ID: 916107710

View in Genome Browser
Species Human (GRCh38)
Location 1:161443036-161443058
Sequence CTGCCCGCCGGGGTCTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916107710_916107723 24 Left 916107710 1:161443036-161443058 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916107723 1:161443083-161443105 AAGCGCAAGATGGGACGAGTCGG No data
916107710_916107718 -5 Left 916107710 1:161443036-161443058 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916107718 1:161443054-161443076 GGCAGTCTCTCGACCCTGGGCGG No data
916107710_916107721 14 Left 916107710 1:161443036-161443058 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916107721 1:161443073-161443095 GCGGCAGAGAAAGCGCAAGATGG No data
916107710_916107716 -9 Left 916107710 1:161443036-161443058 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916107716 1:161443050-161443072 GGCGGGCAGTCTCTCGACCCTGG No data
916107710_916107722 15 Left 916107710 1:161443036-161443058 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916107722 1:161443074-161443096 CGGCAGAGAAAGCGCAAGATGGG No data
916107710_916107717 -8 Left 916107710 1:161443036-161443058 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916107717 1:161443051-161443073 GCGGGCAGTCTCTCGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916107710 Original CRISPR CTGCCCGCCGGGGTCTCCAG GGG (reversed) Intergenic
No off target data available for this crispr