ID: 916106331

View in Genome Browser
Species Human (GRCh38)
Location 1:161435329-161435351
Sequence AGTTATTTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916106326_916106331 16 Left 916106326 1:161435290-161435312 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG No data
916106325_916106331 22 Left 916106325 1:161435284-161435306 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG No data
916106327_916106331 15 Left 916106327 1:161435291-161435313 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG No data
916106324_916106331 25 Left 916106324 1:161435281-161435303 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG No data
916106329_916106331 4 Left 916106329 1:161435302-161435324 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916106331 Original CRISPR AGTTATTTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr