ID: 916106326

View in Genome Browser
Species Human (GRCh38)
Location 1:161435290-161435312
Sequence ACAGCTCTTGGCCTGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 851
Summary {0: 174, 1: 194, 2: 145, 3: 123, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916106326_916106332 17 Left 916106326 1:161435290-161435312 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 916106332 1:161435330-161435352 GTTATTTGCAGAAGATGGCAGGG No data
916106326_916106330 12 Left 916106326 1:161435290-161435312 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 916106330 1:161435325-161435347 GAGTAGTTATTTGCAGAAGATGG 0: 11
1: 189
2: 190
3: 139
4: 322
916106326_916106331 16 Left 916106326 1:161435290-161435312 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916106326 Original CRISPR ACAGCTCTTGGCCTGTTACT GGG (reversed) Intergenic
900347076 1:2215049-2215071 TCAGCTCACGGCCTGTTGCTGGG + Intergenic
900434962 1:2625613-2625635 ACAGCTCTTGGCCCGTTACTGGG + Intronic
901904047 1:12392647-12392669 ACAGCTCTTGGCCTGTTACTGGG - Intronic
902436256 1:16399847-16399869 AAAGCTCCTATCCTGTTACTTGG + Intronic
904179490 1:28655934-28655956 ACAGCTCTTGGCCTATTACTGGG - Intergenic
904335936 1:29798023-29798045 ACAGCTCTTGGCCTATTACTGGG + Intergenic
904419576 1:30383012-30383034 ATAGCTCCTGGCTTGCTACTGGG - Intergenic
905354069 1:37368820-37368842 ACAGCTCTTGGCCTGTTACTTGG + Intergenic
905465228 1:38148136-38148158 ACAGCTCTTAGCCTGTTACTGGG + Intergenic
905508273 1:38497929-38497951 ACAGGACTTGGTATGTTACTGGG + Intergenic
906050492 1:42867451-42867473 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
907780345 1:57560871-57560893 TCAGCTCTTGGCCTGTTACTGGG + Intronic
908052314 1:60246750-60246772 ACAGCTTTCGGCCTGTTGCTGGG + Intergenic
908161490 1:61412689-61412711 ACAGCTCTTTGCAGGTGACTGGG + Intronic
908261127 1:62339916-62339938 ACTGCTCCTGGCCAGGTACTTGG - Intergenic
909172604 1:72315429-72315451 ATGGCTCTTGTCCTCTTACTGGG - Intergenic
909278736 1:73722160-73722182 TCAGCTCTTGGTCTGTTACTAGG + Intergenic
909576924 1:77185895-77185917 ACAGCTCTTGGCCTGTTACTGGG + Intronic
909810957 1:79931374-79931396 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
909869579 1:80722721-80722743 GCAGCTCTAGGGCTGTTTCTTGG + Intergenic
910141290 1:84030026-84030048 ACAGCTCTTGGCCTGTTACTAGG + Intergenic
910169056 1:84358532-84358554 ATAGCTCCTGGTGTGTTACTGGG - Intronic
910370638 1:86512165-86512187 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
910559942 1:88579353-88579375 ACAGCTCTTGACATGCTACTGGG + Intergenic
910561904 1:88600018-88600040 ACAGCTCTTGGCCTGTTATTGGG + Intergenic
910588219 1:88901763-88901785 ACAGCTCTTGTCTTGTTACTGGG + Intergenic
910630225 1:89346289-89346311 GCAGCTCTTGGCCTGTTACTGGG + Intergenic
910688967 1:89946946-89946968 ATACCTCATGGTCTGTTACTAGG - Intergenic
910790325 1:91043757-91043779 ACAGCTGTTGGCCTGTTACTGGG + Intergenic
910831094 1:91463387-91463409 ATAGCTCTTGGCCTGTTATTGGG - Intergenic
911109094 1:94164168-94164190 ACAACTCTTGGCCTGTTACTGGG - Intronic
911257321 1:95647327-95647349 GCAGCTCTTGGCCTGTTACTGGG - Intergenic
911345227 1:96688821-96688843 AAAGCTGTTGGCCTGTAAATGGG - Intergenic
911719981 1:101180406-101180428 ACACCTGTTGTCCTGCTACTTGG + Intergenic
911738394 1:101361882-101361904 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
911980429 1:104559458-104559480 ACAACTCTTGGCCTGTTACTAGG + Intergenic
911981896 1:104579225-104579247 AAAACTCTTGGCCTGTTATTGGG - Intergenic
912067026 1:105756984-105757006 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
912129908 1:106588013-106588035 ACAACTCTTGGCCTGTTACTGGG - Intergenic
912212256 1:107568931-107568953 ACAGCTCTTGGATTGCTACTGGG + Intergenic
912252025 1:108021351-108021373 ACAGCTCTTGGGTTGTTACTGGG - Intergenic
912733319 1:112128792-112128814 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
912943809 1:114068167-114068189 ACAGCTTTTAGCCTGTTACTGGG - Intergenic
913039443 1:115008358-115008380 ACAGCTCTTGTCCTGTTACTGGG - Intergenic
915667666 1:157459606-157459628 ACAGCTCTTGGTCTGTTGCGGGG - Intergenic
916017354 1:160761955-160761977 AGAGCACTTGGCCTATTACTGGG - Intergenic
916106326 1:161435290-161435312 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
916190166 1:162170635-162170657 ACCGCGCCTGGCCTGTTCCTTGG - Intronic
916285320 1:163099565-163099587 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
916365964 1:164028050-164028072 ACAGCTCTTGGTCTGCTACTGGG - Intergenic
917052488 1:170939800-170939822 ACAGCCCTTGACATGCTACTAGG - Intronic
917217210 1:172690876-172690898 GCAGCTCTTGGTCTGTTACTGGG - Intergenic
917462711 1:175246220-175246242 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
917470315 1:175321043-175321065 ACAGCTGTTGGCCTGTACCTCGG + Exonic
917689865 1:177457697-177457719 ACAGCACTTGGAATGCTACTAGG - Intergenic
917797992 1:178545623-178545645 ACAGCTCTTGGCAAGTGAGTGGG + Intronic
918755710 1:188337772-188337794 ATGGCTCTTGGCCCGTTACTGGG - Intergenic
918774496 1:188610784-188610806 ACATCTCTTTGCCTGTTACTGGG + Intergenic
918815082 1:189171265-189171287 CCAGCTCTTGGTCTGTTACTGGG + Intergenic
918918228 1:190671842-190671864 ACAGCTCTTGGCCTGTTAATGGG - Intergenic
919241776 1:194924241-194924263 ACAGCTATTGGCCTGTTAATGGG + Intergenic
920197434 1:204238403-204238425 ACACCTGTTGGTCTGTTACTGGG + Intronic
920270104 1:204756283-204756305 ACAGCTCTTGACTTTCTACTAGG + Intergenic
920570711 1:207015172-207015194 ACAGCTCTTGTCCAGGAACTGGG - Intronic
921619823 1:217313174-217313196 ACAGCTCTTGGTCTGCCACTGGG + Intergenic
923253566 1:232199400-232199422 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
923782673 1:237039570-237039592 TCAGGTCTTGCTCTGTTACTAGG + Intergenic
924182505 1:241453204-241453226 ACAGTTCTTGGCCTGCTACTGGG - Intergenic
924323151 1:242869576-242869598 ACAACTCCTGGCCTGCTGCTGGG - Intergenic
924477395 1:244394164-244394186 ACAACTCTTGGCCTACTACTGGG - Intergenic
924840773 1:247707795-247707817 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1064284272 10:13978868-13978890 ATAGCTCTTGGCTTGCTGCTTGG - Intronic
1064517639 10:16168219-16168241 ACAGCTCTTGCCACGTTACCGGG - Intergenic
1064545685 10:16448098-16448120 ACAGCTCTTGGCCAGTTACTGGG - Intronic
1065005329 10:21374201-21374223 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1066164060 10:32766587-32766609 ACAGTTCTTGGCCTGCTATTGGG + Intronic
1066167024 10:32799193-32799215 TCAGCTCTTGGCCTGTTACTGGG - Intronic
1066169430 10:32826355-32826377 ACACCTCTTGTCCTATTACTGGG + Intronic
1067125550 10:43512507-43512529 ACAGTTCTTGGCCTATTACTGGG - Intergenic
1067299116 10:44993322-44993344 GCAGGTGTTGGCCAGTTACTTGG - Exonic
1067518969 10:46980522-46980544 ACAGCTTTTGGCCTGCTACTGGG + Intronic
1067643277 10:48071312-48071334 ACAGCTTTTGGCCTGCTACTGGG - Intergenic
1067769755 10:49115046-49115068 ACAGCTCTTGGCAGATTCCTCGG - Intronic
1068007670 10:51409533-51409555 ACAGCTCTTGGCCTGTCACTGGG - Intronic
1068447213 10:57138630-57138652 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1068837213 10:61568341-61568363 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1069145766 10:64890477-64890499 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1069192302 10:65506333-65506355 ACAGCCCTTGGCCTGTTACTGGG - Intergenic
1069790828 10:71019546-71019568 ACAGCCCTTGGCCTGTTACTGGG - Intergenic
1071267083 10:83973965-83973987 ACAGCCCTTGGCCTGTTACTGGG - Intergenic
1071364466 10:84884484-84884506 ACAGCTCTTGGCCTGTTACTAGG - Intergenic
1071559737 10:86635660-86635682 ACAGCACTTTGCCTGGTAGTAGG + Intergenic
1071673924 10:87637392-87637414 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
1071920064 10:90339733-90339755 ACAGCTCTTGACTTTCTACTGGG + Intergenic
1071937691 10:90549313-90549335 ACAGCTCTTGGCCTGTTCCTGGG + Intergenic
1071942782 10:90607741-90607763 ACCGCCCTTGGCCTGTTACTGGG - Intergenic
1071947083 10:90657694-90657716 ATAGCTCTTGGTCTGCTACTGGG - Intergenic
1071950795 10:90700900-90700922 ACAGCTTTTGGCCTGGTGCTGGG - Intergenic
1072360471 10:94654180-94654202 ACAGCTCTTGGACTGTTACTCGG + Intergenic
1073557352 10:104465937-104465959 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
1073656678 10:105424447-105424469 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1073830502 10:107377972-107377994 ACAGTTCTTGGCCTATTACTGGG - Intergenic
1073918473 10:108432278-108432300 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1073957679 10:108891616-108891638 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1073995870 10:109314680-109314702 ATAGCTCTTGGCTTATTACTGGG - Intergenic
1074374731 10:112930483-112930505 ACTGCTCCTGGCCTGCTTCTTGG - Intergenic
1074632511 10:115274013-115274035 ACAGCTCTTAGTCTGCTACTGGG - Intronic
1075606792 10:123817436-123817458 ACAGCACTTGGCCTGTTACTGGG + Intronic
1076772626 10:132674802-132674824 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1076927413 10:133499189-133499211 ACAGCTCTTAGCCTGTTACTGGG - Intergenic
1077401203 11:2358506-2358528 ACAGCTCTTGCCCTGCTTCTGGG + Intergenic
1077787030 11:5395523-5395545 ACAGATCTGGACTTGTTACTGGG + Intronic
1078195295 11:9132130-9132152 ACAGTTCCTGGCATGTGACTAGG + Intronic
1079112147 11:17610914-17610936 ACAGCTCCAGGCCTGCTGCTGGG + Exonic
1080020137 11:27551629-27551651 ACAGCTCTGGGCCTGCTACTGGG - Intergenic
1080076596 11:28157532-28157554 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1080976683 11:37350609-37350631 ACAGCTTTTGGCTTGTTACTGGG + Intergenic
1081065458 11:38534865-38534887 GCAGCTCTTGGCTTGTTATTGGG - Intergenic
1081072779 11:38631132-38631154 ACATTTCTTGGCCTGTTACTGGG + Intergenic
1081110480 11:39128430-39128452 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1081609064 11:44547889-44547911 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1082671702 11:56043053-56043075 ATAGCTCTTTGCCTGCTACTGGG + Intergenic
1082691594 11:56311468-56311490 ACACTTCTTGGCCTGCTATTAGG + Intergenic
1082999664 11:59279890-59279912 AGAGTTCTTGGCCTGTTACTGGG + Intergenic
1085684623 11:78610428-78610450 ACAGCTCTTGGCCTGATACTGGG + Intergenic
1085685965 11:78622201-78622223 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1085747573 11:79128251-79128273 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1086278615 11:85160463-85160485 ACAGCTCTTGGCCTGTTATTGGG + Intronic
1086834118 11:91600404-91600426 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1087021602 11:93608716-93608738 ATAGCTCTTGGCCTGCTACTGGG - Intergenic
1087374023 11:97320565-97320587 ACACCTCTTGGCCTGTTGCTAGG + Intergenic
1087410095 11:97780661-97780683 ACAGCTTTTGGCATATGACTAGG + Intergenic
1087494770 11:98877134-98877156 ACAGCTCCTGGCCTCCTTCTTGG - Intergenic
1088097207 11:106115169-106115191 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1088191658 11:107234479-107234501 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1088407609 11:109498651-109498673 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1088449356 11:109965379-109965401 ACAGCTCTTGGCCTGTTACCAGG + Intergenic
1088836658 11:113583400-113583422 ACAGCTCTTGGCCTGTCACTGGG + Intergenic
1089903608 11:122013620-122013642 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1090209490 11:124908039-124908061 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1090753984 11:129772575-129772597 ACAATTCTTGGTCTGCTACTGGG - Intergenic
1090796881 11:130142900-130142922 ACTGCACCTGGCCAGTTACTTGG + Intronic
1091103474 11:132897271-132897293 AGAGCTCTTGGCCAGCTACTGGG + Intronic
1092344137 12:7701474-7701496 CAAGCTCTTGCTCTGTTACTTGG - Intergenic
1092535140 12:9379889-9379911 ACAGCTCATGGCCTGGTACAGGG + Intergenic
1092656051 12:10686558-10686580 ACAACTCTTGGTGTGCTACTGGG - Intergenic
1093031868 12:14295938-14295960 ACAGCTGTTGGCCTGTTACTGGG - Intergenic
1093036339 12:14335695-14335717 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1093048922 12:14484956-14484978 ACAGCTCTTGGCCTGTTAACTGG - Intronic
1093049668 12:14490951-14490973 ACAGCTCTTGGCCTGTTAAAGGG - Intronic
1093392082 12:18635523-18635545 ATAGCTCTTGACCTGCTACTAGG - Intronic
1093458272 12:19385647-19385669 ACAGCGATTGGCATCTTACTTGG - Intergenic
1093645731 12:21583682-21583704 AAAGCTCTTGGCCTGTTACTGGG + Intronic
1094102533 12:26779274-26779296 ACAGCTCTTGGTCTGGTACTGGG + Intronic
1094635408 12:32222482-32222504 TCAGATCATGGCCTGTCACTTGG - Intronic
1095121504 12:38424832-38424854 GCAACTCTTGGCCTGTGACAGGG - Intergenic
1095309282 12:40678594-40678616 ACAAGTATTGGCCTGATACTTGG - Intergenic
1095394103 12:41742944-41742966 ACAGCTCTTGGCCACATACTAGG - Intergenic
1095410183 12:41912815-41912837 AAGGCTCTTGGCCTATTAGTTGG + Intergenic
1095603856 12:44044346-44044368 ACAGCTCTTGGCCTGTTTCTGGG + Intronic
1095844393 12:46729956-46729978 ACAGCTCTTGGCCTGTTAATGGG - Intergenic
1095856238 12:46863663-46863685 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1096085345 12:48861842-48861864 ACAGCTCTGGGACTGGAACTTGG - Intronic
1096288714 12:50322972-50322994 ACAGCTCTTGGCCTGCTACTGGG + Intergenic
1096457464 12:51799425-51799447 ACGGCTCTTGGCCTGTTACTGGG - Intronic
1096734790 12:53644212-53644234 GTAGCTCTTGGCCTGCTACTGGG + Intronic
1097077002 12:56402453-56402475 ACAGCTCTTGACCTGTTACTGGG + Intergenic
1097313935 12:58152124-58152146 ACAGCCCTTGGTCTGCTACTGGG - Intergenic
1097437836 12:59572242-59572264 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1097564646 12:61252417-61252439 ACAGCTCTTGACCTGTTACTGGG - Intergenic
1097821339 12:64131852-64131874 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1097843355 12:64342749-64342771 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1098158370 12:67623629-67623651 ACAGCTTTTGGGCTGCTACTGGG + Intergenic
1098589213 12:72190024-72190046 ACTGCTCTTGGCTTGCTACTGGG + Intronic
1098673043 12:73254256-73254278 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1098716092 12:73829827-73829849 ACAGTTCTTGGCCCGTTACTGGG + Intergenic
1098731053 12:74037360-74037382 ACAGCTGTTGGCCTGTTACTGGG + Intergenic
1098733295 12:74065643-74065665 AAAGCTCTTGGCTGGTTATTGGG + Intergenic
1098745702 12:74234607-74234629 ACAGATCTCGGCCTGCTCCTGGG + Intergenic
1098807199 12:75034985-75035007 ACAGCTCTTGGACTGGTACTGGG + Intergenic
1098831903 12:75374013-75374035 AAAGCTCTTGGCCTGTAAGTGGG - Intronic
1099365926 12:81765396-81765418 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1099375649 12:81893969-81893991 ACAGCTCTTGGCCTGTTACTAGG + Intergenic
1099379380 12:81936528-81936550 GCAGCTCTTGGCCTGTTACTGGG - Intergenic
1099508563 12:83507199-83507221 ACAGCTCTTGGCCTGCTACTGGG + Intergenic
1099578078 12:84405403-84405425 GCAGCTTTTGGCCTGTTACTGGG + Intergenic
1099689782 12:85938049-85938071 ACAGCTCTTTGTCTGTTACTGGG + Intergenic
1099995063 12:89769518-89769540 ATACCTCTTGGCCTACTACTGGG - Intergenic
1100083305 12:90878224-90878246 ACAGCTCTTTGCCTGTTACTGGG + Intergenic
1100231950 12:92617866-92617888 ACAGCTTTTGGCCTGTTATTAGG + Intergenic
1100241150 12:92711596-92711618 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1101264133 12:103066134-103066156 ACAGCTCTTGGCCAATTACTGGG + Intergenic
1101534666 12:105606092-105606114 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1101543073 12:105682648-105682670 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1101697455 12:107139818-107139840 AAAGCTCTTGGCCTGCTACTGGG - Intergenic
1101852846 12:108418036-108418058 GCAGCTCTGGGCTTGCTACTGGG - Intergenic
1102211233 12:111128677-111128699 ACAGCTCTTGGTTTGCTACTGGG - Intronic
1102284871 12:111647940-111647962 ACAGCTGTAGTCCAGTTACTTGG + Intronic
1103396529 12:120611459-120611481 ACAGCTCTTGACCTGTTACTGGG + Intergenic
1103861987 12:124022888-124022910 ACCGCGCCTGGCCAGTTACTGGG + Intronic
1105411300 13:20174018-20174040 ACAGCTGCTGGCCTCTTTCTTGG + Intergenic
1105740111 13:23315188-23315210 ACAACTCTTGGCCTGTTACTGGG + Intronic
1106762091 13:32877326-32877348 GCAGTTCTTGGCATGCTACTGGG + Intergenic
1106905536 13:34405419-34405441 ATAGCTCCTGGTGTGTTACTGGG - Intergenic
1107400778 13:40066833-40066855 CCAGCTCGGGGCCTGTTACCTGG - Intergenic
1107983574 13:45755960-45755982 ACAGCTCTTGGCCTATTACTGGG - Intergenic
1108302432 13:49091973-49091995 ACAGCTCTTGGCCCGTTACTGGG - Intronic
1108477896 13:50839574-50839596 ACACCTCTAAGCCTGTCACTAGG + Intronic
1108914300 13:55588859-55588881 ACAGCTCTTGGCATGTTACTAGG - Intergenic
1109293226 13:60500130-60500152 ACGGCTCTTGGCCTGTTACTGGG + Intronic
1109519024 13:63484813-63484835 ACAGCTCTTGGCTTGTTACTGGG + Intergenic
1109583050 13:64366179-64366201 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1109705069 13:66079235-66079257 ACAACTGTTGACCTGCTACTGGG + Intergenic
1109712679 13:66180810-66180832 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1109933290 13:69245163-69245185 ACAGTTCTTGGCCTGCTATCGGG - Intergenic
1109951022 13:69502193-69502215 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1110377174 13:74806481-74806503 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1110834133 13:80064617-80064639 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1111057797 13:82973015-82973037 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1111317504 13:86581813-86581835 AGAGCTCTTGGCCTGTTACTGGG + Intergenic
1112249925 13:97770266-97770288 ACAGCTCTTGGGCTGTTACTGGG - Intergenic
1112308827 13:98300079-98300101 TTGGCTCTTGGCCTATTACTGGG - Intronic
1113001240 13:105640044-105640066 AGAGCTCTTTCCCTGTTATTTGG + Intergenic
1113111594 13:106829557-106829579 AGAGCTTTTGGCCTGCTACTTGG - Intergenic
1113319703 13:109221651-109221673 ACAGCTCTTGACCTATTACTGGG - Intergenic
1113892141 13:113742088-113742110 TCAGCTCTTGTCCTGTCACGTGG + Intergenic
1114205872 14:20570781-20570803 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1114758256 14:25283864-25283886 ATAGCTCTTCACCTGTTACTGGG - Intergenic
1115059718 14:29173906-29173928 ACAGCTCTTGGCTTGTAACTGGG + Intergenic
1115070786 14:29319636-29319658 ACAGCTCTTAGCCTGCTACTGGG + Intergenic
1115130695 14:30049272-30049294 ACAGCTCTTGGCCTGTCACTGGG + Intronic
1115143401 14:30199399-30199421 GCAACTCTTGGCCTGCTACTGGG + Intergenic
1115310867 14:31976489-31976511 ACAGTTTTTGGCCTGCTACTGGG - Intergenic
1115685297 14:35790396-35790418 ACCGCGCTTGGCCTGTTCCAAGG - Intronic
1116058910 14:39896950-39896972 ACAGCTCTTGGCCTGTTGCTGGG + Intergenic
1116068096 14:40009183-40009205 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1116158376 14:41236653-41236675 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1116308042 14:43283435-43283457 ACAGCTCTTGGCCTGCTACTGGG - Intergenic
1116531454 14:45978213-45978235 AGAGCTCTTGGACTGTTACTAGG - Intergenic
1117216845 14:53560187-53560209 ACACCTCTTGGCCTGTTACTGGG + Intergenic
1117634135 14:57724385-57724407 ACAGCTGTTGGCCTGTTACTGGG + Intronic
1117780110 14:59223372-59223394 ACAGCTCTTGGGCTGGGCCTTGG - Intronic
1118122432 14:62860158-62860180 ACAGCTCTTAGCCTGTTACTGGG - Intronic
1118385500 14:65252533-65252555 ACAGCTCTTGGTCTGCTACTGGG - Intergenic
1118501836 14:66369401-66369423 ATAGCTCTTGGCCTGCTACTGGG + Intergenic
1118880772 14:69824006-69824028 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1118894000 14:69930777-69930799 GCAGCTCTTGGCCTGGAGCTGGG + Intronic
1119059695 14:71462178-71462200 ACAGCTCTTTGTCTGTTACTGGG - Intronic
1119107562 14:71938827-71938849 ACAGCTCTTGGCCTATTACTGGG - Intronic
1120082023 14:80227518-80227540 ACAGCTCTTTGCCTGTTCCTGGG - Intronic
1120169408 14:81233998-81234020 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1120555990 14:85930426-85930448 GCAGCTCTTGGCCTGTTACTGGG - Intergenic
1120710467 14:87788079-87788101 ACAGCTTTTGGCTTGCTATTGGG - Intergenic
1120973705 14:90230838-90230860 GAAGCTCTTGGCCTGTTACTGGG + Intergenic
1123817812 15:23997490-23997512 GCAGCTCTTGGCTTGTCACTGGG - Intergenic
1123908496 15:24943642-24943664 ACAGCTGTTGGCCTGCTACTGGG - Intronic
1124149395 15:27163509-27163531 CAATCTCTTGGGCTGTTACTAGG + Intronic
1124509603 15:30312094-30312116 ACAGCTTTTGGCCTATTCCTGGG + Intergenic
1124571704 15:30870366-30870388 GCAGCTTTTGGCTTGCTACTGGG + Intergenic
1124703347 15:31936827-31936849 ACAGCTCTCGACCTGCTATTGGG + Intergenic
1124733957 15:32226568-32226590 ACAGCTTTTGGCCTATTCCTGGG - Intergenic
1126283612 15:46986289-46986311 ACAACTCTTGGCCTGTTATTGGG + Intergenic
1126304423 15:47238968-47238990 ACAGGCCATGGGCTGTTACTGGG + Intronic
1127172580 15:56318454-56318476 ACAGTTCTTGGCCTTTTGATTGG + Intronic
1127356918 15:58209201-58209223 ACAGCTCTTGGCCTGTTATTGGG + Intronic
1128515037 15:68336720-68336742 ACAGTTCCTGGGCTGTTTCTGGG + Intronic
1131724012 15:95202807-95202829 ACAGCTCTTGGCCTGTTACCGGG + Intergenic
1132305738 15:100810855-100810877 ACAGCTCTTGGCCTGCTACTGGG - Intergenic
1132538090 16:493502-493524 ACAGCTATTGGCCTGTTCTGAGG - Intronic
1133125273 16:3642166-3642188 ACAGCTCTCAGCCTTTTGCTTGG + Intronic
1135061635 16:19275994-19276016 ATGGCTCTTGGCGTGATACTTGG - Intergenic
1135626005 16:23995508-23995530 ACAGCTCTTGGCCTGCTACCGGG + Intronic
1135688078 16:24514376-24514398 GCAGCTCCTGGCATGCTACTGGG + Intergenic
1137708440 16:50550216-50550238 CCAGCTCCTGGCCTGGGACTTGG + Intronic
1138318835 16:56093751-56093773 ACAGATCTCGGTCTGCTACTGGG - Intergenic
1138868386 16:60850794-60850816 ACAGCACTTTTCCTGTTATTGGG + Intergenic
1138952414 16:61929196-61929218 ACAGCGCCTGGCCTGTTTTTAGG + Intronic
1139134622 16:64187066-64187088 ACAACTATTAGCCTGCTACTTGG + Intergenic
1140294197 16:73692348-73692370 ACACCTCCTGGCCTGGTCCTTGG - Intergenic
1141559541 16:84858026-84858048 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1142391095 16:89800739-89800761 ACAGTTCCCGGCCTGTTTCTGGG - Intronic
1142475526 17:186723-186745 ACAGCTCGGGGCCTGTTACAGGG - Intergenic
1142588380 17:988572-988594 ACAGCTTTTGGACTGCTACTGGG - Intergenic
1143191091 17:5040727-5040749 ACAGCCCTAAGGCTGTTACTTGG + Intronic
1146237985 17:31185960-31185982 ACAGCTCTTGACCTGTTACTGGG + Intronic
1146836357 17:36114012-36114034 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1146850935 17:36221052-36221074 ACAGCTCTTAGCCTGTTACTGGG + Intronic
1147658530 17:42104760-42104782 GCAGACCTTGGCCTGGTACTCGG + Exonic
1148166097 17:45485030-45485052 GCAGCACCCGGCCTGTTACTGGG - Intronic
1149299285 17:55289227-55289249 ACTGCTCATGGCCTGGTGCTTGG - Intronic
1150397320 17:64831754-64831776 GCAGCACCCGGCCTGTTACTGGG - Intergenic
1151037810 17:70821586-70821608 ACAGCACTTGGCCCATTATTTGG - Intergenic
1151842029 17:76625759-76625781 ACAGCTCCTGGGCTATTCCTGGG - Intronic
1203163029 17_GL000205v2_random:69136-69158 GCAGCTGTTGACCTGCTACTGGG + Intergenic
1153049136 18:884711-884733 ACAGCACTTGGCGTGTTACTAGG + Intergenic
1153089711 18:1330170-1330192 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1154129535 18:11724816-11724838 ACAACCCTTGGCCTGCTCCTGGG - Intronic
1154252670 18:12757267-12757289 ACAGCTCTTGGCCTGTTACTAGG - Intergenic
1154506174 18:15042898-15042920 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1155940709 18:31799606-31799628 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
1156303862 18:35858702-35858724 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1156582552 18:38394472-38394494 ACAGCTCTTAGCCTATTACTGGG + Intergenic
1156606373 18:38671773-38671795 ACATTTCTTGGCCTGTGATTGGG + Intergenic
1156990301 18:43400767-43400789 ATGGCTCTTGGGCTATTACTGGG - Intergenic
1156998581 18:43497737-43497759 ATAGCTTTTGGCCTCTTACTGGG + Intergenic
1157341204 18:46780035-46780057 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1157870930 18:51229573-51229595 ATAGCTCTTGGTCTGCTACTGGG - Intergenic
1159152204 18:64535030-64535052 ACAGCTCTTGGCATGTTACTGGG - Intergenic
1159287790 18:66375490-66375512 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1159559103 18:69975343-69975365 ACAGCTCTTGGCTTGTTACTGGG - Intergenic
1159711302 18:71764132-71764154 ACAACTCTTGGTTTGTTACTGGG + Intronic
1160092465 18:75840023-75840045 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1163864908 19:19764892-19764914 ACAGCTTTTGGCCTGTTCCTGGG + Intergenic
1164097084 19:22021335-22021357 ACAACTCTTGGCCTATTACTGGG - Intergenic
1164117256 19:22234566-22234588 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1165705827 19:37975598-37975620 ACAGCTCCTGGCCTGTGGCAAGG + Intronic
1167951581 19:53031934-53031956 ACAGCTCCCAGCCTGTTGCTGGG + Intergenic
925279954 2:2676876-2676898 ACAGCACTTGGCCTGTTACTGGG + Intergenic
925381749 2:3432845-3432867 ACAGGCCTTGGCCAGTCACTGGG + Intronic
925460728 2:4060454-4060476 ACAGCTCTTTGTCTATTACTGGG + Intergenic
925499406 2:4486916-4486938 AAAGCTCTTGACTTGTTACTGGG - Intergenic
926810394 2:16750668-16750690 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
926826764 2:16913676-16913698 ACAGATCTTGGCCTGTTACTGGG + Intergenic
927008719 2:18879732-18879754 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
929269824 2:39960773-39960795 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
929550263 2:42886040-42886062 ACAACTCTTGGACTGTTACTGGG + Intergenic
930295401 2:49547501-49547523 AGAGCTCTTGGCCGGTTACTGGG - Intergenic
930418606 2:51121003-51121025 ACATCTTTTGGCCTGTTACTGGG + Intergenic
932870705 2:75395073-75395095 ACAGCTCCTGGCCTGTTACTGGG - Intergenic
933130413 2:78665636-78665658 AGAGTTCTTGGCTTGTTCCTGGG + Intergenic
933265683 2:80178372-80178394 ACAGCTCTTGGCCTGTTACTGGG - Intronic
933394461 2:81713347-81713369 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
934050388 2:88205756-88205778 ACAGCTCCTGACATGTTCCTGGG + Intergenic
934614955 2:95764974-95764996 TCAGCTCTTGGCCTGACACCAGG + Intergenic
934645948 2:96059513-96059535 TCAGCTCTTGGCCTGACACCAGG - Intergenic
934839351 2:97615603-97615625 TCAGCTCTTGGCCTGACACCAGG - Intergenic
935183937 2:100714909-100714931 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
935391354 2:102556411-102556433 ACAGCTGTTGGCATGCTACTGGG - Intergenic
935425108 2:102911317-102911339 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
935477710 2:103544061-103544083 ACTGCGCCTGGCCTGATACTGGG + Intergenic
935564307 2:104590243-104590265 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
935817452 2:106860008-106860030 ACAGCTCCTGGCCATTTGCTTGG + Intronic
935823226 2:106915234-106915256 GCAGCTCTTGGCTTGCTACTGGG + Intergenic
935944628 2:108274355-108274377 ACAGCTCTTGGCCTGCTACTGGG - Intergenic
936641227 2:114314700-114314722 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
936646286 2:114376372-114376394 ACAGCTCATGGCCTGCTCCTCGG - Intergenic
937133032 2:119527511-119527533 AGAGCTCTTTGCATGGTACTGGG + Intergenic
937582063 2:123499157-123499179 ACAGTTCTTGGCCCATTACTAGG - Intergenic
937785204 2:125887718-125887740 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
937852568 2:126648728-126648750 ACAGCACTTGGCCTGTTACTGGG - Intergenic
937896421 2:126979778-126979800 GCAGCTCATGGCCTGCAACTTGG - Intergenic
938375540 2:130803382-130803404 ACAGCTCTTGGCCTGCTACCGGG + Intergenic
938709580 2:133964652-133964674 ACAGCTTTTGTCTTGCTACTGGG + Intergenic
939069064 2:137517866-137517888 GCAGCTCTTGGCCTGTTACTGGG + Intronic
939213874 2:139212250-139212272 ACAGCTCTTGGCCTGTTATTGGG + Intergenic
939788684 2:146546103-146546125 ACAACTCTTGGCCTGTTACTGGG - Intergenic
939806242 2:146778484-146778506 ACAGCTCTCGGCCTATTACTGGG + Intergenic
940171312 2:150832702-150832724 ACAGCTCTTGGCCTGTTACTAGG - Intergenic
940472088 2:154113117-154113139 ACAGCTCTAGACCTGTTACTGGG - Intronic
940605914 2:155924278-155924300 ACAGCTCATGGCCTGTTACTGGG - Intergenic
941236566 2:162982848-162982870 ACAGCTCCTGGCATGTTGCTGGG + Intergenic
941330666 2:164174555-164174577 ACAGCTCTTTGCCTGTTACTGGG - Intergenic
942987908 2:182164004-182164026 GTAGCTCTTGACCTGCTACTAGG + Intronic
943006898 2:182395851-182395873 ACAGCTCTTGGCCTGTTATTAGG + Intronic
943239217 2:185362562-185362584 ACAACTCTTGGCCTGTTACTGGG - Intergenic
943317927 2:186412309-186412331 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
943384062 2:187181080-187181102 ACAGATCTTTACCTGTTACTGGG - Intergenic
943388131 2:187227146-187227168 GCAGCTCTTGGCCTGTTACTGGG + Intergenic
943517596 2:188907232-188907254 ACATCTCTTGGCCTGTTACTGGG - Intergenic
945642180 2:212443847-212443869 ACAGCTCTTGGACTATTACTGGG + Intronic
945717833 2:213380659-213380681 ACAGCTCTTGGCCTGTTACTGGG - Intronic
945725843 2:213471485-213471507 ACAGATGTTGGTCTGTTACTGGG - Intronic
946527866 2:220539957-220539979 ACAGCTCTTGGCCCGTTACTGGG - Intergenic
946703773 2:222437782-222437804 ACAGCTCTTGGCCTGTTACTAGG - Intronic
946790923 2:223299770-223299792 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
947112903 2:226738776-226738798 ACAGCTCTGGGCCTCTAATTAGG + Intronic
947440713 2:230118656-230118678 ACAGCTCCAGGCCTATTACTGGG - Intergenic
1169611114 20:7381085-7381107 GCAGTTCTTGGCCTGCTACTTGG - Intergenic
1170840540 20:19921682-19921704 TCGGCTCTGGGCCTGTTTCTGGG - Intronic
1171330070 20:24329661-24329683 ACAGCTTTTGGCCTGTCATTGGG - Intergenic
1171409816 20:24938618-24938640 GCAGCTCTTGGCCTGCCACTGGG - Intergenic
1171431672 20:25086672-25086694 ACCTCTCTTGGCTTCTTACTGGG + Intergenic
1171436122 20:25125958-25125980 GCAGCTCTTGGCCTGCCACTGGG + Intergenic
1174857432 20:54059912-54059934 ACAGCTCTGCACCTGTTGCTGGG + Intronic
1175949924 20:62577921-62577943 ACAGCTCGGGGCCTGTCACCAGG - Intergenic
1176791679 21:13326126-13326148 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1176998162 21:15580194-15580216 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1177139414 21:17342259-17342281 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1177192842 21:17870905-17870927 ACAGCTCTTTGACTGCTACTGGG - Intergenic
1177505559 21:22014172-22014194 ACAGCTTTTGGCCTGCTACTGGG - Intergenic
1177521517 21:22233943-22233965 ACAGCTCTTGGTTTGTTACTAGG + Intergenic
1177696807 21:24584239-24584261 AAAGGTCTTGGCATTTTACTGGG + Intergenic
1177874130 21:26610490-26610512 ACAGCTCTTTCCCTAGTACTTGG + Intergenic
1177913177 21:27056220-27056242 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1177933696 21:27316922-27316944 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1177991070 21:28037128-28037150 ACAGCTTGTGGCCTGTTACTGGG - Intergenic
1178060753 21:28851128-28851150 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1178063298 21:28875347-28875369 ACAGCTCTTGGCCTGCTACTGGG - Exonic
1178292882 21:31384708-31384730 ACAGCTCTTGACCTATTTGTGGG - Intronic
1178634468 21:34290207-34290229 ACAGCTCTTGGCCTGCTACTGGG + Intergenic
1179383529 21:40921060-40921082 ACAGCTCTTGGCCTGCAACTGGG + Intergenic
1179415148 21:41192511-41192533 AGAGCTCTTGGCCTGTTACTGGG - Intronic
1180591145 22:16938357-16938379 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1180681851 22:17633291-17633313 ACAGGACCTGGCCTGTTCCTTGG - Intronic
1181367435 22:22388934-22388956 ACAGCTCTTGGCCTATTACTGGG - Intergenic
1181420655 22:22795841-22795863 ACAGCTGTTGGCCTGTTACTGGG + Intronic
1183654559 22:39177169-39177191 ACTGCTCTGGGCCTGAAACTAGG - Intergenic
1184343822 22:43900899-43900921 ACAGCCCTTGGCTGGTTACCTGG - Intergenic
1184603559 22:45558365-45558387 ACAGCTCTTGGCCTGTTACTGGG - Intronic
949125663 3:443136-443158 ACAGTTCTTTGCCTGTTACTGGG - Intergenic
949170038 3:986594-986616 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
949245870 3:1924932-1924954 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
949417591 3:3830873-3830895 ACAGCTCTTGGCCTGTTACTAGG - Intronic
949445613 3:4131063-4131085 ACAGCTCTTGGCCTGTTACTGGG + Intronic
949638781 3:6012526-6012548 ACAGCTCTCAGCCTGTTACTGGG + Intergenic
949905877 3:8858067-8858089 ACAGCTCTTGGCCTACTAGCGGG + Intronic
950644835 3:14370977-14370999 TCAGCTTTTGTCCTGTTACTCGG + Intergenic
951003620 3:17592861-17592883 ACAGCTTTTGGCCTGTTACTAGG + Intronic
951122573 3:18945576-18945598 GCAGCTCTAGGCCTGTTACTGGG + Intergenic
951291517 3:20876736-20876758 ACAGCACTTGGCCTATTATTGGG - Intergenic
951384527 3:22027544-22027566 ACAGCTCTTGGCCTGTTACTGGG + Intronic
951571100 3:24064181-24064203 ATGGCTCTTGGCCTGCTACTAGG - Intergenic
951970761 3:28441856-28441878 ACAGCTCTTGGTCTGTTACTGGG - Intronic
952605443 3:35142006-35142028 ACAGCCCTTGGCTTGTTACTGGG - Intergenic
954054158 3:48007969-48007991 TCAGCTCTTGGCCTGTTACTGGG + Intronic
954152483 3:48664317-48664339 AGAGCTCTGGGCCTGATACACGG + Intergenic
954431642 3:50473819-50473841 ACAGCTCTGGGGCTGTTTCTTGG - Intronic
954511489 3:51129652-51129674 GCAGCTCTTGGCCTGTTACTGGG - Intronic
955035587 3:55264101-55264123 ACAGTTCTTGACCTCTTACTGGG + Intergenic
955418752 3:58716558-58716580 ACCACTTTTGGCCTGCTACTGGG - Intergenic
956360454 3:68441447-68441469 ATAGCTCTTGGCCTGTTACTGGG + Intronic
956509663 3:69980381-69980403 ACAGCTCTTGGCCTATTACTGGG + Intergenic
956703893 3:71982878-71982900 ACAGCTCTTGGCCTATTACTGGG - Intergenic
957298497 3:78361634-78361656 ACAGCTCTTGGCCTGCTGCTGGG - Intergenic
957529087 3:81417094-81417116 ACACTTATTGGCCTCTTACTAGG + Intergenic
957754599 3:84469435-84469457 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
958477414 3:94602471-94602493 ATAGCTGTTGGCATGTTACTAGG - Intergenic
958487676 3:94732465-94732487 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
958934304 3:100240637-100240659 ACAGCTCTGGACCTGTTACTGGG + Intergenic
959100165 3:102001092-102001114 ACAGCTCCTAGCCTGCTACTGGG - Intergenic
959203649 3:103279236-103279258 ATGGCTCTTGGCCTGTTACTGGG - Intergenic
959226777 3:103597267-103597289 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
959746012 3:109777264-109777286 ACAGCTTTTGGACTGTTACTGGG - Intergenic
959863611 3:111242480-111242502 AGAGCTCTTGTTCTGTGACTAGG + Intronic
959997861 3:112698329-112698351 AGAGCTCTTGGCCTGCTACTGGG + Intergenic
960349531 3:116575710-116575732 ACAGCTCTTGGTCTGTTACTGGG + Intronic
961869905 3:129979739-129979761 ACAGCTCCTGGCATGGTGCTAGG + Intergenic
963115132 3:141721797-141721819 AGAACTCTTGGTATGTTACTGGG + Intergenic
963268112 3:143259237-143259259 GCAACTCATGGCCTGCTACTTGG - Intergenic
963331815 3:143923364-143923386 ACAGATCTTGGCCTGTTACTGGG - Intergenic
963355661 3:144206851-144206873 ACAGCTCTTGGCCCATTTCTGGG - Intergenic
963453672 3:145516676-145516698 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
963630311 3:147723229-147723251 ACATCTTCTGGTCTGTTACTGGG + Intergenic
963661394 3:148132154-148132176 ACACCTCTTGACCTGTTACTGGG + Intergenic
964297674 3:155251930-155251952 ATAGCTCTTTTCCTGTTACTGGG + Intergenic
964679243 3:159318905-159318927 ACAGCTCATGGCCTGTTACTGGG - Intronic
965226765 3:166000755-166000777 ACAGCTCTTGGCCTGTTAGTGGG - Intergenic
965251331 3:166348258-166348280 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
965708642 3:171534770-171534792 GCAGCTCTTGGCCTGCTACTGGG - Intergenic
965893153 3:173540085-173540107 ACAGCTCTGGGCCTGCTACTGGG - Intronic
966044328 3:175530912-175530934 ACAGCTCTTGGCCTGTTACTGGG - Intronic
966445695 3:179998568-179998590 ACAGCTCTTGGTCTGTTACTGGG + Intronic
966661314 3:182418018-182418040 ACAGGTATTGCCCTGCTACTTGG + Intergenic
966896731 3:184450551-184450573 ACGGCTCCTGGCCTGTTACTGGG - Intronic
967425989 3:189328153-189328175 ACAGGTGTTGGCTTGTCACTGGG + Intergenic
967570880 3:191027028-191027050 ACTGCTTTTGGCCTGCTACTAGG - Intergenic
967704125 3:192630359-192630381 ACAGCCCATGGCCTGCTATTTGG + Intronic
967831778 3:193925999-193926021 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
967976591 3:195038722-195038744 AGAGCTCTGGGCATGTTTCTTGG - Intergenic
968800185 4:2738130-2738152 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
968906948 4:3457976-3457998 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
969038183 4:4273038-4273060 CCATCTCTGGGCCTGTTTCTGGG - Intronic
970523989 4:16913085-16913107 ATAGCCCTTGGCCTGCTACCAGG + Intergenic
971739950 4:30506751-30506773 ACAGCTCTTTGCCTGCTAGTAGG + Intergenic
971857652 4:32062824-32062846 AAAGCTCTTGACCTGTTACTGGG - Intergenic
971897542 4:32617014-32617036 ACAGCTCTTGGCTTGCTACTGGG + Intergenic
971979293 4:33732864-33732886 ACAGCTCTTGGCCTGCTATTGGG - Intergenic
972095495 4:35342698-35342720 AATGCTCTTGGCCTGTTACTGGG + Intergenic
972805918 4:42529336-42529358 ACAGCTCTTGGCTTGTTACTGGG + Intronic
972882959 4:43448145-43448167 ACAGCTGTTTGCCTGTGACTGGG - Intergenic
973098054 4:46226769-46226791 ACAGCTCTTGGCCTCCTACTGGG + Intergenic
973102926 4:46294761-46294783 ACAGCTCTTGGCCCATTACTGGG + Intronic
973118444 4:46489052-46489074 GCAGCTCTTGGCCTGTTACTGGG + Intergenic
973120979 4:46520889-46520911 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
973143683 4:46798615-46798637 ATAGCTCTTGGCCTGCTACTGGG + Intronic
973539874 4:51925071-51925093 ACACCTATTGGCCTGCTAGTGGG - Intergenic
974262369 4:59542260-59542282 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
974289571 4:59912751-59912773 ATAGCTCTTGGCTTGTCACTGGG + Intergenic
974644614 4:64674755-64674777 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
974688530 4:65265599-65265621 ACAGTTTTTGGCCTGCTACTGGG + Intergenic
974727214 4:65812532-65812554 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
974746913 4:66088896-66088918 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
974786409 4:66624112-66624134 ACAGCCCTTATCCTGCTACTGGG + Intergenic
975024470 4:69531641-69531663 ACAGCTCATGGCCTGTTACTGGG + Intergenic
975386715 4:73767500-73767522 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
975982613 4:80177268-80177290 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
976034204 4:80795813-80795835 ACAGATCTTGGTCTGTTAGTGGG - Intronic
977031624 4:91891416-91891438 ACAGCTCTTTTTCTGTTACTGGG + Intergenic
977204718 4:94155693-94155715 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
977430768 4:96928221-96928243 ACAGCTTTTGGCCTCTTACTGGG + Intergenic
977466003 4:97383383-97383405 ACAACTCTTGGTCTGTTACTGGG + Intronic
977490069 4:97700062-97700084 ACAGCTCTTGGCCTGTTACTGGG - Intronic
977626274 4:99192645-99192667 ATAGCTCTTGGCCTGTTACTGGG - Intergenic
977701729 4:100029878-100029900 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
977833273 4:101618159-101618181 ACAGCTCTTGGCCTGTTACTGGG - Intronic
977930410 4:102743810-102743832 ACAGCTCTTGGCCTGTTACTGGG - Intronic
977976561 4:103273318-103273340 ACGGCTCCTGGCTTGCTACTGGG - Intergenic
978341588 4:107725540-107725562 ACAGCTTGTGGCCTGTTACTGGG - Intergenic
978772150 4:112467771-112467793 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
978899073 4:113926809-113926831 ACAGCTCTTGGCCTGTTACTGGG - Intronic
978966854 4:114750951-114750973 ACAGCTCTTGGGCTTTTACTGGG + Intergenic
979767022 4:124474604-124474626 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
979835942 4:125367510-125367532 ACAGTTCTTGGCACGTTAATAGG - Intronic
979888566 4:126062164-126062186 ATAGCTCTTGGCCTGCTATTGGG - Intergenic
979898400 4:126189048-126189070 AAAGCTCTTGGCCTTTTACTGGG - Intergenic
980405889 4:132353782-132353804 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
980497525 4:133605353-133605375 ACAGCTCTTGGCCTGTTATTGGG - Intergenic
980582282 4:134770781-134770803 ACAGCTTTTGGCCTGCTCCTGGG - Intergenic
980629524 4:135414295-135414317 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
980697747 4:136381746-136381768 ACAGATCTTGGTCTACTACTAGG + Intergenic
980957733 4:139445926-139445948 ACAGCTTTTGGCCTGTTACTGGG + Intergenic
981160919 4:141497570-141497592 ACAGCTTTTGGACTACTACTGGG + Intergenic
981835005 4:149043954-149043976 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
981873539 4:149515205-149515227 GCAGCTCTTGGCCTGTTACTAGG + Intergenic
981979354 4:150772595-150772617 ACAACTCTTGGCCTGTCACTAGG - Intronic
982623339 4:157732892-157732914 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
982835541 4:160116650-160116672 AGAGCTCTTGGCCTGTTACTGGG + Intergenic
982847771 4:160274305-160274327 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
982851047 4:160316647-160316669 ACAGCTTTTGGCCTGCTACAGGG - Intergenic
983027392 4:162755304-162755326 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
983185065 4:164691584-164691606 ACAGCTCTTGGCCTCGTACTAGG + Intergenic
983582677 4:169324821-169324843 ACAGCTCTTGGCTTGTTACTGGG + Intergenic
984060282 4:174982015-174982037 ACAGCTCTTGGCCTGCTACTGGG - Intergenic
986037031 5:3950428-3950450 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
986087111 5:4462727-4462749 ACAGCTCTTGGCCTGTTAGTGGG + Intergenic
986742921 5:10719515-10719537 ACAGCTCTTGGCCTGTTACTGGG + Intronic
986938330 5:12918741-12918763 ACAGCTCTTGGCCTATTACTGGG - Intergenic
986959840 5:13199228-13199250 TCAGCTCTTTGCCTGTTACTGGG + Intergenic
987153178 5:15061675-15061697 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
987468187 5:18296975-18296997 ACAGCTCTTGGCCTATTACTGGG - Intergenic
987646372 5:20677320-20677342 ACAGAACTTGGCCTGCTACTGGG - Intergenic
987657136 5:20821642-20821664 ACAGGTCTTGGCCTATTACTGGG - Intergenic
987885446 5:23806509-23806531 ATGGCTGTTGGCCTATTACTGGG + Intergenic
988056567 5:26105258-26105280 ACAGCTCTTGGCCTGTTACTCGG - Intergenic
988079829 5:26401410-26401432 ACAACTCTTGGCCTGTTACTGGG - Intergenic
988107760 5:26772556-26772578 ACAGCTCTTGGCTTTTTGCTGGG + Intergenic
988160823 5:27516861-27516883 ACAGATCTAGGCCTGTTACTGGG - Intergenic
988169200 5:27632828-27632850 TCAGCTTTTGGCCAGTTACTGGG - Intergenic
988188777 5:27901246-27901268 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
988228770 5:28448136-28448158 ACAGCTCATGGCCTGTTACTGGG + Intergenic
988233286 5:28507080-28507102 GCAGCTCATGACTTGTTACTGGG - Intergenic
988562132 5:32290857-32290879 ACAGCTCTTGGCCCGTTACTGGG + Intronic
988766415 5:34382306-34382328 ACAGGTCTTGGCCTATTACTGGG + Intergenic
989045204 5:37267581-37267603 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
989097832 5:37797330-37797352 ACAGCTTTTGGAATGTTACTAGG + Intergenic
989307501 5:39974613-39974635 ACAGCTCTTGGCCTATAACTGGG - Intergenic
989457641 5:41661758-41661780 ACAGCTCTTGGCCTGTTACTAGG - Intergenic
989486382 5:41996349-41996371 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
989679025 5:44007539-44007561 ACAGCTCTTGGAGTGCTATTGGG - Intergenic
990164702 5:52981708-52981730 GCTGCTGTTGGCCTGTTATTTGG - Intergenic
991033546 5:62105932-62105954 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
991234169 5:64375173-64375195 ACAGCTTTTGGCCTATTACTGGG + Intergenic
991330735 5:65489674-65489696 ACAGTTCTTGGCTGGTTACTGGG - Intergenic
991946147 5:71900151-71900173 ACAGCTGTTGGCCTGTTACTGGG + Intergenic
991955179 5:71987264-71987286 ATGGCTCTTGGCATGATACTGGG + Intergenic
992242957 5:74789877-74789899 ACAGTTCTTGGCCTGTTACTGGG + Intronic
992344706 5:75865097-75865119 ACAGCTCCTGGCATGTTACTGGG + Intergenic
993224010 5:85141764-85141786 ACAGCCTGTTGCCTGTTACTAGG - Intergenic
993231899 5:85247523-85247545 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
993319828 5:86458588-86458610 ATAGCTCTTGGCTTGTTACCGGG + Intergenic
993367466 5:87050946-87050968 ACAGCTATTGGTCTGTTACTGGG - Intergenic
993412580 5:87591802-87591824 GAAGCTCTTGGCCTGTTACTGGG - Intergenic
993780695 5:92062404-92062426 ACAGCTCTTGACTTGTTACTGGG + Intergenic
994291371 5:98031961-98031983 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
994855433 5:105113574-105113596 ACAGCTCTTGGCATGTTACTGGG - Intergenic
994984418 5:106915719-106915741 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
995269555 5:110205456-110205478 ATAGCTCTTGGCCCAATACTGGG - Intergenic
995427731 5:112043716-112043738 AAAGCTCTTGGCCTGTTACTGGG - Intergenic
995776285 5:115727669-115727691 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
996018562 5:118567866-118567888 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
996164954 5:120212498-120212520 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
996381712 5:122868401-122868423 ACAGCGCTTACCCTGCTACTGGG - Intronic
996392201 5:122973775-122973797 ACAGCTCTTGGCCTGTTACTTGG - Intronic
996912234 5:128668984-128669006 ACAGCTCTTGGCCTGTTACTGGG + Intronic
998284091 5:140841720-140841742 ACAGCTTTTGGTCTTTTACCCGG - Exonic
998290334 5:140908541-140908563 ACAGCTCTTGGCCTATTACTGGG - Intronic
999242290 5:150134912-150134934 CCAGCTGTGGGTCTGTTACTCGG + Exonic
999351387 5:150874855-150874877 ACAGCTCTTGGCCTGTCACTGGG + Intronic
1000223243 5:159234238-159234260 ACAGCTCTTGGCTTGTTACTGGG - Intergenic
1000416974 5:160993912-160993934 ACAGCTCTTGGCCTGTTATTGGG + Intergenic
1000621617 5:163492928-163492950 ACAGCTCTGGGCCTACTGCTGGG - Intergenic
1001173597 5:169444653-169444675 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1001436085 5:171700505-171700527 ACAGCTCTTGGAGGGTTTCTTGG + Intergenic
1002655006 5:180739053-180739075 ACAGATCTTTCCCTGTTCCTTGG - Exonic
1003023141 6:2529497-2529519 ACAGCTCTTGGCATGTTACCAGG + Intergenic
1003151897 6:3559646-3559668 ACCTCTCTTGGCTTGTTCCTAGG + Intergenic
1003695896 6:8406129-8406151 ACAGCTCTTGGCCTGTTACAGGG - Intergenic
1003758609 6:9150092-9150114 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1003791222 6:9550002-9550024 ACAGCTCTTGGCCTATTACTGGG + Intergenic
1004313867 6:14569844-14569866 ACACCTCTTGGCCTCCTCCTTGG - Intergenic
1004824287 6:19403225-19403247 ACAGCTCTTGGACTGTTACTGGG - Intergenic
1005185171 6:23157083-23157105 ACAGCTGTTGGGCTGTTATTGGG + Intergenic
1006001558 6:30969086-30969108 ACAGCTCTTGGCCTATTACTGGG + Intergenic
1006062353 6:31433233-31433255 ACAGCTCTTAGCCTGTTACTGGG + Intergenic
1006273019 6:32978769-32978791 CCAGTCCGTGGCCTGTTACTGGG - Intronic
1008079356 6:47178389-47178411 TCTCCTTTTGGCCTGTTACTGGG - Intergenic
1008820400 6:55625163-55625185 ATAGCTCCTGGCCTGTTAATGGG + Intergenic
1009390110 6:63135067-63135089 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
1009660693 6:66606911-66606933 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1009770332 6:68136841-68136863 ATAGCTCTTGGCCTGCTACTGGG - Intergenic
1009806496 6:68606963-68606985 ACAGCTCCCGGCCTGTTACTGGG + Intergenic
1010252684 6:73724636-73724658 ACAGGTCTTGGTCTGTTGCCCGG + Intronic
1010323579 6:74540500-74540522 ACACCTCTTGGCCTGTTACTGGG + Intergenic
1010325328 6:74556588-74556610 ACATCTCTTGGCCTGTTACTGGG - Intergenic
1010938244 6:81886406-81886428 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1011039342 6:83013263-83013285 ACAGGTCTTAGCCTGTTACTGGG - Intronic
1011069103 6:83361676-83361698 ACAGCTCCTGGCCTGTTACTGGG + Intronic
1011136589 6:84106930-84106952 GCAGCTCTTTACCTGCTACTGGG - Intergenic
1012001907 6:93664457-93664479 ACAGCTTTTAACCTGTTACTGGG + Intergenic
1012108568 6:95197726-95197748 ACAGCTCCTGTCATGTTACTGGG - Intergenic
1012344590 6:98170330-98170352 ATAGCTGTTGGCCTATTACTGGG + Intergenic
1012362989 6:98406674-98406696 ACAGCTCTTGGCGTGCTACTGGG - Intergenic
1012499825 6:99875978-99876000 ACAGGTCATGGACTGGTACTGGG + Intergenic
1012730463 6:102874330-102874352 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1012820806 6:104082929-104082951 ACAGTTCTTGGCCTGTTACTGGG + Intergenic
1012920793 6:105219534-105219556 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1012964134 6:105655361-105655383 TCAGCTCTTGTCCTGGTACTGGG + Intergenic
1013150291 6:107439276-107439298 ACAGCTCCTGGCTTGCTACTAGG + Intronic
1013391039 6:109686726-109686748 ACAGCTCTTGGCATGCTCTTGGG + Intronic
1013406673 6:109849813-109849835 ACAGTTCTTGGCCAGTTACTGGG + Intergenic
1014363395 6:120508343-120508365 AGAGCTCTTGGCCTGTTACTGGG - Intergenic
1014416988 6:121195400-121195422 ACAGCTCTTGGCATGTTACTGGG + Intronic
1014534195 6:122596611-122596633 AGAGCTCTTGGCCTATTACTGGG - Intronic
1014538830 6:122649751-122649773 ACAGCTTTTTGCCTGCTACTGGG - Intronic
1014631642 6:123796812-123796834 ACATCTCTTGACCTGTTACTGGG + Intergenic
1015095448 6:129409590-129409612 ACAACTCTTGGCCTGTTACTGGG - Intronic
1015443283 6:133272554-133272576 ACAGCTCTTGGCCCATTACTGGG - Intronic
1015466848 6:133557706-133557728 ACAGCTCTTCGTCTGTTACCAGG - Intergenic
1015475751 6:133657502-133657524 ACAGCTCTTGGCTTGTTACTGGG + Intergenic
1015862095 6:137691852-137691874 ACAGCTTTTGGCCTGCTCCTGGG + Intergenic
1016119913 6:140332681-140332703 ACAGTTCTTGGCCTATTACTGGG - Intergenic
1016132837 6:140497996-140498018 ACAGCTCTTGGCCTGTAATTGGG - Intergenic
1016147328 6:140692705-140692727 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1016174913 6:141069084-141069106 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1016419613 6:143870671-143870693 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1016453262 6:144205616-144205638 AGAGCTTTTGGCCTGAGACTGGG + Intergenic
1016576256 6:145572576-145572598 ACAGCTCTTGGTCTGTTACTGGG - Intronic
1017044068 6:150330843-150330865 ACAGCTCTTGGCCTGCTACTGGG - Intergenic
1017388455 6:153912196-153912218 ACAGCTCTTGGCCTGTTACCAGG - Intergenic
1017977114 6:159368046-159368068 ACAGTTCTTGGTTTGTTACTGGG - Intergenic
1018122926 6:160655212-160655234 ACAGCTATTGGTCTGTTATTGGG - Intronic
1018535029 6:164810483-164810505 ACCACTCTTGGCCTGTTACTGGG - Intergenic
1018599889 6:165527537-165527559 ACAGCTATTGGCCTGGTACTGGG + Intronic
1018803790 6:167242980-167243002 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1018850838 6:167589183-167589205 ACAGCTTTTGGTCGGTTTCTTGG - Intergenic
1018955132 6:168404579-168404601 CCAGCTCTTGGCCTGCTAGTTGG - Intergenic
1019986583 7:4660853-4660875 CCATGTCTTGGCCAGTTACTGGG + Intergenic
1020396719 7:7725525-7725547 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1020710351 7:11597636-11597658 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1020960881 7:14800233-14800255 ACAGCTATGGTCCTGCTACTAGG + Intronic
1021305090 7:19022516-19022538 ATAGCTCTTGGACTGCTACTGGG - Intronic
1021988811 7:26122933-26122955 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1022078887 7:27000339-27000361 ACAGCTATTGGCCTGTTACTGGG + Intergenic
1022134469 7:27434445-27434467 GAGGCTCTTGGCCTGTGACTCGG - Intergenic
1022560857 7:31347421-31347443 ACAGCCCTTAGCCTGATCCTCGG - Intergenic
1023629932 7:42153999-42154021 AGAGCTCTTGTCCTGTTAACAGG - Intronic
1024040539 7:45550155-45550177 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1024744208 7:52388454-52388476 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1024866105 7:53906354-53906376 ACAGTTCTTGGCTTGTTACTGGG + Intergenic
1024884341 7:54124644-54124666 ACAGTTCTTTGCCTATTACTGGG - Intergenic
1026046488 7:66909088-66909110 ACAGCTCTTCACTTATTACTGGG - Intergenic
1026874900 7:73873593-73873615 ACAGCCCGTGGCCTGGAACTGGG + Intergenic
1027685799 7:81277965-81277987 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1027799767 7:82736453-82736475 AATGCTCTTGGCCTGTTATTGGG + Intergenic
1028043861 7:86091476-86091498 ATAGTTCTTGGCCTGTTACTAGG + Intergenic
1028141737 7:87281994-87282016 ACAGCTCTTGGCCTGTTATTGGG + Intergenic
1028237822 7:88382831-88382853 ACAGCTCTTGGCCTATTACTGGG + Intergenic
1028502817 7:91537961-91537983 ATAGCTCTTTGCCTGTTGATAGG - Intergenic
1028935015 7:96455073-96455095 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1029961258 7:104691058-104691080 ACAGCATTTGCCCTGTTACTTGG + Intronic
1030277459 7:107736124-107736146 ACATATCTTGGCCTGTTACTAGG + Intergenic
1030368755 7:108674037-108674059 ACAGATCTTGGCCTGTTACTGGG + Intergenic
1030457462 7:109793042-109793064 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1030479474 7:110084068-110084090 ACAGCTCTTGTTCTACTACTAGG + Intergenic
1030885704 7:114933992-114934014 ACAGTCCTTGGCCTGTTCTTGGG + Intronic
1030931286 7:115525673-115525695 ACAGCTCTTGGCCCATTACAGGG - Intergenic
1031236828 7:119188025-119188047 ACAGCTCTTGGCCTGTTACAGGG + Intergenic
1031474445 7:122205343-122205365 ACAGACCTTGGCCTGTTACTGGG - Intergenic
1031649901 7:124275998-124276020 AGAGCTCTTTGCATGTTGCTTGG + Intergenic
1031676559 7:124618374-124618396 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1031781662 7:125975591-125975613 ATAGCTCTGGGCCTGTAACCTGG + Intergenic
1031832997 7:126650026-126650048 ATAGCTCTTGTCCCGTTACTGGG + Intronic
1032923469 7:136576106-136576128 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1033076259 7:138253055-138253077 GCAGCTCTTGGCCTCTTACTGGG + Intergenic
1034357253 7:150460930-150460952 ACAGCTTTTGGCCTGCCGCTGGG - Intronic
1034544815 7:151782816-151782838 ACAGCTCTTGTCCTACCACTTGG + Intronic
1034866297 7:154645352-154645374 ACTGCGCCCGGCCTGTTACTTGG + Intronic
1037364592 8:18108260-18108282 ACAGCTCTTGGCATGTTACTTGG - Intergenic
1037953619 8:23036111-23036133 ACAGCTCTTGGCTTGTTTCTGGG + Intronic
1038077051 8:24088018-24088040 TCTGCTTTTGGCCTTTTACTGGG + Intergenic
1038454463 8:27663628-27663650 ACAGCTTTTGACCTTCTACTGGG - Intronic
1038495566 8:27999672-27999694 TCTGCTCTGGGCCTGTCACTGGG - Intergenic
1039110448 8:34035782-34035804 ACAGCTCTTGACATGCTCCTTGG - Intergenic
1039324169 8:36466516-36466538 ATAGCCCTTGGCCTGTTGATGGG - Intergenic
1039579659 8:38653956-38653978 ACAGCTCTAGCCCTGTGAATAGG + Intergenic
1039626541 8:39060143-39060165 AAAACTATTGGCCTGCTACTGGG - Intronic
1040030983 8:42823421-42823443 ACAGCTCTTGACCTGCTAATGGG - Intergenic
1041478508 8:58292426-58292448 ACAGCTCCAGGCTTGATACTGGG - Intergenic
1041986183 8:63924482-63924504 ATAGCTCTTGGCCTGTCACTGGG + Intergenic
1042001059 8:64123987-64124009 ACAGCTCTTGGCTTGTTACGGGG - Intergenic
1042342422 8:67694360-67694382 ACAGCTCTTGGCCTGCTGCTGGG + Intronic
1043232515 8:77820894-77820916 ACAGCTGTTGGCCTGCTACTCGG - Intergenic
1043259970 8:78184184-78184206 AGCGCTCTTGACCTGGTACTGGG - Intergenic
1043469771 8:80550769-80550791 CAAGCACTTGGCCAGTTACTGGG + Intergenic
1044202391 8:89452497-89452519 ACAGCTCTTGGCCCATTACTGGG + Intergenic
1044285972 8:90412437-90412459 ACAGCTCTTGTTCTGCTACTGGG - Intergenic
1044487149 8:92767113-92767135 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1045015659 8:97999558-97999580 AAAGCTCTTGGCTTGTTTCCTGG + Intronic
1045221840 8:100207074-100207096 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1046064856 8:109184020-109184042 ACAGTTCCTGGCTTGTTACTGGG - Intergenic
1046128672 8:109941593-109941615 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1046197559 8:110884232-110884254 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1046384814 8:113495466-113495488 ACAGCTCTTGGTCTGCTACTAGG + Intergenic
1046417636 8:113937785-113937807 ACAGGTCTTGGCCTGTTACTGGG - Intergenic
1046585784 8:116147710-116147732 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1047365421 8:124206755-124206777 ACAGCTCTCAGCTTGTTTCTGGG + Intergenic
1048054275 8:130848573-130848595 ACAATTGTTGGCCTGTGACTTGG - Intronic
1048642945 8:136384802-136384824 ACAGCCCTCGGCTTGCTACTGGG + Intergenic
1049238847 8:141526309-141526331 AAAGCCCTTGGCCTGGGACTGGG - Intergenic
1050482676 9:6102612-6102634 ACAGCTCTTGGCCTATTACTGGG + Intergenic
1050487010 9:6145247-6145269 GCAGCTCTTTGCCTGCTGCTGGG - Intergenic
1050696579 9:8286048-8286070 ACTGCTCTCAGCCTGTGACTGGG + Intergenic
1051966464 9:22834586-22834608 ACTGCCCTTTGCCTGTTACTGGG + Intergenic
1052101021 9:24446407-24446429 ATAGCTCTTGGCCTGCTACTAGG - Intergenic
1052227591 9:26108385-26108407 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1052368651 9:27640845-27640867 ACAGCCCTTGGCCTGTTACTAGG + Intergenic
1052442268 9:28512273-28512295 TCAGCTCCTGGCCTGTTACTGGG - Intronic
1052561524 9:30089747-30089769 ACGGCTCTTGCCCTGTTACTGGG - Intergenic
1052895471 9:33743609-33743631 ACAATTCTTGGTCTGCTACTGGG - Intergenic
1055678620 9:78691685-78691707 AGAGCTTTTGGCTTGCTACTGGG - Intergenic
1055903939 9:81271195-81271217 ATACCTCTTGGCCTGTTACTGGG - Intergenic
1056156668 9:83845218-83845240 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1056246293 9:84698603-84698625 AAAGCACTTGGCCTGTATCTTGG - Intronic
1056314233 9:85372936-85372958 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1056353870 9:85778309-85778331 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1056524935 9:87434160-87434182 ACAGCTCCTGACTTGCTACTGGG - Intergenic
1057058998 9:91986599-91986621 ACAGCTCTTGGCCTGCTACTGGG + Intergenic
1057298408 9:93862397-93862419 CCTGCTCTGTGCCTGTTACTGGG + Intergenic
1057692728 9:97300589-97300611 ATAGCTTTTGACCTGCTACTGGG - Intergenic
1058239799 9:102542502-102542524 ACAGCTCTTAGCTTGCTACCGGG + Intergenic
1058259254 9:102809659-102809681 GTAGCACTTGGCCTGTTACTGGG - Intergenic
1058544164 9:106042741-106042763 ACAGCTCTTGGCCTATTACTGGG - Intergenic
1059196504 9:112375859-112375881 ACAGCTCTTAGCCTGTTACTGGG - Intergenic
1060805141 9:126570679-126570701 ATTGCTCTTGGCCTGGTACTGGG - Intergenic
1062135473 9:134925032-134925054 ACAGCTCTTGACCTGTTACAGGG + Intergenic
1062167645 9:135115940-135115962 TCCGCTCTTGGCCTTTTGCTGGG + Intronic
1186077297 X:5894526-5894548 ACAGCCCTTGACTTGTTTCTGGG - Intronic
1186279497 X:7977127-7977149 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1186384092 X:9091753-9091775 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1186469765 X:9812100-9812122 AAAGCTCTTGGCCTGTTACTGGG - Intronic
1186495293 X:10008165-10008187 ACTGCACCTGGCCTGTTTCTAGG - Intergenic
1187310687 X:18138329-18138351 AAAGCTCTTAGCCTGTTGCTTGG + Intergenic
1187604867 X:20871871-20871893 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1188902618 X:35752779-35752801 ACAGCTCGTGGCTTCTTTCTTGG + Intergenic
1189032439 X:37464271-37464293 ATAGCCCTTGGCCTGCTACTGGG - Intronic
1189124933 X:38436181-38436203 ACAGGTCCCGGCATGTTACTGGG + Intronic
1189154882 X:38746713-38746735 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1189872981 X:45404192-45404214 ACAGCTGTTGGCCAATTTCTGGG - Intergenic
1190255321 X:48758147-48758169 ACAGCTCTTGGTCTGCTACTGGG + Intergenic
1190527877 X:51346240-51346262 ATAGCTCTTGGCCTGCTACCGGG - Intergenic
1190601536 X:52097826-52097848 ACAGCTCTTGGTCTGCTACTGGG - Intergenic
1190721635 X:53153602-53153624 ACAGCTCTTGATCTGCTACTGGG - Intergenic
1191095705 X:56671166-56671188 ACAGTTCTTGGCCTATTACTGGG - Intergenic
1191134032 X:57044479-57044501 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1191630036 X:63312580-63312602 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1191631294 X:63324887-63324909 ACAGCTTTTGGCCTGTTACTTGG + Intergenic
1191658803 X:63629798-63629820 ACAGCTCTTGGCTTGTTACTGGG - Intergenic
1191719240 X:64215701-64215723 ACAGCTCCTCGCCTGTTACTGGG - Intergenic
1191742538 X:64451300-64451322 ACAGCTATTGGCCTGTTACTGGG - Intergenic
1191759362 X:64629932-64629954 ACAGCTCTCAGCCTGTTACTGGG + Intergenic
1191769493 X:64740090-64740112 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
1191832728 X:65432315-65432337 ATCACTCTTGGCCTGCTACTGGG - Intronic
1191932927 X:66394171-66394193 ACAGCTTTTGGCCTGTTACTGGG + Intergenic
1191941260 X:66483857-66483879 ACAGTCCTTGGCCTGTTACTGGG - Intergenic
1191946355 X:66539019-66539041 ACTGCTCTTGGTCTGTTACTGGG + Intergenic
1192661562 X:73047754-73047776 ATAGCTCTTGGCATGTTACCAGG - Intergenic
1192756829 X:74055467-74055489 ACTGCTTTTGGCCTGTTAGCTGG + Intergenic
1192824488 X:74681202-74681224 ACAGCTTTTGGCTTGCTACTGGG + Intergenic
1192898705 X:75471917-75471939 ACAGCTCTTGGCCTATTACTGGG + Intronic
1192996194 X:76515585-76515607 ACAGCTCTTGGCATGTTACTGGG + Intergenic
1193053492 X:77125775-77125797 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1193297782 X:79852681-79852703 ACAGTTCTTGGCCTGTTACTGGG + Intergenic
1193356257 X:80523130-80523152 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1193464936 X:81836785-81836807 ATAGTTCCTGGCCTGTTACTGGG - Intergenic
1193832949 X:86310104-86310126 ACAGCTCTTGACCTGTTACTGGG + Intronic
1193904487 X:87225838-87225860 ACAGCTCTTTGACTATTACTGGG + Intergenic
1193914800 X:87351921-87351943 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1193957286 X:87878217-87878239 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1194179589 X:90695928-90695950 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1194443551 X:93961110-93961132 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1194482726 X:94446573-94446595 ACAGCATTTGGCCTGCTATTGGG + Intergenic
1194513416 X:94822245-94822267 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1194521082 X:94919446-94919468 ACATCTCTTGACCTGTTACTAGG + Intergenic
1194604388 X:95961961-95961983 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
1194626617 X:96233173-96233195 ACAGTTCTTGGCCTGCTACTGGG + Intergenic
1194833960 X:98658811-98658833 CGAGCTCTTGGCCTGTTACTGGG + Intergenic
1194849244 X:98852167-98852189 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
1195228470 X:102822278-102822300 ACAGCTCTTGGCCTGCTAATGGG + Intergenic
1195782351 X:108479858-108479880 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1195982621 X:110595846-110595868 ACACCTCTTGGCATGTTGCTGGG + Intergenic
1196114479 X:111984118-111984140 ACAGCTCTTAGCCCGCTACTGGG - Intronic
1196135967 X:112209836-112209858 ACAGCTCTTGGACTGTTACTGGG - Intergenic
1197002291 X:121452931-121452953 ATAGCTCATGGTCTGTTACTGGG + Intergenic
1197044416 X:121978332-121978354 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1197084194 X:122453492-122453514 ACAGCTCTTGGCTTGTTGCTGGG - Intergenic
1197097470 X:122612845-122612867 ACAGGTTTTGGCCTGTTACTGGG + Intergenic
1197245044 X:124158987-124159009 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1197372054 X:125637859-125637881 GCAGCTCTTGGCCTGTTACTGGG - Intergenic
1197379999 X:125727898-125727920 ACAGCTCTTAGCCTGTTACTGGG - Intergenic
1197386771 X:125812236-125812258 CCGGCTCTTGGCCTGTTACTAGG - Intergenic
1197477357 X:126941322-126941344 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1197521999 X:127510373-127510395 GCAGCTCATGGCATGCTACTGGG + Intergenic
1197534718 X:127673486-127673508 AGAGCTGTTGGCCTGCTACTGGG + Intergenic
1197591867 X:128419394-128419416 GCAGCTCTTAGCCTGTTACTGGG + Intergenic
1198701302 X:139400303-139400325 ACGGCTCTTGGCCTGTTACTGGG + Intergenic
1198783038 X:140257790-140257812 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1198934042 X:141887886-141887908 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1199021249 X:142881108-142881130 ACAGCTCTTGGCCTGCCACTGGG + Intergenic
1199024381 X:142919726-142919748 ACAGCTCTTGGACTGTTACCGGG + Intergenic
1199040593 X:143111107-143111129 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
1199144440 X:144348958-144348980 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1199310425 X:146314393-146314415 ACAGCTCTTGGCCCGTTACTGGG - Intergenic
1199580351 X:149354181-149354203 GCAGCTCTTGCCTTGCTACTGGG + Intergenic
1200289358 X:154857146-154857168 ATAGCTCTTGGCCTACTACTGGG + Intronic
1200340493 X:155390635-155390657 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1200521272 Y:4212037-4212059 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1200526251 Y:4278097-4278119 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1200746056 Y:6904865-6904887 ATAGCTCTTGGCTTATTACTGGG - Intergenic
1200973122 Y:9177703-9177725 ACAGCTCTTGGCCCATTACTGGG - Intergenic
1201529650 Y:14977887-14977909 AAGGCTTTTGGCCTATTACTGGG - Intergenic
1201558625 Y:15291392-15291414 ACATCTATTTACCTGTTACTAGG + Intergenic
1201748137 Y:17402980-17403002 GCAGCTGTTGGCCTACTACTGGG + Intergenic
1201796628 Y:17903404-17903426 ACAGCTCCTGGCCCATTGCTGGG - Intergenic
1201798429 Y:17926706-17926728 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1201803124 Y:17979251-17979273 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1201804927 Y:18002581-18002603 ACAGCTCCTGGCCCATTGCTGGG + Intergenic
1202137956 Y:21686810-21686832 ACAGCTCTTGGCCCATTACTGGG + Intergenic
1202358012 Y:24072466-24072488 ACAGCTCTTGGCCCATTGCTGGG - Intergenic
1202359749 Y:24095396-24095418 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1202511029 Y:25574718-25574740 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1202512766 Y:25597647-25597669 ACAGCTCTTGGCCCATTGCTGGG + Intergenic