ID: 916103713

View in Genome Browser
Species Human (GRCh38)
Location 1:161414808-161414830
Sequence TAGCACGTTGGGAAGCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916103709_916103713 2 Left 916103709 1:161414783-161414805 CCTGCTGATGGGAATTAAACAGG No data
Right 916103713 1:161414808-161414830 TAGCACGTTGGGAAGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916103713 Original CRISPR TAGCACGTTGGGAAGCAACC TGG Intergenic
No off target data available for this crispr