ID: 916103709

View in Genome Browser
Species Human (GRCh38)
Location 1:161414783-161414805
Sequence CCTGTTTAATTCCCATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916103709_916103711 -10 Left 916103709 1:161414783-161414805 CCTGCTGATGGGAATTAAACAGG No data
Right 916103711 1:161414796-161414818 ATTAAACAGGTATAGCACGTTGG No data
916103709_916103713 2 Left 916103709 1:161414783-161414805 CCTGCTGATGGGAATTAAACAGG No data
Right 916103713 1:161414808-161414830 TAGCACGTTGGGAAGCAACCTGG No data
916103709_916103712 -9 Left 916103709 1:161414783-161414805 CCTGCTGATGGGAATTAAACAGG No data
Right 916103712 1:161414797-161414819 TTAAACAGGTATAGCACGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916103709 Original CRISPR CCTGTTTAATTCCCATCAGC AGG (reversed) Intergenic
No off target data available for this crispr