ID: 916101121

View in Genome Browser
Species Human (GRCh38)
Location 1:161394105-161394127
Sequence TAGTGAACACACTGTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916101121_916101126 10 Left 916101121 1:161394105-161394127 CCAGCACCACAGTGTGTTCACTA No data
Right 916101126 1:161394138-161394160 TCTTGGAACCCTGTTGTTTAGGG No data
916101121_916101123 -7 Left 916101121 1:161394105-161394127 CCAGCACCACAGTGTGTTCACTA No data
Right 916101123 1:161394121-161394143 TTCACTAAGCCAGAAACTCTTGG No data
916101121_916101129 22 Left 916101121 1:161394105-161394127 CCAGCACCACAGTGTGTTCACTA No data
Right 916101129 1:161394150-161394172 GTTGTTTAGGGTTTGAACATAGG No data
916101121_916101125 9 Left 916101121 1:161394105-161394127 CCAGCACCACAGTGTGTTCACTA No data
Right 916101125 1:161394137-161394159 CTCTTGGAACCCTGTTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916101121 Original CRISPR TAGTGAACACACTGTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr