ID: 916108289

View in Genome Browser
Species Human (GRCh38)
Location 1:161446457-161446479
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916108289_916108293 -10 Left 916108289 1:161446457-161446479 CCCAACAGGTAGAGATGACAGAT No data
Right 916108293 1:161446470-161446492 GATGACAGATACCCACGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916108289 Original CRISPR ATCTGTCATCTCTACCTGTT GGG (reversed) Intergenic
No off target data available for this crispr