATACAGATATCGGCCAGG + Intronic
1196840401 X:119854079-119854101 AGAAAGCAGATCAGTCGGCCAGG + Intergenic
1197085335 X:122467460-122467482 AGAAACCTTAGTTATCGGGCTGG + Intergenic
1197210001 X:123820520-123820542 AGAAAGTGGATTTGTCGGCCGGG - Intergenic
1198185264 X:134248456-134248478 TGAAAACAGAATTATAGGCCGGG - Intergenic
1198304410 X:135366470-135366492 AGAAAACAGACCTATAGGCCGGG + Intergenic
1198423776 X:136495494-136495516 AGAATGCAGAGCTATCTGCCAGG + Intergenic
1199750799 X:150815824-150815846 AGAAGGCATAGTGATCAGCCAGG + Intronic
1200251256 X:154555311-154555333 AGACAGCAGAGATGTAGGCCAGG + Intronic
1200446864 Y:3273796-3273818 AGAAAGAAGAGTTATCCAACGGG - Intergenic
1200572147 Y:4844493-4844515 TGAAAGGAGAGTTACAGGCCAGG + Intergenic
1201254660 Y:12095292-12095314 ACAGAGCAGAGATATCAGCCTGG + Intergenic
1201328750 Y:12796265-12796287 AGAAAGTAGAGGAATAGGCCGGG + Intronic